ID: 902890284

View in Genome Browser
Species Human (GRCh38)
Location 1:19438368-19438390
Sequence AAGGAAATACAGAGGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 621
Summary {0: 1, 1: 0, 2: 7, 3: 54, 4: 559}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902890281_902890284 -8 Left 902890281 1:19438353-19438375 CCAGAAAGTCAGGGAAAGGAAAT 0: 1
1: 0
2: 3
3: 49
4: 391
Right 902890284 1:19438368-19438390 AAGGAAATACAGAGGAAGCTGGG 0: 1
1: 0
2: 7
3: 54
4: 559
902890280_902890284 -5 Left 902890280 1:19438350-19438372 CCTCCAGAAAGTCAGGGAAAGGA 0: 1
1: 0
2: 1
3: 35
4: 417
Right 902890284 1:19438368-19438390 AAGGAAATACAGAGGAAGCTGGG 0: 1
1: 0
2: 7
3: 54
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902890284 Original CRISPR AAGGAAATACAGAGGAAGCT GGG Intronic
900571823 1:3362421-3362443 AAGGAAATATAAAGGAGGCTGGG + Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900600424 1:3500408-3500430 CAGGAAAGGCAGAGGAAGCCAGG + Intronic
900715691 1:4142111-4142133 CAGAAATTCCAGAGGAAGCTGGG + Intergenic
900875522 1:5340035-5340057 AAGGAGATTCAGAGGGAGCAGGG + Intergenic
901528311 1:9837909-9837931 AAGGAAAGAAAGAGGAAGGAAGG + Intergenic
902208626 1:14888379-14888401 CAGGAAAGAGAGAGGAAGCGAGG + Intronic
902680068 1:18037073-18037095 AAGGGAATCCAGGAGAAGCTGGG + Intergenic
902890284 1:19438368-19438390 AAGGAAATACAGAGGAAGCTGGG + Intronic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
904193967 1:28770825-28770847 AAGGAAAGAGAGAGGAAGAAAGG - Intergenic
904546111 1:31274136-31274158 AAGGAAATAAAGTGCAAGCCAGG - Intronic
904556147 1:31365944-31365966 AAGGAAAGACAGAGTGAGATGGG + Intronic
905489555 1:38332842-38332864 AAGAAAAAAAAGAGGAACCTGGG - Intergenic
905543177 1:38776457-38776479 AAGGGAACAGAGTGGAAGCTAGG + Intergenic
905998348 1:42401687-42401709 AAGGAAATAAATGGGAAGTTAGG + Intronic
906238871 1:44229333-44229355 AAGGAAATGAAGAGGCAGCACGG + Intronic
906743543 1:48205890-48205912 AAGGAGATTCAGAGGAGCCTGGG - Intergenic
907445661 1:54506269-54506291 CAGAAAATACAGAGGAAACTGGG - Intergenic
908151871 1:61310787-61310809 CAGGAAATTCAGAGGAAGGAAGG - Intronic
908746059 1:67377710-67377732 AAGGAAAGAGAGGGGAAACTGGG - Intronic
909065233 1:70928336-70928358 GAAGAAATGAAGAGGAAGCTGGG + Intronic
909894581 1:81051325-81051347 AAGGAAATGAAAATGAAGCTGGG + Intergenic
912485554 1:110024770-110024792 TAGGTAAGACAGAGCAAGCTAGG + Intergenic
912661962 1:111539630-111539652 AAGGAACTACAGAAAAAGCAAGG + Intronic
912998424 1:114554913-114554935 ATGAAAATACAGAGAAAGATGGG + Intergenic
914934582 1:151967376-151967398 AAGGAAAAAGAGAGGAAGTAAGG - Intergenic
915700651 1:157791690-157791712 AAAGAAAAAAAGAGGAACCTAGG + Intergenic
915750847 1:158208948-158208970 AAGGAGATAGAGAGGGAGTTTGG - Intergenic
916315720 1:163445831-163445853 AAGGAAAAACAAAGGAGGCCCGG - Intergenic
916393546 1:164359917-164359939 AAGGAAGAACAGAAGAAACTTGG - Intergenic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
916886951 1:169078710-169078732 AAGGAGAGACAGAGGGAACTAGG + Intergenic
916961972 1:169897468-169897490 AAGGAAATACAGAGTCCTCTAGG - Intergenic
917076116 1:171206940-171206962 AGAGAAATAGAGAGGAATCTAGG + Intronic
917688349 1:177441638-177441660 AATGAAATACATAGTAAACTGGG + Intergenic
917944164 1:179952530-179952552 ACAGAAATACAGAGGAAACGAGG + Intergenic
918408750 1:184236550-184236572 AAAGAAATAAAGAGCAGGCTGGG - Intergenic
918640422 1:186833999-186834021 AAGCAAATGAAGAGGAAGATTGG - Intronic
918763584 1:188448172-188448194 AATGAAATACATAGGAACCTGGG - Intergenic
918796460 1:188904119-188904141 AGGGAAATAGAGAGGAAGGAAGG + Intergenic
919077461 1:192830904-192830926 AAGGAAAGAAAGAGGAAGGAAGG + Intergenic
919938662 1:202271509-202271531 CAGAAAATACAGGGGAGGCTGGG + Intronic
921128639 1:212199895-212199917 AAGGAAATACAAAGCAAGTATGG + Intergenic
921695541 1:218204899-218204921 TTGGAAATACAGAAGAAGTTTGG - Intergenic
923178200 1:231489704-231489726 ATGGAAATAAAGAGGGAGCAGGG + Intergenic
923236132 1:232035128-232035150 AAGGAACTCCAGAGGATCCTGGG - Intronic
923682595 1:236130259-236130281 AAAAAAATGCAGAGGAACCTCGG + Intergenic
924127542 1:240870938-240870960 ATGGAAATACTGTGGAAGGTAGG - Intronic
924709071 1:246519355-246519377 ATGGAAAGACAGAGGACCCTGGG - Intergenic
924812301 1:247414063-247414085 AAGAAAATAGAGAAGAAGCCAGG - Intergenic
1063239041 10:4149456-4149478 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239045 10:4149482-4149504 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239049 10:4149508-4149530 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239053 10:4149534-4149556 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239057 10:4149560-4149582 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063817436 10:9791717-9791739 AAAGAAATACATAGAAAACTGGG + Intergenic
1065324480 10:24538632-24538654 AAGGAAAAAGAGAGGAAGGGAGG + Intronic
1065434152 10:25690018-25690040 AAGGAAATACAGAAGATTCTGGG - Intergenic
1065837070 10:29668246-29668268 AAGAAAAAACAGAGGAATATGGG + Intronic
1066065981 10:31761109-31761131 AAGGGAAGACAGAGCAAACTGGG - Intergenic
1067407037 10:46032602-46032624 AAGCAAACACAGAGGAATGTGGG + Intergenic
1067949163 10:50712541-50712563 AAGGAATTATAGAGGAAGGAAGG + Intergenic
1068416963 10:56735304-56735326 AAGGAAAGACAGAAGAAGGCAGG - Intergenic
1068627293 10:59263081-59263103 AAGGAAATACAGGAGAGGATGGG + Intronic
1068894170 10:62181305-62181327 AAGGGAATACAGAGTGAGTTTGG + Intergenic
1069578302 10:69546040-69546062 AAGGAAATACAAGGTAAACTCGG - Intergenic
1069778605 10:70941108-70941130 AAGGAAGCACAGAGGCAGCAGGG + Intergenic
1069996115 10:72343125-72343147 CAGGAAATGCAGAGGAAGCAGGG + Intronic
1071332506 10:84573985-84574007 AAGGAAAAATAGAGGAAACTGGG - Intergenic
1071420703 10:85494503-85494525 AAGGAAAGAAAGAGGAAGGAAGG - Intergenic
1071441613 10:85702907-85702929 AAGGAAAGAAAGAGGAAGAAGGG + Intronic
1072054680 10:91742892-91742914 AAGGAAATTCACTGGAATCTAGG - Intergenic
1072311279 10:94157713-94157735 AAGGAACTACAGGGATAGCTGGG - Intronic
1072527205 10:96283269-96283291 AAGGAAATGCTGATGAAGCCTGG - Intergenic
1072723074 10:97792634-97792656 AAGGAAATAAACAGGAGGCTGGG + Intergenic
1072897497 10:99379342-99379364 AAGGAAATAAAGAGGTAATTGGG + Intronic
1073343501 10:102764107-102764129 AAGAAAATACAGAGAAGGCCGGG - Intronic
1073589076 10:104738932-104738954 AAGGAAAGCCAGAGGAACCCAGG + Intronic
1073742559 10:106425253-106425275 AAGGAACAACAGAGGAGGCCAGG + Intergenic
1075228351 10:120649749-120649771 TAGGAAATGCAGAGGAACCCAGG + Intergenic
1076432668 10:130417261-130417283 TTAGAAATACAGAGGAAGGTTGG - Intergenic
1077825400 11:5803451-5803473 AAGGAAATAAAAGGGAAGCAGGG + Intronic
1078294083 11:10047999-10048021 AGGGAAATATAGAGGAGGATAGG - Intronic
1078465341 11:11546078-11546100 AAGGAATTATAGTGGCAGCTTGG - Intronic
1078629065 11:12985147-12985169 AAGAAAGTACGGAGGAAGATGGG + Intergenic
1078890978 11:15559031-15559053 AAGGAAAGAAAGAGGAAGGAAGG + Intergenic
1079073349 11:17367443-17367465 AAGGGGAAACAGAGAAAGCTTGG + Intronic
1080125285 11:28726700-28726722 AGGGAAATACAGAAGAATCTAGG - Intergenic
1080454730 11:32407925-32407947 TAGGAAATACAGGGGAGGCCAGG + Intronic
1080825045 11:35841226-35841248 TAAGAAATACAGAGAAAGCCAGG + Intergenic
1080871914 11:36243774-36243796 AAGGAAATACAGCCAGAGCTGGG + Intergenic
1081627917 11:44666489-44666511 AAGGAAATCCAGAGGAGGGAAGG - Intergenic
1082720589 11:56670406-56670428 AGGGTAATGTAGAGGAAGCTTGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085078075 11:73609851-73609873 AAGGAAATGCAAAGTGAGCTTGG - Intergenic
1085827087 11:79859144-79859166 AAAGGCATACAGAGGAAGCAAGG + Intergenic
1085876796 11:80417259-80417281 AAAGAATTACAGAGGAGTCTAGG - Intergenic
1085924583 11:81000770-81000792 AAGGAAAGAAGGAGGAAGATTGG - Intergenic
1085991564 11:81852978-81853000 AAGAAAATGCACATGAAGCTGGG + Intergenic
1087257120 11:95968440-95968462 AAAGAAATAAAGTAGAAGCTTGG - Intergenic
1087279460 11:96193991-96194013 AAGGACATAAAAAGGATGCTTGG - Intronic
1087784490 11:102339607-102339629 AAGGAAATTAAGAGAAAGGTTGG - Intergenic
1089168434 11:116495672-116495694 CAGCAAATACAGAGAAAGGTAGG - Intergenic
1090505365 11:127306844-127306866 AAGGAAAGAGAGAGGAAGGAAGG - Intergenic
1092846428 12:12589462-12589484 AAGGAAGGACAAAGGAAGGTTGG + Intergenic
1093778972 12:23111998-23112020 AAGGAAAGAAAGAGGAAGGAAGG - Intergenic
1094619522 12:32066816-32066838 AAGGAAACAAGGAGGAAGCCGGG + Intergenic
1094802580 12:34053787-34053809 AAGGAATTCCAGAGGAAGAGAGG + Intergenic
1095115741 12:38349729-38349751 AAGGAATTCCAGAGGAAGAGAGG + Intergenic
1095309685 12:40683620-40683642 AAGGAAGTACAGATGACACTTGG - Intergenic
1095475592 12:42584233-42584255 AAAGAAAAATAGAGGAATCTGGG + Intronic
1095645629 12:44542647-44542669 AAAGAAACACAGAGAAAGCCTGG + Intronic
1095843775 12:46723407-46723429 AAGACAAAGCAGAGGAAGCTCGG - Intergenic
1096597581 12:52706532-52706554 AAGGAAAGAGAGGTGAAGCTAGG + Intergenic
1097283934 12:57863401-57863423 AAGGGGAGACAGAGGCAGCTGGG - Intergenic
1097787143 12:63773287-63773309 AAGGAAAGAAAGAGGAAGGAAGG + Intergenic
1099401808 12:82210208-82210230 AAGGAAATACCAAGGAAGACTGG - Intergenic
1099620930 12:85002267-85002289 GATGGAAGACAGAGGAAGCTGGG + Intergenic
1100525500 12:95415658-95415680 AAGGAAGAAAAGAGGAAGCCAGG - Intergenic
1101073110 12:101097058-101097080 AATGGGATACAGAGGATGCTGGG + Intronic
1101765210 12:107691591-107691613 AAGGGATTGCAGAGGTAGCTGGG + Intronic
1101858395 12:108463024-108463046 AGGGAAAGACAGAGGAAGGGAGG + Intergenic
1102047752 12:109840388-109840410 AAGGAAAAACACAGGAAACTAGG + Intergenic
1102052991 12:109876654-109876676 AAGGAAAGAAAGAGGAAGGAAGG + Intronic
1102313664 12:111867779-111867801 AAGGAAGGGCAGAGGAAGCGAGG - Intronic
1102350668 12:112189678-112189700 AGGGAAATAAAGAGGAAAGTTGG - Intronic
1102452907 12:113055103-113055125 AAAGGAACACAGAGGAAGATGGG + Intergenic
1102876813 12:116455346-116455368 AAGGAAGCAAACAGGAAGCTAGG - Intergenic
1103259275 12:119572631-119572653 AAAGAAAAACAGAGGAGGCTGGG + Intergenic
1103277344 12:119723577-119723599 AAGGAAAAAGACAGGAAACTGGG + Intronic
1104144485 12:126019307-126019329 ATGGAAACACAAAGGGAGCTGGG + Intergenic
1106504460 13:30359115-30359137 AAATAAATAAAAAGGAAGCTAGG - Intergenic
1106865445 13:33959444-33959466 AAGGGAATCAAGAGGAAGCCAGG - Intronic
1107052958 13:36072053-36072075 GAAGAAATGGAGAGGAAGCTGGG - Intronic
1107229569 13:38091831-38091853 AAGGGAAAACAGAGGAAGAAGGG + Intergenic
1107475441 13:40731274-40731296 AAGAAAAGACAGAGGAGGCCGGG + Intronic
1107649039 13:42525942-42525964 GGGAAAATAGAGAGGAAGCTAGG + Intergenic
1107837358 13:44422710-44422732 AAGGAGAAACACAGGAAGATAGG - Intergenic
1108398144 13:50009951-50009973 AAGGAAATACACAAAAATCTAGG + Intronic
1108539629 13:51427938-51427960 AAGGAAAGACATAGGAAGAAAGG + Intronic
1109143166 13:58742616-58742638 AATGAAATAAATAGAAAGCTTGG - Intergenic
1109255356 13:60073598-60073620 AATGAAAAATAGAGGCAGCTGGG - Intronic
1109279896 13:60344070-60344092 AAGGAAATAAACAAGGAGCTGGG + Intergenic
1110398582 13:75063028-75063050 AAGGAAAGAAAGAGGAAGGAAGG + Intergenic
1110575819 13:77053770-77053792 AAGAAAATACAGAGGATGAATGG - Intronic
1110719206 13:78742616-78742638 AAGGAAAGAAAGAGGAAGCTGGG - Intergenic
1111119643 13:83830255-83830277 AAAGAAATACAGATCAAGATTGG + Intergenic
1111403833 13:87776105-87776127 GAGGAAATGAGGAGGAAGCTGGG - Intergenic
1112483511 13:99799115-99799137 AGGGAAAGACAGTGGAGGCTGGG + Intronic
1113202784 13:107885619-107885641 AAGGAAATACAGTGGAACTTTGG - Intergenic
1114641458 14:24224831-24224853 CAGGAAATACAGAGGAAAAGAGG + Intronic
1114761434 14:25320837-25320859 AAGGAAGTAGAGAAGAAGATAGG - Intergenic
1114780748 14:25535919-25535941 AAAGACATAGAAAGGAAGCTGGG + Intergenic
1114840402 14:26256360-26256382 AAGGAAAAATAGAGGGTGCTAGG - Intergenic
1114933781 14:27507457-27507479 GAGGAAAGACACAAGAAGCTGGG - Intergenic
1116652260 14:47608589-47608611 AAGGAAATTCAGAGGCAACAAGG + Intronic
1116801363 14:49447369-49447391 CAGCAAATGCAGAGGATGCTTGG - Intergenic
1118456703 14:65951477-65951499 ATGGAAATACAAAGGAAGGCTGG - Intergenic
1118555405 14:67013268-67013290 CAGGAAAAACATAGGAAGTTAGG - Intronic
1118572868 14:67211272-67211294 AAGGAAAGAGAGAGGAAGATAGG + Intronic
1119428155 14:74549466-74549488 AAGGAGATAAAGAGGAGGCCTGG + Intronic
1119639385 14:76303290-76303312 AAGGAAAGACTGAGGAAACGAGG - Intergenic
1119863296 14:77952791-77952813 AAGAAAAGACACAGGAGGCTGGG + Intergenic
1119978687 14:79054962-79054984 ATGTAAATACAGTGGTAGCTTGG + Intronic
1120352356 14:83379059-83379081 AAATATATACAGAGGAAGGTTGG - Intergenic
1120365962 14:83569684-83569706 AAGAAAAGACAGTGGAAGTTAGG - Intergenic
1120472411 14:84942768-84942790 AAGGTAATGCTGAAGAAGCTGGG + Intergenic
1120983996 14:90316677-90316699 AAGAAAACAAAGAGGAAGCATGG - Exonic
1122550624 14:102547258-102547280 AAGGAAAGAAAGAGGAAGGAAGG + Intergenic
1122800531 14:104227229-104227251 CAGGAAATGCACAGGAAGCGAGG - Intergenic
1123046826 14:105521510-105521532 AAGGAAAGAGAGAGGAAGGGAGG - Intergenic
1123459427 15:20455811-20455833 AGGGAAGTCCAGAGGAAACTAGG - Intergenic
1123658634 15:22544607-22544629 AGGGAAGTCCAGAGGAAACTAGG + Intergenic
1123666174 15:22610757-22610779 AAGGAGCTACAGGAGAAGCTTGG - Intergenic
1124260696 15:28187790-28187812 AAGGCAGAACAGAGGAAGGTTGG - Intronic
1124265657 15:28231632-28231654 AGGGAAGTCCAGAGGAAACTAGG - Intronic
1124312499 15:28639103-28639125 AGGGAAGTCCAGAGGAAACTAGG + Intergenic
1124319997 15:28705163-28705185 AAGGAGCTACAGGAGAAGCTTGG - Exonic
1124482514 15:30090254-30090276 AAGGAGCTACAGGAGAAGCTTGG + Exonic
1124488971 15:30142356-30142378 AAGGAGCTACAGGAGAAGCTTGG + Exonic
1124507946 15:30294911-30294933 AAGGAAAGACAGAGGCACATCGG + Intergenic
1124521060 15:30406955-30406977 AAGGAGCTACAGGAGAAGCTTGG - Exonic
1124537602 15:30559265-30559287 AAGGAGCTACAGGAGAAGCTTGG + Exonic
1124544057 15:30611320-30611342 AAGGAGCTACAGGAGAAGCTTGG + Exonic
1124564021 15:30798755-30798777 AAGGAGCTACAGGAGAAGCTTGG + Intergenic
1124735609 15:32243746-32243768 AAGGAAAGACAGAGGCACATCGG - Intergenic
1124754559 15:32395967-32395989 AAGGAGCTACAGGAGAAGCTTGG - Exonic
1124761054 15:32448322-32448344 AAGGAGCTACAGGAGAAGCTTGG - Exonic
1124777580 15:32600741-32600763 AAGGAGCTACAGGAGAAGCTTGG + Exonic
1125128167 15:36249212-36249234 AAGAATATACAGAAGAAGATAGG - Intergenic
1125440597 15:39698992-39699014 TCGGAAAGACAGAGGAGGCTAGG - Intronic
1125598585 15:40903105-40903127 GAGGAGCTGCAGAGGAAGCTGGG + Exonic
1125881210 15:43197685-43197707 AAGGAACAACAGATGTAGCTTGG - Intronic
1126314518 15:47356019-47356041 AGGGAAATTCAGAGGAATCATGG + Intronic
1126436228 15:48641214-48641236 AAGAAAACACAGCAGAAGCTGGG + Intronic
1126584830 15:50274093-50274115 AATTAAAAACTGAGGAAGCTAGG + Intergenic
1126595985 15:50384761-50384783 AAGAAAATATACAGGGAGCTGGG + Intergenic
1126882760 15:53117059-53117081 AAGGAAAGAAAGAGGAAGGAAGG - Intergenic
1127120839 15:55770800-55770822 AAGGAAATACAGAGGTAAAGAGG - Intergenic
1127326859 15:57904283-57904305 AAAGACAGACAGAGGAGGCTTGG - Intergenic
1127429719 15:58891953-58891975 AACTAAATACACAGGAAGCTAGG + Intronic
1127632666 15:60841273-60841295 TATGAAACACAGAGGAATCTAGG + Intronic
1128847550 15:70914638-70914660 TAGTGAATACAGAGGAATCTAGG + Intronic
1131139478 15:89965392-89965414 AACAAATGACAGAGGAAGCTGGG + Intergenic
1131203746 15:90423835-90423857 AAGGAAATATAAAGAATGCTGGG + Intronic
1131542870 15:93289289-93289311 AAGGAAAGAAAGAGGGAGATGGG - Intergenic
1131616995 15:94026767-94026789 AAGGAAATTCAGAGGAACAAGGG - Intergenic
1131906670 15:97150170-97150192 ACTGAAATACAGATGAACCTTGG + Intergenic
1131978823 15:97975219-97975241 AAGGAAATGGAGAGGAGGATGGG - Intergenic
1132856819 16:2048787-2048809 AGGGAAATGCAGAGAAGGCTGGG + Intronic
1133247676 16:4460023-4460045 AAAGAAATACAAAAGAAACTAGG - Intergenic
1133456117 16:5943913-5943935 AAGGAAAGACAGAGGAGGAGTGG - Intergenic
1133802898 16:9098398-9098420 AAGTAAATACATAAGTAGCTAGG + Intronic
1133838018 16:9383741-9383763 AAGGAAATAAACAGGGTGCTAGG - Intergenic
1134302640 16:13005334-13005356 AAGGAAATATAGAAGATGCTGGG + Intronic
1134341588 16:13351598-13351620 AAGGAAATAAACAGTAACCTGGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134558084 16:15183428-15183450 AAGGAAATAGAGAAGAGACTTGG - Intergenic
1134918617 16:18095030-18095052 AAGGAAATAGAGAAGAGACTTGG - Intergenic
1135039877 16:19110096-19110118 AAATAAAGACAGAGGTAGCTGGG + Intergenic
1135263908 16:21005206-21005228 AAGGAAATACAGAAGGAGAGAGG - Intronic
1136232579 16:28895245-28895267 AAGGAATAACAGATGAAGTTGGG - Intronic
1136703835 16:32169018-32169040 AGGGAAGTCCAGAGGAAACTAGG - Intergenic
1137032647 16:35538318-35538340 AAAGAAAAACAGATGAGGCTGGG + Intergenic
1138167482 16:54816695-54816717 AAGGCACAAAAGAGGAAGCTTGG - Intergenic
1139018432 16:62718417-62718439 AAGGAGATAGAGCAGAAGCTTGG + Intergenic
1139290620 16:65855124-65855146 AAGGAAAGAGAGAGGAAGGAAGG + Intergenic
1139930943 16:70525565-70525587 AAAGCAAAAGAGAGGAAGCTAGG - Intronic
1141226176 16:82118117-82118139 AAGAAAATAAAGAGTAAACTAGG + Intergenic
1141235238 16:82209993-82210015 AAGGAAAGAGAGAGGAAGGAAGG - Intergenic
1141285853 16:82670921-82670943 TAGGAAATACAGAGAAGCCTCGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141761024 16:86028852-86028874 AAAGAAACTCAGAGGAAGGTTGG - Intergenic
1141995033 16:87631191-87631213 AAGGAAATACCCAGGAAAATGGG - Intronic
1203066221 16_KI270728v1_random:1020710-1020732 AGGGAAGTCCAGAGGAAACTAGG + Intergenic
1143176340 17:4957265-4957287 AGGGACTCACAGAGGAAGCTGGG + Intergenic
1143388862 17:6548352-6548374 AAGGAAACACAGAGGCTGCGAGG + Intronic
1144159783 17:12546561-12546583 AAAGGAATACTGAGGAAGTTTGG - Intergenic
1145045928 17:19615843-19615865 AAGGGAATGTAGAGGAGGCTTGG + Intergenic
1145764092 17:27446127-27446149 AAGGCAAGACAGAGGAAGGGAGG + Intergenic
1146804973 17:35857820-35857842 AAGGGAACATAGAGGAAGGTAGG + Intronic
1149259664 17:54864953-54864975 AAGGAAAACCAGAGGGAGTTAGG - Intergenic
1149436375 17:56637048-56637070 AAGGAAAAACAAAGGAAGGCAGG + Intergenic
1149904803 17:60515867-60515889 AAGGAACATCAGATGAAGCTGGG + Intronic
1150059240 17:62050061-62050083 AAGGAAAGGGAGAGGAAGCCAGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150925423 17:69527374-69527396 AAGGGAATCCAAAGGAAGTTGGG + Intronic
1151075324 17:71265708-71265730 AAGAAAAAACACAGGAAGCCAGG + Intergenic
1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG + Intergenic
1152110361 17:78354370-78354392 GTGGAAAGACAGAGGAAGGTTGG + Intergenic
1153904413 18:9648448-9648470 AAGGAATTTCAGAGCAATCTTGG + Intergenic
1154122528 18:11663514-11663536 AGGGAAACACAGAGGTAACTGGG - Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155737833 18:29246189-29246211 GAGGAAATGCAGAGTAAGTTAGG - Intergenic
1156866451 18:41894166-41894188 AAGGAAACAGAGAGGTAGCTTGG - Intergenic
1157037776 18:43996980-43997002 AAGGTCATACTTAGGAAGCTTGG - Intergenic
1158106566 18:53891344-53891366 CAGGAAAGACAGAGGAAACAAGG + Intergenic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1158918101 18:62157162-62157184 AAGTAAATACACATGGAGCTGGG - Exonic
1159062091 18:63526274-63526296 AAATAAATAAAAAGGAAGCTAGG - Intergenic
1159452885 18:68624945-68624967 TAGGAAATACAGAAGAATATAGG - Intergenic
1159508954 18:69371315-69371337 CAGCAAAAAAAGAGGAAGCTAGG + Intergenic
1159687346 18:71438682-71438704 AAGGAAATATAGAGCCAGCAAGG + Intergenic
1159848396 18:73494955-73494977 AAGAATGTACAGAAGAAGCTAGG + Intergenic
1160221313 18:76979962-76979984 AAAAAAAAACAAAGGAAGCTTGG + Intronic
1161428779 19:4218684-4218706 AAGGAAAGAGAGAGGAAGGAAGG - Intronic
1161845283 19:6708607-6708629 AAGGAGATAAAGAGGAAGGGAGG - Intronic
1162549365 19:11350048-11350070 AAGGAGAAACAGAGGTTGCTGGG - Intronic
1164250897 19:23474117-23474139 GAGAAAATACAAAGCAAGCTAGG - Intergenic
1164810656 19:31152738-31152760 AAGGAAGCACAGAGGAAGTTAGG - Intergenic
1164945343 19:32288561-32288583 TGGGAAAAACAGAGGAAGCAGGG - Intergenic
1165313230 19:35040773-35040795 ATGGAAAGGCAGAGGAAGCCAGG + Intronic
1167479677 19:49722221-49722243 GAGGAAAAACAGAGGATTCTAGG + Intergenic
1168185140 19:54695711-54695733 AAGGAAAAAAATAGGAAGTTTGG + Intronic
925659189 2:6184329-6184351 AAGGAAAGAAAGAGGAAGGCAGG + Intergenic
925753688 2:7112108-7112130 AAGCAAACACTGAGGAAGCCTGG + Intergenic
926427669 2:12754142-12754164 AATGAAAGCCAGAGGAAGCAAGG + Intergenic
926468517 2:13222515-13222537 AAGTAAATACATAGGAAGTTTGG - Intergenic
926827158 2:16916992-16917014 AAGGCAATACAGAGGAAGTTAGG + Intergenic
927675243 2:25100785-25100807 AAGAAAATACAGGGGAGGCCGGG - Intronic
928064700 2:28151777-28151799 AGGGAAATCCAGAGGTAGATAGG - Intronic
928281812 2:29953160-29953182 GAGTAAATACAATGGAAGCTAGG + Intergenic
928483760 2:31708851-31708873 AAGGAAACACAGTGGAGGCTGGG + Intergenic
929065519 2:37969893-37969915 AAGGAAAGAAAGAGAAAGCAAGG - Intronic
929504507 2:42517888-42517910 AAGAAAATACAGTAGAGGCTGGG + Intronic
929771797 2:44898540-44898562 AAGTAAGTGCATAGGAAGCTGGG - Intergenic
929840778 2:45460490-45460512 AAGGAAATGCTGAGGAAGGCAGG + Intronic
930105660 2:47637321-47637343 AAGGAAAGACAGAGGGAACTTGG + Intergenic
931102923 2:59022422-59022444 GAGGAAAGACAAAGGAACCTCGG + Intergenic
931260114 2:60610441-60610463 AAGGAAATACAGCAGCAGTTGGG - Intergenic
931486156 2:62694760-62694782 AAGCCAAAACAGAGGAAGCCAGG - Intronic
931876397 2:66518047-66518069 AAGGAGGTACAGAGAAGGCTGGG - Intronic
931995510 2:67835613-67835635 AAAGAGATTCAGAGAAAGCTGGG + Intergenic
932189212 2:69724870-69724892 ATGGAATTTGAGAGGAAGCTGGG + Intronic
932419059 2:71590746-71590768 CAGGAAATGCAGAGGCAGCCTGG - Intronic
932785861 2:74603177-74603199 AAGGGGATATAGAGGATGCTAGG + Intronic
932891243 2:75598825-75598847 AGGGAAATGCAGAGGAGCCTGGG - Intergenic
933154990 2:78963487-78963509 GAGGAAGTGCAGAGCAAGCTGGG + Intergenic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
933293667 2:80465693-80465715 AAAGAAATAAAGAAGAAGTTAGG - Intronic
933576276 2:84072119-84072141 AAGGAAAAAAAGAGGGAGGTAGG + Intergenic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
936854991 2:116946936-116946958 AAAGAAATACAGATAAAGCAAGG - Intergenic
936963650 2:118104008-118104030 GAGGAAATAAAGAGGATGATAGG - Intronic
937326939 2:120995387-120995409 GAGGAAATACAGAGGCGGCTGGG - Intergenic
937481076 2:122260050-122260072 AAGGAAATTAAGATGAAGGTGGG - Intergenic
938614016 2:132979081-132979103 CTGGAAATTCAGTGGAAGCTTGG - Intronic
938785083 2:134620708-134620730 AATTCAATACAGAGGAAGCTTGG + Intronic
938959531 2:136328817-136328839 CAGGAAAGACAGAGGAAGAAAGG + Intergenic
939831944 2:147082706-147082728 AAAGAAATACAGCAGAAACTTGG + Intergenic
939865816 2:147471300-147471322 AAGGGAACACACAGGAAGCAAGG + Intergenic
939953523 2:148504751-148504773 AAGGAAACAAAGACGAAGATGGG + Intronic
940263459 2:151810465-151810487 AAGGAATTACAGATGAAGTTGGG - Intronic
940714079 2:157198564-157198586 AAGGAAGAACAGAGGAAGGAAGG + Intergenic
940820286 2:158346422-158346444 AGGGACATACAGAAGAAGCAAGG - Intronic
942900754 2:181114720-181114742 AAGGAAAGAAAGTGGGAGCTTGG + Intergenic
943471375 2:188298263-188298285 AAATAAATACAGAGAAAGTTTGG + Intronic
943794321 2:191972535-191972557 AAGGGGACACAGAGGAAGCAGGG + Intronic
943812324 2:192202920-192202942 AAGGAAAGAGAAAGGAAGGTAGG + Intergenic
944633642 2:201653337-201653359 AAGGCAAGACAGAGGAACCTAGG - Intronic
944653561 2:201856222-201856244 AATAAAATACATAGGGAGCTGGG + Intronic
944725541 2:202467703-202467725 AAGGAAATACAAAGAAAAGTTGG - Intronic
945241315 2:207679458-207679480 AAGGAAACAGAGAGGACTCTGGG + Intergenic
947956651 2:234197786-234197808 AAAGAAATACAATGGAAGCTCGG + Intergenic
947994534 2:234515855-234515877 GAGGAAGTCCAGAGGAAGCCAGG - Intergenic
948064721 2:235068879-235068901 AAGGATACACAGTGGAAACTGGG - Intergenic
948327158 2:237133798-237133820 AAAAAAAAAAAGAGGAAGCTAGG - Intergenic
948338444 2:237229983-237230005 AAGGACATGCAGAGCAAGCTTGG - Intergenic
1169030036 20:2399934-2399956 AATGAGAGACAGAGGGAGCTAGG - Intronic
1169475069 20:5923622-5923644 AAGAAAACAGGGAGGAAGCTAGG + Exonic
1170312802 20:15011299-15011321 AAGGAAAGAGAGAGGAATCGGGG + Intronic
1170396719 20:15933702-15933724 AAGGAAATGAAGAAGAGGCTTGG + Intronic
1172050682 20:32115222-32115244 CAGGAAGTACAGAGGAGGTTGGG + Intronic
1172815237 20:37681026-37681048 ATGGAAATAGAGAGGATGTTAGG + Intergenic
1173012826 20:39197812-39197834 AAGGAAACATACTGGAAGCTAGG - Intergenic
1173063072 20:39680649-39680671 AAGGCCATAAGGAGGAAGCTGGG - Intergenic
1173890691 20:46507264-46507286 AAGGAAATAAAGAAAAGGCTAGG + Intronic
1174735883 20:52965348-52965370 AAGAAAATACAGAGAAAGAGTGG + Intergenic
1174838485 20:53879838-53879860 AAAGAAATACAGAGGCAGAGAGG + Intergenic
1176701160 21:10052163-10052185 AAAGAAATACAGAGCAATCTAGG - Intergenic
1176977272 21:15335947-15335969 AAAGAAATACAAATGAAGTTAGG + Intergenic
1177963233 21:27695267-27695289 AAGGAAAGAGAGAGGAAGGAAGG - Intergenic
1177973020 21:27813778-27813800 AAGGAAAAAGAGAGGAAGGCTGG + Intergenic
1178370557 21:32023575-32023597 AAGAAAAGTCAGAGGGAGCTGGG - Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178538294 21:33428519-33428541 AATGAAATGAAGAGGAGGCTGGG - Intronic
1178566210 21:33688727-33688749 GAGGAAAGACAGAGGGAGCTTGG + Intronic
1178986405 21:37307423-37307445 TAAAAAAGACAGAGGAAGCTAGG + Intergenic
1179603923 21:42499715-42499737 AACGAAGTACAGAGGAACCGTGG - Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182713917 22:32340137-32340159 AAGGAGACACCGAGGAGGCTCGG - Intergenic
1183239653 22:36647816-36647838 AAGGAAAAACACAGGGAGCTAGG - Intronic
1184044921 22:41967091-41967113 AAGGAAGAACAGAGGGTGCTGGG - Intergenic
1184530875 22:45054865-45054887 AAAAAAAAACAGAGGAAGCCGGG + Intergenic
949127752 3:466822-466844 ATGGAAATACAGAGCCAGCAAGG - Intergenic
949156963 3:839709-839731 AAGGATAGAAAAAGGAAGCTAGG - Intergenic
949388029 3:3526714-3526736 AAGGAAATAAATAGGATGCCGGG - Intergenic
949741063 3:7235195-7235217 ATGGAAATACAAAGGAAGGAAGG - Intronic
949782680 3:7707754-7707776 AAGAAAAGACAAAGGGAGCTTGG - Intronic
949855114 3:8453993-8454015 AAGGAAAGAGGGAGGAAGATGGG + Intergenic
949904298 3:8845773-8845795 ATGGAAAGACACAGGATGCTGGG - Intronic
950078715 3:10206087-10206109 AAGAAAATGCAGAGGGAGCTGGG + Intronic
950629362 3:14271983-14272005 AAGAAAATACAGAAGGCGCTGGG - Intergenic
950840099 3:15959736-15959758 AAGAAAATACAGAGCAGGCCTGG + Intergenic
950887942 3:16377107-16377129 AAGGAAATACAGAGAAACGGAGG + Intronic
951529312 3:23683844-23683866 AAAGAAAAATATAGGAAGCTGGG - Intergenic
951714060 3:25620211-25620233 AAGGCAATACACAGGGATCTCGG + Intronic
952377352 3:32778905-32778927 AAGGAAGTACAGAGGGAGACTGG - Intergenic
952665880 3:35903340-35903362 AAGGAAATACCTGGGAAGTTTGG - Intergenic
952941627 3:38449551-38449573 ATGAAAACACAGAGTAAGCTGGG - Intergenic
952950592 3:38521708-38521730 AAGGGGATTCAGGGGAAGCTGGG - Intronic
953495836 3:43386359-43386381 AGGGAAATAAAGAGGAAGAAAGG + Intronic
953800100 3:46016299-46016321 AAAGAAAAACAAAGGAAGCCTGG - Intergenic
954959445 3:54551135-54551157 CAGGAAATAAAAAGGAGGCTGGG - Intronic
955058127 3:55474161-55474183 CAGGAAAGACAGAGAAAGATAGG + Intronic
955554115 3:60117815-60117837 AAGGTTGTACAGAGGAAGCAGGG - Intronic
955816834 3:62852633-62852655 CAGGAAATTCAGAGTAAACTGGG - Intronic
956197743 3:66670099-66670121 AAAGAGAGACAGAAGAAGCTGGG - Intergenic
956293531 3:67687554-67687576 AAGGAAATATAAAGGATGCTTGG - Intergenic
956564993 3:70626233-70626255 AAGAAGATACAGGGGGAGCTTGG - Intergenic
957149312 3:76464423-76464445 AAGAAAAGACGAAGGAAGCTAGG - Intronic
957642688 3:82877631-82877653 AAGGAATGACAGAGGAAGGAAGG - Intergenic
958704753 3:97641386-97641408 AATAAAATACAGAGGAAGAATGG + Intronic
959172833 3:102863518-102863540 ATGGAAATATAGAGGAAGAATGG + Intergenic
959485110 3:106919642-106919664 CAGGAGTTACAGAGGAAGCAGGG + Intergenic
959563812 3:107814148-107814170 AATGCAGTACAGATGAAGCTGGG + Intergenic
959999038 3:112711648-112711670 AAGGAAATACAGAGCTAAGTTGG - Intergenic
960214865 3:115019858-115019880 AAGGAAAAACTGAGCAAACTAGG + Intronic
960299761 3:115987488-115987510 CAGGAACTACAGTGGCAGCTGGG + Intronic
960947473 3:122976627-122976649 AAGGAAATACAGCAGAATGTTGG - Intronic
962490886 3:135893077-135893099 AAGGAAAGAAAGAGGAAGGAAGG + Intergenic
963374134 3:144441486-144441508 AATGTAATGCAGAGGAAACTTGG + Intergenic
964011736 3:151899773-151899795 AAAGAAATGCAGAGAAGGCTGGG - Intergenic
964343195 3:155730199-155730221 AAGGAAATAGAGAAGGAGATGGG + Intronic
965093159 3:164187663-164187685 AAGGAAGAAAAGAGGAGGCTTGG - Intergenic
965100389 3:164290820-164290842 AAGAAAACACAGAGAAAACTAGG + Intergenic
965230112 3:166039615-166039637 AAAGAAAAACAGAGAAAGCCCGG + Intergenic
965341252 3:167493886-167493908 GAGGAAATACAGACGAAGATGGG - Intronic
965938523 3:174146164-174146186 AAGGAAAGAAAGAGGAAGGGAGG - Intronic
965994655 3:174865695-174865717 AAGAAATTATAGAGGAATCTAGG + Intronic
966020895 3:175208204-175208226 AAGCAAAAATATAGGAAGCTTGG - Intronic
967664804 3:192158485-192158507 AAGGAAAGAGAGAGGAAGGAAGG - Intronic
967989108 3:195118301-195118323 AAGGAGATACAGAGCAGGGTGGG + Intronic
968061227 3:195727395-195727417 AAGCAAATACAGCGAAGGCTTGG + Intronic
968134312 3:196210295-196210317 AAGGAAAGAGAGAGGAAGAAAGG + Intronic
968134319 3:196210369-196210391 AAGGAAAGAGAGAGGAAGGAAGG + Intronic
968279886 3:197468439-197468461 AAGAAAATAAAGATGCAGCTGGG + Intergenic
968778726 4:2562608-2562630 AAGGAAATGCAGATCAAGTTGGG - Intronic
969204312 4:5631369-5631391 AAGGAAATACAGGCCAGGCTTGG - Intronic
970180928 4:13392470-13392492 AGGTAAATACAGAAGAAACTTGG + Intronic
970362369 4:15322673-15322695 AAAGACACACAGAGGTAGCTGGG - Intergenic
970804864 4:20018786-20018808 AAGGAAATGCAGAGCAAACATGG - Intergenic
970986057 4:22160100-22160122 AGGGAACTAAAGAGGAAGCTGGG - Intergenic
971471274 4:27029309-27029331 AAAGAAATACAAAAGAAGCCGGG - Intergenic
972205544 4:36768004-36768026 AAGGCAGTGCAGAGGAAGCAGGG + Intergenic
972341877 4:38159184-38159206 AAGGAACAACAGAGCATGCTGGG - Intergenic
972537033 4:40008353-40008375 CAGGAAATGCACAGGGAGCTTGG - Intergenic
972601282 4:40575258-40575280 AAAGAAATACCAAGGAAGCTGGG + Intronic
972785889 4:42326599-42326621 AAGGAAGGACAGAGGAAGGAAGG + Intergenic
972886281 4:43493218-43493240 CAGGAAAAATAGAGGGAGCTGGG + Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974303355 4:60098590-60098612 AAGGAAATTCAAAGGAATTTAGG - Intergenic
974628663 4:64455563-64455585 AAGGACCTACAGAAGAAGCTGGG - Intergenic
975658655 4:76666730-76666752 AAGGAAATACAGAGCAAGCAGGG + Intronic
976455778 4:85245747-85245769 AAGGAAATGAGGAAGAAGCTGGG + Intergenic
976868575 4:89762159-89762181 AAGGAAAGACACATGAAGCCAGG + Intronic
977668822 4:99671661-99671683 TGGGAAATACCGAGGAAACTAGG + Intergenic
977806800 4:101309175-101309197 AAGGGATGACAGAGGAAGGTGGG - Intronic
977993776 4:103477776-103477798 CAAGGAATACAGAGGAAGATGGG + Intergenic
978347276 4:107784955-107784977 ATGGAAATACAGAGAAAACTTGG - Intergenic
978533854 4:109740385-109740407 AAAGAAATAAAGAGGAAGCAGGG + Intergenic
978914183 4:114103351-114103373 ATGGAAATAAAAAGGAAGCTTGG + Intergenic
979772036 4:124538342-124538364 CAGGAAATACAGAGGAGGTTGGG + Intergenic
980011869 4:127604929-127604951 AAAGAAATAAAGAAGGAGCTAGG + Intergenic
980157997 4:129129901-129129923 AAGGAAATACAGATGGACTTAGG + Intergenic
980373310 4:131908491-131908513 AAAGAAATACAGAGCAATCTAGG - Intergenic
980842031 4:138275334-138275356 ATTGATATACAGATGAAGCTTGG - Intergenic
980900825 4:138903693-138903715 TAGGAAAAACAAAAGAAGCTGGG + Intergenic
980901363 4:138908277-138908299 AAGGAAAGAAAGAGGAAGGAAGG + Intergenic
980998430 4:139804001-139804023 AAGGTATTACAGAAAAAGCTGGG + Intronic
981689955 4:147497448-147497470 TAGAAAACACAGAGGAATCTAGG + Intronic
982020275 4:151196103-151196125 AAAGTAGGACAGAGGAAGCTGGG + Intronic
982376533 4:154696986-154697008 AAAGAAACACAGAGCTAGCTAGG + Intronic
982571726 4:157058791-157058813 AAGAAAATAGAGGGGAATCTGGG - Intergenic
982980539 4:162128742-162128764 AATGAAATACATAGGAAGATCGG - Intronic
983918375 4:173316394-173316416 AAGGAAAAGAAGAGGAAGTTAGG - Intronic
984411418 4:179403493-179403515 CAGCAAGTACAGTGGAAGCTGGG - Intergenic
984587956 4:181584404-181584426 TAAGGAATACAGAAGAAGCTTGG - Intergenic
986061218 5:4193060-4193082 AGGGAAATAAACAGGCAGCTAGG + Intergenic
986080659 5:4389285-4389307 AAGGAAACACATAGGAAACATGG + Intergenic
988360412 5:30230027-30230049 AAGGAAAGAAAGAGTAAGCTTGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989235558 5:39144347-39144369 TAGGAAATACAGAGGAGACAGGG + Intronic
989427362 5:41312405-41312427 AAGGAAAGAAAGAGGAAGGCTGG - Exonic
990074388 5:51825337-51825359 AGGGAAATAAAGAGTAAGCGAGG - Intergenic
990660220 5:58005700-58005722 TAGGAAATACAGGACAAGCTTGG - Intergenic
990661381 5:58019600-58019622 AAGGAAGTCCACAGGAAGTTGGG - Intergenic
992421244 5:76607517-76607539 AAGGAAATGCAGAGGCAACAGGG - Intronic
993485635 5:88480769-88480791 AAGGAAAACTAGAGGGAGCTAGG + Intergenic
993723067 5:91340937-91340959 AAGAAAATAAAGAGGAGGCCGGG + Intergenic
994217675 5:97157709-97157731 GAGGAAATAGAGAGGGAGATGGG - Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994844179 5:104964416-104964438 AATCAAATACAGAGGCAGATAGG + Intergenic
994976681 5:106816855-106816877 AAGGAGATACAGAGCAAGCTAGG - Intergenic
995003729 5:107165724-107165746 AAGGAAATACAGGGGAGGAGAGG - Intergenic
995488964 5:112669831-112669853 GAGGAAATACAGACAAAGCAAGG - Intergenic
996494670 5:124140075-124140097 CAGGAAATACAGACAGAGCTTGG + Intergenic
996607522 5:125341595-125341617 AAGGAAAGAGAGAGGAAGGAGGG - Intergenic
996834079 5:127771865-127771887 AAGGAAAAAAAGGGGAAGCAGGG + Intergenic
997675233 5:135707709-135707731 AAGGAAATAAACAGGAGGGTAGG - Intergenic
998516730 5:142762306-142762328 AAAGAAATACAAAGGAAAATGGG + Intergenic
998939488 5:147265648-147265670 ATGGAAAAACATAAGAAGCTTGG - Intronic
999999734 5:157126420-157126442 AAAGAAAGACAGAGGAAGGGGGG + Intronic
1000114124 5:158137115-158137137 AAGGAAAAAGAGAGGAAGGAGGG - Intergenic
1000380715 5:160626929-160626951 AAGGAAATAAACAGGAACCCTGG + Intronic
1001530998 5:172461650-172461672 AAGGAAATACACAGGGAGGTCGG - Intergenic
1002110886 5:176911215-176911237 AAAGAAATACAGGGTAAGATAGG + Intronic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1002584732 5:180236716-180236738 AAGGAAAGACATAGGAATATGGG - Intronic
1002607186 5:180390358-180390380 GAGGAGAAACAGAAGAAGCTCGG - Intergenic
1002646043 5:180655521-180655543 TAAGAAATACAGACGAGGCTGGG - Intergenic
1002941443 6:1720153-1720175 AAGGAAAAAAGGAGGAAGTTGGG + Intronic
1003012197 6:2436437-2436459 TAAGAAAAACAGAGAAAGCTGGG + Intergenic
1003736743 6:8886301-8886323 AAAGAAAGACAGAGGAAGGAAGG - Intergenic
1003982834 6:11405545-11405567 AAGGAAAACCAGAGGAAAGTGGG - Intergenic
1004303210 6:14476931-14476953 AAGAAAATACAGCTGGAGCTGGG + Intergenic
1004332098 6:14731193-14731215 AAGGGAATACAGAGGGAGACAGG - Intergenic
1005312339 6:24570667-24570689 AAGGAAAGAGAGAGGAAGGAAGG + Intronic
1005916889 6:30360106-30360128 AAGGAAGAAAAGAGGAAGATGGG + Intergenic
1006388687 6:33746404-33746426 CTGGGACTACAGAGGAAGCTGGG - Intronic
1007316547 6:40993830-40993852 AAGGAAACATTGAGGAAGCCAGG - Intergenic
1007338738 6:41174763-41174785 AGTGAAATACAGAAGCAGCTGGG + Intergenic
1007544739 6:42685011-42685033 AAGGAAAAAAAGAAGAAACTTGG + Intronic
1007674984 6:43585938-43585960 AAGAAAATAAAGAGCAAGATCGG - Intronic
1009566458 6:65317593-65317615 AAGGAAATCTAGGGGCAGCTTGG + Intronic
1009917789 6:70017618-70017640 AAGGGAAAACATAAGAAGCTGGG + Intronic
1010116833 6:72322718-72322740 AAGTAACTTCAGAGGAAACTAGG - Intronic
1010704328 6:79089775-79089797 AAGGAAAGAAAGAGGAAGGAAGG - Intergenic
1010813310 6:80324925-80324947 AAGAAAGTACATAGGAAGATGGG + Intronic
1011007656 6:82665245-82665267 GAGGAAAACCAGATGAAGCTAGG + Intergenic
1011773445 6:90701304-90701326 AAGGAAACAGAGAGGGAGCCAGG + Intergenic
1012542388 6:100376352-100376374 AAGTAAACACAGAGGCACCTTGG + Intergenic
1013036867 6:106393447-106393469 AAGGAAGTTCAGAGGAGTCTGGG - Intergenic
1013083428 6:106833081-106833103 AAGGAAAGACACGGGAAGGTGGG - Intergenic
1013253465 6:108358930-108358952 AAGAAGATACAGAGCAAGCAGGG + Intronic
1013350537 6:109301905-109301927 ATGGAAAGAGATAGGAAGCTTGG + Intergenic
1014109564 6:117605189-117605211 AAGGTAATAGATACGAAGCTGGG - Intergenic
1014828682 6:126075959-126075981 AAGGAACTGCAGGGGAGGCTGGG + Intergenic
1014888767 6:126816144-126816166 AAGGAAAGAAAGAGGAAGGAAGG - Intergenic
1014974109 6:127857216-127857238 AAGGAAATACAGGGCAATGTGGG + Intronic
1015004625 6:128264103-128264125 AAGAAAAGCCAGAGGAAGATGGG + Intronic
1015042142 6:128733890-128733912 CAGGAAATTCAGAGGAAGGCTGG + Intergenic
1015893783 6:137997055-137997077 AAGAAAATACAGGGGAAGGGAGG + Intergenic
1016312259 6:142746688-142746710 AAGGAAAGAGAGATGCAGCTGGG - Intergenic
1016582758 6:145647654-145647676 AAGCAAATACAAAGGAAGGAAGG + Intronic
1017265562 6:152441599-152441621 AAGGAAGCACAGAAGAAGGTAGG + Intronic
1017478460 6:154824516-154824538 AAGCAAAAACAGTGGAGGCTGGG - Intronic
1018615230 6:165680535-165680557 AAGTAAAGATAGAGGAATCTTGG + Intronic
1019052421 6:169193255-169193277 GAGGAAATACAGAGTGGGCTTGG - Intergenic
1021489439 7:21202671-21202693 GAGGAAATACAGGTAAAGCTTGG + Intergenic
1021698413 7:23295294-23295316 AGAGAAATACAGAGCAGGCTGGG - Intergenic
1021930143 7:25572415-25572437 AAGAAATCACAGAGCAAGCTGGG + Intergenic
1023452131 7:40298055-40298077 AAGGAAACACAAAGGAGGCAAGG - Intronic
1023477710 7:40599032-40599054 AAGGAAGTGGAGAGGAAGGTAGG - Intronic
1023498897 7:40827576-40827598 AAGGTTAGACAAAGGAAGCTTGG + Intronic
1023538426 7:41238726-41238748 AAGGAAATACAGAGAGGACTTGG + Intergenic
1023599756 7:41870105-41870127 AAGGAAAAAGGGAGGAAGCCAGG + Intergenic
1024023084 7:45388452-45388474 AAGTAAATACAGACCAGGCTGGG - Intergenic
1024024134 7:45397091-45397113 AAAGAAAGAAAGAGCAAGCTGGG - Intergenic
1024568430 7:50703974-50703996 AAGGAAATGCTGGGGAAGCTGGG - Intronic
1024916225 7:54503229-54503251 CAGGAAATACAGAGAACGCCTGG - Intergenic
1025040629 7:55641455-55641477 AAGGGAATACCAGGGAAGCTTGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026363760 7:69627131-69627153 ATGTAAATACAGAGGAGGCAAGG + Intronic
1026655453 7:72252619-72252641 AAAGAAAGACAGAGGAAGGAAGG + Intronic
1027006088 7:74694289-74694311 AAGGAAAGACACAGTCAGCTGGG + Intronic
1029249363 7:99225053-99225075 AAGGAAAGAAAGAGGAAGGAAGG - Intergenic
1029627019 7:101726228-101726250 ACTGAAATTCAGTGGAAGCTGGG - Intergenic
1029710378 7:102295951-102295973 AAGAAAATAAAGAGGGTGCTGGG - Intronic
1029787551 7:102807761-102807783 AAAAAAATACAGAGTAGGCTGGG + Intronic
1030726087 7:112925880-112925902 AAGGAAGTAGAGAGAAAGATGGG + Intronic
1030794315 7:113769529-113769551 AAGGAAATCAAAAGGAAGATTGG - Intergenic
1030830135 7:114210435-114210457 AAGGAAAAACTGAGGCAACTGGG - Intronic
1031741426 7:125436470-125436492 AAGTATGCACAGAGGAAGCTGGG + Intergenic
1033403362 7:141048564-141048586 TAGGAAATATAAAGAAAGCTTGG - Intergenic
1033793582 7:144820891-144820913 AAGGTAATACATAGAAAACTTGG + Intronic
1034211919 7:149371350-149371372 AAGGAAATAAAAATAAAGCTGGG - Intergenic
1035568750 8:658878-658900 AAGGAAAGGCAGAGGAAGGACGG - Intronic
1035784828 8:2252276-2252298 AGGGAAATGCAGAGCAAGCCCGG + Intergenic
1035807979 8:2469445-2469467 AGGGAAATGCAGAGCAAGCCCGG - Intergenic
1036820940 8:11938911-11938933 AAGGAAATATAGAAGAAGCTAGG + Intergenic
1038525475 8:28269389-28269411 AACGAATGACAGAGGAAGCATGG + Intergenic
1038719523 8:30021459-30021481 AAAGAAACACAGAGGAGGCTGGG + Intergenic
1039322076 8:36443386-36443408 AAGGAAATAGAGAGTGATCTGGG - Intergenic
1039995073 8:42525170-42525192 AAGGAAATACAGAAAAAGGAAGG + Intronic
1041236673 8:55809804-55809826 AAAGAAATACAGATGAAAATAGG + Intronic
1041326999 8:56678479-56678501 ACAGAAATACAGAAGAAGCAGGG - Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1042078083 8:65018008-65018030 CAGGGAAAACAGAGGTAGCTAGG + Intergenic
1042251809 8:66763771-66763793 AAGGAGATACAGATGAACTTGGG - Intronic
1042543085 8:69926734-69926756 AAGAAAATACAGAGAAAACATGG + Intergenic
1043325733 8:79048775-79048797 TAGTTAATACAGAGGAAACTGGG + Intergenic
1043495887 8:80799505-80799527 CAGGAAAAACTGAGGCAGCTAGG + Intronic
1043607420 8:82019187-82019209 AAGGAAAAAGAGAGGAAGGGAGG - Intergenic
1043658577 8:82705338-82705360 AAGGAAAGAGAGAGGAAGGAAGG + Intergenic
1043861272 8:85320050-85320072 AAGGAGATAAAGAGAAAGATGGG + Intergenic
1043964678 8:86460629-86460651 AAGGAAATACACGAGAATCTTGG - Intronic
1044096981 8:88078965-88078987 AGTGAAATACAGTGGCAGCTTGG - Intronic
1045695264 8:104802211-104802233 AAAATAAGACAGAGGAAGCTTGG + Intronic
1045836553 8:106528142-106528164 AAGGAAAAAGAGAGGAAACAGGG - Intronic
1046050576 8:109017242-109017264 AAGGAAAGGCAGAGGAAGAGAGG + Intergenic
1046108639 8:109694831-109694853 AAGGAAATACAGAGAGAGAAAGG - Intergenic
1046326213 8:112650365-112650387 AAGAAAATAAAGAGTAAGCTTGG + Intronic
1047373859 8:124277871-124277893 GAGGAAAAACAGTGGAGGCTTGG - Intergenic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048580423 8:135725875-135725897 AATGAAATATATAGGTAGCTGGG - Intergenic
1048611495 8:136027873-136027895 CAGGAAAGACAGAGGTGGCTTGG + Intergenic
1051457188 9:17272046-17272068 AAGGAAAGAGAGAGGAAGGAAGG - Intronic
1052330193 9:27259872-27259894 AAGGAAATAGAGGGGAACCATGG - Intergenic
1053638303 9:40038662-40038684 AAAGAAATACAGAGAAATCTAGG - Intergenic
1053767781 9:41426558-41426580 AAAGAAATACACAGCAATCTAGG + Intergenic
1054319096 9:63635261-63635283 AAAGAAATACAGAGCAATCTAGG - Intergenic
1054546447 9:66338062-66338084 AAAGAAATACAGAGAAATCTAGG + Intergenic
1055005730 9:71504021-71504043 AAGGAATTACAGAGGAATGTTGG - Intergenic
1055178686 9:73354670-73354692 TAGGAAATAAAGAGGAAACTAGG - Intergenic
1055331948 9:75194026-75194048 AAGGAAAGAAAGAGGAAGGAAGG - Intergenic
1055439530 9:76324560-76324582 AAGGATATGAAGAGGAAGGTGGG - Intronic
1055808577 9:80124875-80124897 AAGGAAAGACAGAGGAGCCATGG - Intergenic
1056637393 9:88342600-88342622 AAGGAAATAGAGAAGTAGCCTGG - Intergenic
1057133949 9:92673475-92673497 AAGGAAAGATAGAGGAAGGGAGG + Intergenic
1058194064 9:101952604-101952626 AAGGAAAAACAAAGGATTCTAGG + Intergenic
1058495548 9:105554968-105554990 TGGGAAGTACAGATGAAGCTTGG + Intergenic
1059673602 9:116515206-116515228 AAGAAAACACAGGGAAAGCTAGG - Intronic
1060338682 9:122752567-122752589 AAGGAAATACAGGGACACCTAGG + Intergenic
1060847411 9:126848381-126848403 AAGTAAAGACAGATGATGCTGGG - Intergenic
1061415764 9:130445993-130446015 AAGAAAATGAAAAGGAAGCTTGG - Intronic
1061420644 9:130471450-130471472 AAGGAAAGACAGGGTCAGCTGGG - Intronic
1202786176 9_KI270719v1_random:22218-22240 AAAGAAATACAGAGCAATCTAGG - Intergenic
1185610954 X:1393259-1393281 AAGAAAAAACAGAGGAAGGGCGG - Intergenic
1185796995 X:2973684-2973706 AAGAAAAGAGAGAGGAAGCAGGG + Intergenic
1186024825 X:5297686-5297708 AGGGAAAGACAGAGGAAGAGGGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187646228 X:21349468-21349490 CAGGAAAAACTGAGGAAACTAGG + Intergenic
1188525784 X:31086332-31086354 AATGAAAGAAAGAGGAATCTAGG + Intergenic
1188817996 X:34739147-34739169 AAGGGAATACAGAGGAGTCCAGG + Intergenic
1189159239 X:38793787-38793809 AAAGAAAGACAAAGGAAGCAAGG + Intergenic
1189767299 X:44384710-44384732 AGAGAAATAGAGAGGGAGCTGGG - Intergenic
1189769350 X:44408053-44408075 AAAAAAAAACAGAGAAAGCTGGG - Intergenic
1189930725 X:46006168-46006190 AAAAAAATACACAGGAGGCTGGG - Intergenic
1192271867 X:69588504-69588526 AGGGATATACAGAGGAGACTTGG - Intergenic
1192524729 X:71831682-71831704 AAGGGAAGACAGAGAAAGGTAGG + Intergenic
1194265304 X:91745867-91745889 AAGGAAATACAGAGAAAGCACGG - Intergenic
1194561084 X:95421378-95421400 AAGAAAATTCTGAGGAAGGTGGG + Intergenic
1195915263 X:109929172-109929194 ATGGAAATACAGAGGAAAATTGG + Intergenic
1196821404 X:119703985-119704007 AGGAAAAAACAGATGAAGCTGGG - Intergenic
1197168550 X:123406311-123406333 AGGGGAAGACAGAGGAATCTAGG + Intronic
1197481694 X:126994754-126994776 ACAGAAATACAGATGAAGGTCGG - Intergenic
1198757458 X:139996308-139996330 AAGGAAATAAGGAGGAAGCTTGG - Intergenic
1199031291 X:143003622-143003644 AAGGATATACAGTGAAAGCAAGG - Intergenic
1201495202 Y:14585343-14585365 AAATAAATAAAGAGGAAACTTGG + Intronic