ID: 902891535

View in Genome Browser
Species Human (GRCh38)
Location 1:19447800-19447822
Sequence CGGTGGCCTTGCCAGAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 103}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902891527_902891535 14 Left 902891527 1:19447763-19447785 CCCAGCAGCTCGCAGGCCACACT 0: 1
1: 0
2: 2
3: 11
4: 146
Right 902891535 1:19447800-19447822 CGGTGGCCTTGCCAGAATGCTGG 0: 1
1: 0
2: 0
3: 4
4: 103
902891524_902891535 20 Left 902891524 1:19447757-19447779 CCCAGCCCCAGCAGCTCGCAGGC 0: 1
1: 0
2: 2
3: 40
4: 363
Right 902891535 1:19447800-19447822 CGGTGGCCTTGCCAGAATGCTGG 0: 1
1: 0
2: 0
3: 4
4: 103
902891529_902891535 -2 Left 902891529 1:19447779-19447801 CCACACTGCTCCTCTCCGCCTCG 0: 1
1: 0
2: 2
3: 26
4: 317
Right 902891535 1:19447800-19447822 CGGTGGCCTTGCCAGAATGCTGG 0: 1
1: 0
2: 0
3: 4
4: 103
902891528_902891535 13 Left 902891528 1:19447764-19447786 CCAGCAGCTCGCAGGCCACACTG 0: 1
1: 0
2: 1
3: 18
4: 221
Right 902891535 1:19447800-19447822 CGGTGGCCTTGCCAGAATGCTGG 0: 1
1: 0
2: 0
3: 4
4: 103
902891525_902891535 19 Left 902891525 1:19447758-19447780 CCAGCCCCAGCAGCTCGCAGGCC 0: 1
1: 0
2: 3
3: 46
4: 473
Right 902891535 1:19447800-19447822 CGGTGGCCTTGCCAGAATGCTGG 0: 1
1: 0
2: 0
3: 4
4: 103
902891526_902891535 15 Left 902891526 1:19447762-19447784 CCCCAGCAGCTCGCAGGCCACAC 0: 1
1: 0
2: 2
3: 25
4: 225
Right 902891535 1:19447800-19447822 CGGTGGCCTTGCCAGAATGCTGG 0: 1
1: 0
2: 0
3: 4
4: 103
902891521_902891535 28 Left 902891521 1:19447749-19447771 CCATCCGACCCAGCCCCAGCAGC 0: 1
1: 0
2: 3
3: 39
4: 496
Right 902891535 1:19447800-19447822 CGGTGGCCTTGCCAGAATGCTGG 0: 1
1: 0
2: 0
3: 4
4: 103
902891522_902891535 24 Left 902891522 1:19447753-19447775 CCGACCCAGCCCCAGCAGCTCGC 0: 1
1: 0
2: 8
3: 49
4: 463
Right 902891535 1:19447800-19447822 CGGTGGCCTTGCCAGAATGCTGG 0: 1
1: 0
2: 0
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902891535 Original CRISPR CGGTGGCCTTGCCAGAATGC TGG Intronic
900565583 1:3330393-3330415 TGGTGGCCTTGTAAGAATGCAGG + Intronic
902574323 1:17367711-17367733 AGGTTGCCTTGTCTGAATGCAGG - Intergenic
902891535 1:19447800-19447822 CGGTGGCCTTGCCAGAATGCTGG + Intronic
903020841 1:20393000-20393022 CAGTGGCATTTCCAGATTGCTGG - Intergenic
905343741 1:37297272-37297294 AGGTGGCCATGGCAGAATGGAGG - Intergenic
905449160 1:38046215-38046237 CGGCGGCCTGGCCGGGATGCTGG - Exonic
907734772 1:57101556-57101578 CAATGGCTCTGCCAGAATGCAGG - Intronic
913661379 1:121008924-121008946 CGGTGCCCTAAGCAGAATGCAGG - Intergenic
914165084 1:145169080-145169102 CGGTGCCCTAAGCAGAATGCAGG + Intergenic
914824839 1:151133018-151133040 CGGTGGCCTCACCAGCACGCGGG + Exonic
919180078 1:194069488-194069510 CGCTGGCCCTGCCTGACTGCTGG + Intergenic
920309514 1:205040578-205040600 CGGTGGCTAAGCCAGGATGCTGG + Intergenic
922730656 1:227947450-227947472 CCGTGTCCTTGCCAAAAGGCTGG - Intronic
1064866142 10:19882761-19882783 CGCTGGCCTTGTCAGAATGTTGG - Intronic
1064929239 10:20605228-20605250 CAGTGGAATTCCCAGAATGCTGG - Intergenic
1065695442 10:28375612-28375634 AGGTGACCTTGGCAAAATGCAGG - Intergenic
1067369912 10:45673149-45673171 CGGTGGCCTCTCCAGAGTGAGGG + Intergenic
1071520784 10:86330383-86330405 TGGTGGCATTGCCAGCCTGCTGG - Intronic
1073579056 10:104647250-104647272 CGCTGCCCTGGCCAGAATGCAGG - Intronic
1078103925 11:8346487-8346509 CGGTGCCCATGCCAGAAACCCGG - Intergenic
1078509631 11:11975785-11975807 CGCTGCACTTGCCATAATGCTGG + Intronic
1080413537 11:32048703-32048725 GTGTGGCCTTGCCAGATTCCAGG - Intronic
1084804034 11:71566408-71566430 AGGTGGCCTTGCCTGGACGCGGG + Exonic
1084872071 11:72105125-72105147 CAGGGGCCTTGCAAGAAGGCCGG + Intronic
1085444076 11:76589198-76589220 GTGTGGCCTGGCCAGACTGCTGG + Intergenic
1089291679 11:117441169-117441191 TGGTGGCCCAGCCAGAATCCTGG - Intronic
1091534755 12:1395345-1395367 CCATGGCCTTGCCAGAAAACAGG + Intronic
1093875223 12:24341872-24341894 AGGTGGCCTTACCAGAACCCAGG - Intergenic
1103947724 12:124535893-124535915 CGGTGGTCTTGCCAGGGTGTGGG - Intronic
1104608196 12:130205199-130205221 CGGCAGCCTTCCCAGAGTGCTGG - Intergenic
1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG + Intergenic
1105805266 13:23948594-23948616 TGGCGGCCTTGCCCGAAGGCAGG - Intergenic
1113379955 13:109795191-109795213 CGGTGTGTTTGCCAGAATGTTGG + Intergenic
1122814829 14:104307259-104307281 AGGTGGTCTTGCCAGAGGGCTGG + Intergenic
1124633540 15:31350823-31350845 CCATGGCCAGGCCAGAATGCAGG + Intronic
1125003589 15:34795391-34795413 CTGGGGCCTTGGCTGAATGCGGG + Intronic
1129829766 15:78661139-78661161 CTGGGGCCTTGCCGAAATGCCGG + Intronic
1130764580 15:86857152-86857174 TGGTGGCCTGGACAGCATGCTGG - Intronic
1132401292 15:101507322-101507344 TGGTGGCCTTGCCAGAGGGTGGG - Intronic
1132669546 16:1096986-1097008 TGGCGGCCTTGCCTGAAAGCAGG + Intergenic
1132860516 16:2069189-2069211 ATGTGGCCTTCCCAGAATGGGGG + Intronic
1133447202 16:5871951-5871973 CAGTGGCCTTGGGAGAATGTAGG + Intergenic
1136139488 16:28279535-28279557 CTGTGCCCGTGACAGAATGCGGG - Intergenic
1136477950 16:30525077-30525099 CGAAGGCCTTGCCACAATGTGGG + Exonic
1139510414 16:67425015-67425037 CTGAGGGCTTTCCAGAATGCGGG - Intergenic
1145018929 17:19415358-19415380 CTGTCTCCCTGCCAGAATGCTGG - Intronic
1151748650 17:76024610-76024632 AGGGAGCCTTGCCAGCATGCTGG + Intronic
1152001447 17:77647978-77648000 CGTTGGCCTTACCTGTATGCAGG + Intergenic
1157556730 18:48617764-48617786 CGGTGCCCTTTTCAGAATGAGGG - Intronic
1161584785 19:5099514-5099536 CAGAGGCCTTCCCAGAATGGGGG + Intronic
1166880720 19:45928439-45928461 CGGAGACCTCACCAGAATGCTGG + Intergenic
1167289361 19:48615899-48615921 CTGGGGCCTTGCCGAAATGCCGG + Exonic
927264781 2:21133257-21133279 TAGTGACCTTGCCAGAATACTGG + Intronic
927816579 2:26222815-26222837 CAGTTGCCTTGACAGAATGGTGG + Intronic
928155319 2:28871018-28871040 CGGTCGGCTTCCCAAAATGCTGG - Intergenic
929248110 2:39724378-39724400 GTGTGGCCCTGCAAGAATGCTGG + Intergenic
929532696 2:42762693-42762715 GGATGGCATTCCCAGAATGCAGG - Exonic
931897820 2:66752682-66752704 GGGGGGCCTTGCCAGAATCAAGG - Intergenic
932332527 2:70905819-70905841 CGGTGGCTTTGACTGACTGCGGG - Intronic
934779439 2:96960433-96960455 CCCTTGCCTTGCCAGGATGCTGG - Exonic
936710971 2:115130832-115130854 CAGTGGAATTGACAGAATGCAGG - Intronic
937048826 2:118871494-118871516 TGGTGGCCAAGCCAGAAAGCTGG + Intergenic
944496483 2:200312220-200312242 CAGTGGCATTTCCATAATGCAGG - Intronic
945373001 2:209044230-209044252 CTGAGACCTTGCCACAATGCTGG + Intergenic
945903851 2:215568791-215568813 CAGTGGTATTGCCAGAATCCAGG - Intergenic
948380421 2:237546744-237546766 CCGTGGACTTGCCACACTGCTGG - Intronic
1176092656 20:63325869-63325891 CTGTGGCCTGGCCAGAAGGCTGG + Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176382822 21:6121527-6121549 CAGTGTCCGTGCCAGGATGCAGG - Exonic
1179740647 21:43416712-43416734 CAGTGTCCGTGCCAGGATGCAGG + Exonic
1184117133 22:42428745-42428767 CTGTGGCCTTTCCAGAACTCTGG - Intronic
949915034 3:8954593-8954615 GGGGTGCCTTGGCAGAATGCAGG - Intronic
950459694 3:13113764-13113786 GGATGGCCTGGCCAGAGTGCGGG - Intergenic
950461498 3:13124925-13124947 CGGTGGCCAGGCCAGGATGGTGG - Intergenic
954885091 3:53866143-53866165 CCTTGGCCTTGCCAAAGTGCTGG - Intergenic
968513446 4:1005214-1005236 GGGTGGCCTTGGGAGGATGCTGG - Intergenic
969594353 4:8140511-8140533 CGGGGGCCTTGCCTGCATGTGGG + Intronic
969623239 4:8289506-8289528 CGGCGGCTGTGGCAGAATGCTGG + Intronic
972582117 4:40404169-40404191 TGGTGGGTTTGTCAGAATGCTGG + Intergenic
972730524 4:41790215-41790237 CTGAGGCCTTACCAGAATCCAGG - Intergenic
975575487 4:75858324-75858346 TGGTGGGCTTTCCAGAATGAGGG - Intergenic
975580066 4:75898193-75898215 TGGTGGGCTTTCCAGAATGAGGG - Intronic
977380694 4:96270094-96270116 CTGTAGCTTTGCCAGAATGTTGG - Intergenic
980396893 4:132226286-132226308 AGCTGGCCTTATCAGAATGCAGG - Intergenic
989605080 5:43236551-43236573 GGGCAGCCATGCCAGAATGCAGG - Intronic
991024796 5:62018251-62018273 CAGTGGCCAAGCCAGAATGAGGG - Intergenic
991656772 5:68912105-68912127 TGGTGACTTTCCCAGAATGCTGG + Intergenic
999919612 5:156304112-156304134 TGGTGGGCTAGCCAGAATTCAGG + Intronic
1000183750 5:158838947-158838969 CGGTGGCCTTGGCATCATACAGG + Intronic
1006941386 6:37754030-37754052 CGGGGGCCTGGCCAGAGAGCAGG + Intergenic
1007859998 6:44898669-44898691 CTGTGGCAGTGCAAGAATGCAGG - Intronic
1013400316 6:109788812-109788834 CAGTGTCCTTGCCAGAAGCCAGG + Intronic
1019548325 7:1589328-1589350 CTGTGGCCTTTCCAGCATGGTGG + Intergenic
1019963874 7:4483526-4483548 AGGTGGCCTTTCCAGACAGCTGG - Intergenic
1025230531 7:57201058-57201080 GGGTGGCCTTCGCAGAATGGAGG - Intergenic
1025730456 7:64102679-64102701 GGGTGGCCTTGGCAGAGTGGAGG + Intronic
1029705949 7:102275701-102275723 CAGTGGCACTGCAAGAATGCAGG + Intronic
1032969913 7:137148937-137148959 CTGTGGCACTGCCAGATTGCTGG + Intergenic
1032971082 7:137164495-137164517 CCGGTGCCTTGCCAAAATGCCGG - Intergenic
1033710060 7:143933788-143933810 CAGTGGTCTTGCCAGACAGCAGG - Intergenic
1039569273 8:38574168-38574190 GGTAGGCCTTGCCAGAAAGCAGG - Intergenic
1044857484 8:96491640-96491662 GTGTGGCCTTGCCTGAAGGCTGG + Intergenic
1048965921 8:139614433-139614455 CTGTGACCATGCCTGAATGCAGG + Intronic
1053173653 9:35907695-35907717 GGATGGCCTTGGGAGAATGCTGG + Intergenic
1055755528 9:79553722-79553744 CTGTGGCCTTGGCATAATGGTGG + Intergenic
1056485423 9:87052075-87052097 CCCTGCCCTTGTCAGAATGCAGG - Intergenic
1062645217 9:137544313-137544335 AGGTGACCCTGCCAGCATGCAGG - Intronic
1201178012 Y:11321680-11321702 TGGTGGCCATGCCAGGATACGGG - Intergenic