ID: 902890248

View in Genome Browser
Species Human (GRCh38)
Location 1:19438084-19438106
Sequence CTACGTCAGGGGAGGGGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 168}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902890236_902890248 -9 Left 902890236 1:19438070-19438092 CCTCCCACTACCTCCTACGTCAG 0: 1
1: 0
2: 1
3: 14
4: 159
Right 902890248 1:19438084-19438106 CTACGTCAGGGGAGGGGACCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
902890234_902890248 11 Left 902890234 1:19438050-19438072 CCATCCAAGTATTGTTCTTACCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 902890248 1:19438084-19438106 CTACGTCAGGGGAGGGGACCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
902890233_902890248 15 Left 902890233 1:19438046-19438068 CCATCCATCCAAGTATTGTTCTT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 902890248 1:19438084-19438106 CTACGTCAGGGGAGGGGACCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
902890231_902890248 29 Left 902890231 1:19438032-19438054 CCCAGACGAGGAATCCATCCATC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902890248 1:19438084-19438106 CTACGTCAGGGGAGGGGACCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
902890230_902890248 30 Left 902890230 1:19438031-19438053 CCCCAGACGAGGAATCCATCCAT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 902890248 1:19438084-19438106 CTACGTCAGGGGAGGGGACCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
902890232_902890248 28 Left 902890232 1:19438033-19438055 CCAGACGAGGAATCCATCCATCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 902890248 1:19438084-19438106 CTACGTCAGGGGAGGGGACCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
902890235_902890248 7 Left 902890235 1:19438054-19438076 CCAAGTATTGTTCTTACCTCCCA 0: 1
1: 0
2: 0
3: 16
4: 160
Right 902890248 1:19438084-19438106 CTACGTCAGGGGAGGGGACCGGG 0: 1
1: 0
2: 0
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902890248 Original CRISPR CTACGTCAGGGGAGGGGACC GGG Intronic
900415474 1:2532632-2532654 CTGGCTCAGGGGAAGGGACCAGG - Intergenic
900646506 1:3711189-3711211 TTAGGTCAGGGCAGGGTACCTGG + Intronic
900901146 1:5516877-5516899 CTATTTCAGGGCAGGGGCCCTGG - Intergenic
902890248 1:19438084-19438106 CTACGTCAGGGGAGGGGACCGGG + Intronic
903542768 1:24106195-24106217 CTCAGCTAGGGGAGGGGACCGGG - Intronic
905031460 1:34886608-34886630 AAACGTCAGGGGATGGGACTAGG - Intronic
907256328 1:53181801-53181823 TTTTGTCAGGGGAGGGGACGGGG - Intergenic
907459776 1:54598526-54598548 CTGCGTCTGGGGATGGGACCAGG + Intronic
909141183 1:71867366-71867388 CTCCGTCGAGGGAGGGGACGAGG + Intronic
910535754 1:88295697-88295719 CTGCGTCAGGGGAAAGGAGCAGG - Intergenic
915325657 1:155080223-155080245 AGACCCCAGGGGAGGGGACCGGG + Intronic
916082400 1:161242865-161242887 CTAGGTCAGGGGAGGGAAGTGGG - Intergenic
920286677 1:204884587-204884609 CAAGGTCAGGGGAGGGGCTCAGG - Intronic
920909897 1:210206541-210206563 CTATGTCAGAGGAGGGGCCTGGG + Intergenic
921152682 1:212414574-212414596 GTGCGTCAGGGGAGGGCTCCCGG - Intronic
1067189940 10:44060606-44060628 CAAAGTCAGGGTAGGGGACAGGG + Intergenic
1067259261 10:44673703-44673725 ACACAGCAGGGGAGGGGACCTGG - Intergenic
1069847184 10:71380428-71380450 CAACCTCAGGGGAGGGGAGCAGG - Intergenic
1072465284 10:95656911-95656933 CCACGTCCCGGGAGGGGACAGGG + Intergenic
1073036750 10:100569242-100569264 CTCCGTCAGGGTTGGGGACAGGG - Intergenic
1073290408 10:102410613-102410635 GCACGGCGGGGGAGGGGACCCGG - Intronic
1076022913 10:127089188-127089210 CTGAGTCACGGGAGGGGTCCAGG - Intronic
1076188041 10:128464135-128464157 CTCTGACAGGGGAAGGGACCAGG - Intergenic
1076705378 10:132298478-132298500 CATCCTCAGGGGAGGGGAGCTGG - Intronic
1077167506 11:1150432-1150454 CAAGGTCAGGGGAGGGGCCCAGG + Intergenic
1082024875 11:47564981-47565003 CTAGGACAGGGGAGGGGAGGAGG + Intronic
1083895112 11:65616069-65616091 CTGCATCAGGGGCGGGGTCCGGG - Exonic
1084196068 11:67524102-67524124 CTTAGTCCAGGGAGGGGACCAGG - Intergenic
1086596294 11:88575431-88575453 CTACATCAGGGGAGGCAACTTGG + Intronic
1088237439 11:107741256-107741278 CTAAGGCAGGGGAATGGACCTGG - Intergenic
1088823526 11:113475452-113475474 CTGTCTCAGGGGCGGGGACCGGG - Intronic
1089526639 11:119101419-119101441 CTAGGGCAGGGGCGGGAACCGGG - Intronic
1089695752 11:120215395-120215417 CTAGGGGAGGGGAGGGGACCTGG + Intronic
1091047096 11:132334492-132334514 CTATCTCAGGGCAGGGCACCTGG - Intronic
1091235059 11:134016165-134016187 CTACACCAGAGGAGGGGGCCGGG + Intergenic
1091784337 12:3233384-3233406 CTCCGCCAGGGGATGGGACAGGG - Intronic
1091973841 12:4809838-4809860 CTGGGTCTGGGGAGGTGACCTGG - Exonic
1095462540 12:42457851-42457873 TTACTTCTGGGGAGAGGACCTGG + Exonic
1096716256 12:53493230-53493252 CCAGGTCAGGGGCGGGGCCCAGG - Intronic
1096838994 12:54369779-54369801 CTCCGTAGGGGGAGGGGAGCAGG - Exonic
1101988604 12:109466684-109466706 TTGCTTCAGGAGAGGGGACCTGG - Intronic
1101997193 12:109533786-109533808 CTTCCTCAGGGAAGGGTACCTGG + Intronic
1101999477 12:109547905-109547927 CCACTTCAGGGGAGGGGAGCTGG + Intergenic
1103513255 12:121489796-121489818 CTACGTCAAGTGCGGGGGCCAGG + Intronic
1103723194 12:122985632-122985654 CTACCAAATGGGAGGGGACCTGG + Exonic
1103949386 12:124542819-124542841 CTACCACAGGGACGGGGACCAGG - Intronic
1104219836 12:126772294-126772316 CCACGTGGGGGAAGGGGACCTGG + Intergenic
1106051209 13:26191486-26191508 ACATGTCAAGGGAGGGGACCTGG + Intronic
1106071932 13:26420791-26420813 CTACGGCAGGGAAGTGGACATGG - Intergenic
1114007835 14:18333165-18333187 CTAAGTCAGGGGTTGGGTCCTGG + Intergenic
1114562318 14:23602329-23602351 CTCTGTCAGGGGAGGGGTGCCGG - Intergenic
1114659414 14:24335013-24335035 CTAGGTCCGGGGAGGGAGCCGGG + Exonic
1121327063 14:93027157-93027179 CCACCACAGGGGAGAGGACCAGG + Intronic
1122615732 14:103016491-103016513 CCAGGTGAGGGGAGGGAACCAGG + Intronic
1122615739 14:103016509-103016531 CCAGGTGAGGGGAGGGAACCAGG + Intronic
1122615746 14:103016527-103016549 CCAGGTGAGGGGAGGGAACCAGG + Intronic
1122615753 14:103016545-103016567 CCAGGTGAGGGGAGGGAACCAGG + Intronic
1122738741 14:103858648-103858670 GCCCGTCAGGGGAGGGGGCCGGG - Intergenic
1123219892 14:106845119-106845141 CGCTGTCAGGGGAGGGGCCCCGG + Intergenic
1125449809 15:39796346-39796368 TTGCCTCAGGGGAGGGGACGAGG - Intergenic
1126851351 15:52798902-52798924 CTAGCTAGGGGGAGGGGACCTGG - Intergenic
1127807498 15:62534647-62534669 CAACCTCAGAGGAGGGGAGCGGG - Intronic
1128731949 15:70027192-70027214 CCACCTCAGGGGTGGGGCCCAGG - Intergenic
1130257320 15:82331867-82331889 CTAGGGCTGGGGAGGGGACAGGG - Intergenic
1132548592 16:544859-544881 CGACGTGAGGGGAGGCGACGTGG - Intronic
1132578210 16:673619-673641 CCAGGTCAGGGGAGGGGGCTTGG - Exonic
1133211298 16:4264639-4264661 CCACTTCAGGGCAGGGGAACCGG - Intronic
1137272196 16:46909161-46909183 CTATGTCAGGGGTGGGGCCCAGG - Intronic
1137307153 16:47213600-47213622 CTATGTCACGGGAGGGGAGGGGG + Intronic
1139466282 16:67155745-67155767 CTAGGTCAGGGGATGGGACGCGG - Intronic
1139490572 16:67283881-67283903 CTAGGTGAGGGAAGGGGAGCAGG + Intronic
1141691036 16:85596238-85596260 TAACGTGAGGGGAGGGGGCCTGG + Intergenic
1141693227 16:85607960-85607982 CTCCGTAAGGGGAGGGGCCTGGG + Intergenic
1141722723 16:85765847-85765869 CTGGGGCAGGGGAGGAGACCAGG + Intergenic
1142009947 16:87708891-87708913 CTACGGCAGCAGAGGGGCCCTGG + Intronic
1142244918 16:88965963-88965985 TGATGTCAGGGGAGGGGACGGGG + Intronic
1148866480 17:50631402-50631424 CCACTTCAGGGGAGAGGACAAGG + Intergenic
1149437484 17:56645306-56645328 CTACAGCAGGGGAGGGGATGAGG - Intergenic
1149625968 17:58081511-58081533 ATACTTCAGGGAAGGGGAGCAGG + Intergenic
1150656659 17:67044167-67044189 CCAGGCCAGGGGAGGAGACCAGG - Intergenic
1151658786 17:75508012-75508034 CTGAGTGAGGGGAGGGGCCCTGG - Intronic
1155173037 18:23281112-23281134 CTAGGTCAGTGGAGGGGAGGAGG + Intronic
1160820096 19:1053889-1053911 CTAAGCCAGGGATGGGGACCTGG - Intronic
1161189116 19:2943494-2943516 CTAGCTCAGGGGAGGTGACAGGG - Intronic
1161236447 19:3200763-3200785 CTGGGGCTGGGGAGGGGACCAGG - Intronic
1161327162 19:3669454-3669476 GGCCGTCAGGGGTGGGGACCCGG + Intronic
1163829409 19:19540627-19540649 CGACGTCAGGGGGCGGGGCCAGG + Intronic
1163869687 19:19809700-19809722 CTGTGGCAGGGGAGGGCACCTGG - Intronic
1165423025 19:35731799-35731821 CTGGGTCAGGGTCGGGGACCTGG + Intronic
1167078830 19:47265465-47265487 CTGTGTGAGGGGTGGGGACCTGG + Intronic
1167991759 19:53366284-53366306 CTGCGTTAGGGGAGGTGCCCGGG + Intronic
1168115424 19:54219563-54219585 CTGGGGCAGGGGAGGGGAGCAGG - Intronic
1168121253 19:54253785-54253807 CTGGGGCAGGGGAGGGGAGCAGG - Intronic
1168181551 19:54665464-54665486 CTGGGGCAGGGGAGGGGAGCAGG + Intronic
927292631 2:21419911-21419933 CTGCGGCAGGGGAAGGGACAAGG + Intergenic
928394060 2:30930799-30930821 CTAGGTCAGTGGAAGGGGCCAGG - Intronic
930063889 2:47312819-47312841 CTAAATCAGGGGTGGGGACAGGG + Intergenic
931717825 2:65043114-65043136 CCAAGCCAGGGGAGGGGTCCAGG - Intergenic
932528588 2:72501256-72501278 TTACCTCAGGGGAGGGCACTGGG - Intronic
934601801 2:95663632-95663654 CTCCTTCAGGGGAGGGGGACGGG + Intergenic
936535153 2:113305787-113305809 CTCCTTCAGGGGAGGGGGACGGG + Intergenic
938568244 2:132539772-132539794 ATAAGACAGGGGAGGGGAACTGG + Intronic
938687420 2:133753480-133753502 TTACATCTGGGGAGGGGAACTGG + Intergenic
939432621 2:142130609-142130631 GGAAGTCAGGGGAGGGGAGCGGG + Intronic
942100105 2:172572206-172572228 CTAGGGGAGGGGAGGGGAGCAGG - Intronic
944494663 2:200294783-200294805 CCATCTCAGGGGAGGGGACCAGG - Intergenic
945403993 2:209423752-209423774 CTTTGTCGCGGGAGGGGACCAGG + Intergenic
1168819616 20:764025-764047 CCTGGTCAGGGGAGGGGATCAGG + Intronic
1170625661 20:18028127-18028149 CTAGGTCAGGGGCTGGGACTAGG + Intronic
1173325283 20:42027206-42027228 CTAGGTCTGGGGTGGGGACTAGG + Intergenic
1180432341 22:15263975-15263997 CTAAGTCAGGGGTTGGGTCCTGG + Intergenic
1181002232 22:19993243-19993265 CCATGTCAGGGGAGTGGGCCTGG - Intronic
1181359276 22:22322565-22322587 CAGGGTCAGGGGAGGGGTCCAGG + Intergenic
1181369377 22:22404317-22404339 CAGGGTCAGGGGAGGGGTCCAGG + Intergenic
1182676468 22:32043190-32043212 CAGCACCAGGGGAGGGGACCTGG - Exonic
1183548890 22:38469579-38469601 CTTCCTCAGGGGAGGTGGCCAGG + Intronic
1184225678 22:43127820-43127842 CTACACCTGGGGAGGGGCCCTGG + Intronic
1184620214 22:45671538-45671560 CTCCCCCAGGGGAGGGGATCCGG - Intergenic
950530278 3:13549059-13549081 CGGAGTCAGGGGAGGGGGCCGGG + Intergenic
952726949 3:36596600-36596622 CAACATGAGGGGAGGGGCCCAGG - Intergenic
954305038 3:49721162-49721184 CTACAACAGGGGAGGGGATGAGG - Exonic
955325964 3:58009377-58009399 CGACGGCAGGGGAAGGTACCAGG - Intronic
955525906 3:59819557-59819579 CTACCTCCAGGGAGGGGACCAGG - Intronic
961636485 3:128336124-128336146 CAGCTTCAGGGGAGGGGAGCTGG - Intronic
961637881 3:128344471-128344493 CTGCCTTTGGGGAGGGGACCTGG - Intronic
965276622 3:166691349-166691371 CTACGTCAGGGGCTTGGTCCTGG + Intergenic
967990231 3:195125202-195125224 CAAGAGCAGGGGAGGGGACCCGG + Intronic
968506112 4:972175-972197 CTCCGAAGGGGGAGGGGACCCGG + Intronic
968747498 4:2367915-2367937 CTGGGTAAGGGGAGGGCACCTGG - Intronic
968816667 4:2825006-2825028 CAAGGTCAGAGGAGGCGACCCGG - Intronic
969364286 4:6685014-6685036 CAACCTCAGGTGAGGGGAGCGGG + Intergenic
976297526 4:83486913-83486935 CTACTTCAGGGAAGGACACCGGG + Intronic
984832434 4:183988039-183988061 CTAATGCATGGGAGGGGACCTGG + Intronic
986812348 5:11373600-11373622 GGACCTCAGGGGAGGGGCCCAGG + Intronic
989665908 5:43853546-43853568 CTAAGACAGGGCAAGGGACCAGG + Intergenic
999872803 5:155770145-155770167 CTAAGCCTGGGGAGGGGACAGGG - Intergenic
1000037537 5:157460362-157460384 GTACGGCAGGGCTGGGGACCAGG + Intronic
1000505733 5:162115460-162115482 TTAGGTGAGGGAAGGGGACCAGG + Intronic
1001035038 5:168291593-168291615 CTGCGCGCGGGGAGGGGACCCGG + Intergenic
1001474995 5:172044284-172044306 CTATGTGGGGGGCGGGGACCGGG - Exonic
1001993131 5:176133768-176133790 CTGCGGAAGGGGTGGGGACCGGG + Intergenic
1004553372 6:16672058-16672080 ATAGGTCAGGGGTGGGGCCCAGG - Intronic
1006034372 6:31200097-31200119 GTAATTCAGGGAAGGGGACCTGG - Intronic
1006361597 6:33590177-33590199 CTGGGCCAGGGCAGGGGACCAGG - Intergenic
1007801434 6:44397097-44397119 CAACCTCAGGGGAGGGGAGAAGG - Intronic
1010980153 6:82363032-82363054 CTACATCTGGGGAGGGGGGCGGG + Intergenic
1012490681 6:99779932-99779954 CTAGCACAGGGGTGGGGACCTGG + Intergenic
1016452158 6:144194497-144194519 CTTGGTGAGGGGAGGGGACATGG + Intergenic
1017088667 6:150738699-150738721 CCACGGCTGGGGAGGGGACAGGG - Intronic
1017792015 6:157808637-157808659 CTATGTCAGTAGAGGGCACCTGG + Intronic
1019167484 6:170108375-170108397 CCACGTGAGGGGAAGGGTCCTGG - Intergenic
1019686511 7:2384857-2384879 CAAAGTCAGGGCAGGGGAGCAGG + Intergenic
1023829510 7:44030667-44030689 CCACATCTGGGGAGGGCACCAGG - Intergenic
1029739819 7:102484925-102484947 CCACATCTGGGGAGGGCACCAGG - Intronic
1029757818 7:102584104-102584126 CCACATCTGGGGAGGGCACCAGG - Intronic
1029775754 7:102683165-102683187 CCACATCTGGGGAGGGCACCAGG - Intergenic
1030218088 7:107067120-107067142 GTAAGTCAGGGAAGGGGAGCAGG - Intronic
1032683297 7:134207631-134207653 CTGCGTCAGTGGAGGGGATCGGG + Intronic
1036716677 8:11131597-11131619 CTACTTCAGGGGAAGAGAACTGG - Intronic
1037273695 8:17156397-17156419 CCACGCCAGGGGAGGCGGCCGGG + Exonic
1039330685 8:36533600-36533622 CTACCTCTGGGGAGGGGAGGGGG + Intergenic
1039912567 8:41836508-41836530 CCACCTCAGGGGAGGGGGACCGG - Intronic
1045412432 8:101932190-101932212 CTGTGGCAGGGGAGGGGGCCTGG - Intronic
1046542954 8:115610589-115610611 CAACGGCAGGGGAGGGTACAGGG + Intronic
1047690513 8:127348897-127348919 CTGGGTCTGGGGTGGGGACCAGG - Intergenic
1049918001 9:337060-337082 CTGCATCATGGGAGGGGAACTGG - Intronic
1058063675 9:100525656-100525678 CTACCTCTGGGAAGGGGACAGGG - Intronic
1059217199 9:112575124-112575146 CTACCTCACAGGAGGAGACCTGG - Exonic
1060809317 9:126601688-126601710 CTAGGTCAGGGGAGGGCACTGGG + Intergenic
1061006250 9:127929861-127929883 CAGCCTCAGGGGAGGGGGCCAGG + Exonic
1061958189 9:133974405-133974427 GGACGTCAGGTGAGGTGACCAGG + Intronic
1189292269 X:39894826-39894848 CTCCACCAGGGGAGGGGACAGGG + Intergenic
1190065491 X:47239109-47239131 ATACGTGCAGGGAGGGGACCAGG + Exonic
1190748058 X:53338285-53338307 CCACCTCAGGGGAGGGGAGAGGG - Intergenic
1190798734 X:53769490-53769512 CCACCTCAGGGGAGGGGAGAGGG - Intergenic
1196760744 X:119198435-119198457 GAAAGTCAGGGAAGGGGACCTGG + Intergenic
1198394004 X:136205278-136205300 CCACAGCCGGGGAGGGGACCAGG + Intronic
1199694291 X:150332555-150332577 CCACGTCAGAGGTGGGGACAAGG - Intergenic
1199745598 X:150770331-150770353 CTACGTGAAGGGAGAGAACCTGG - Exonic
1200259083 X:154602424-154602446 CTCCGTCGGGACAGGGGACCTGG + Intergenic