ID: 902891632

View in Genome Browser
Species Human (GRCh38)
Location 1:19448438-19448460
Sequence CTGGGCTTTGTGGATTAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902891632_902891638 28 Left 902891632 1:19448438-19448460 CCGCCTTAATCCACAAAGCCCAG 0: 1
1: 0
2: 0
3: 23
4: 248
Right 902891638 1:19448489-19448511 CTGAACCGCAGAAACAAACCTGG 0: 1
1: 0
2: 0
3: 3
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902891632 Original CRISPR CTGGGCTTTGTGGATTAAGG CGG (reversed) Intronic
901825286 1:11857380-11857402 CAGGGCTTTGTGGTTTTAGTTGG + Intergenic
902733984 1:18387961-18387983 GTGGGCTTTGAGGATGGAGGTGG + Intergenic
902891632 1:19448438-19448460 CTGGGCTTTGTGGATTAAGGCGG - Intronic
903286157 1:22278017-22278039 GAGAGCTTTGTGGATCAAGGGGG + Intergenic
903764501 1:25725468-25725490 CTGGGCTTTGAAGAATAAGCTGG + Intronic
904380817 1:30109481-30109503 ATGGGCTTTGGGGACTCAGGGGG + Intergenic
905896191 1:41547434-41547456 CTGGGCTTTGAAGATGAAGAAGG + Intronic
905977228 1:42185111-42185133 CTGGACTTTGTAGGTTAAGTAGG - Intronic
906128056 1:43439622-43439644 CTAGCCTTTGTGGATGAAGGAGG + Exonic
909090057 1:71214579-71214601 CTGGACTTTGGGGACTCAGGGGG - Intergenic
910282809 1:85520110-85520132 GTGGACTTTGGGGATTCAGGGGG - Intronic
912081230 1:105939203-105939225 ATGGACTTTGAGGATTTAGGGGG - Intergenic
912746579 1:112250206-112250228 TTGGGCTTTATGGAATAAGCTGG - Intergenic
917316948 1:173735763-173735785 ATGGACTTTGGGGATTCAGGGGG - Intronic
917741333 1:177964429-177964451 CTGGGATTAGTAGATTGAGGTGG - Intronic
918161647 1:181906522-181906544 CTGGGTGTTCTGGATTAATGGGG - Intergenic
919685746 1:200482119-200482141 ATGGGCTTTGGGGATTCAGGGGG + Intergenic
920607111 1:207399414-207399436 TTGGACTTGGTGGATTCAGGAGG + Intergenic
921588442 1:216975903-216975925 CTGAGCTTTGTGGGATAAGAAGG - Intronic
924482169 1:244445883-244445905 CTGGGCTTTGTGCATGAAATTGG - Intronic
924805196 1:247356326-247356348 CTTTGGTTTGTGGATTAGGGAGG - Intergenic
1063255377 10:4321472-4321494 CTGTGCTTTGGGGAGCAAGGTGG + Intergenic
1063457517 10:6194689-6194711 CAGGGGTTTGTGGATTCAGTGGG + Intronic
1063547530 10:6997007-6997029 CTGGGTTATGTGGATTAACATGG - Intergenic
1063762881 10:9100018-9100040 GTGGGCTTTGTGGGACAAGGAGG - Intergenic
1068077440 10:52274286-52274308 ATGGGCTTTGGGGATTTGGGGGG - Intronic
1068549471 10:58389759-58389781 GTGGGCTGGGTGCATTAAGGAGG - Intronic
1069747790 10:70726815-70726837 CTAGGGTGTGTGGATTGAGGAGG + Intronic
1070281774 10:75054747-75054769 CAGGGCTGTATGGATTAAGTTGG - Intronic
1070313225 10:75288633-75288655 CTGGGATTTGTGGAGCAAGCTGG - Intergenic
1071767005 10:88678289-88678311 CTTTGCTCTGTGGATAAAGGTGG + Intronic
1073586107 10:104711706-104711728 CTGGCCTCTGGGGATTATGGTGG + Intronic
1075976976 10:126704663-126704685 CTTGGGTTTGGGGAATAAGGAGG - Intergenic
1076267265 10:129118514-129118536 CTGGGCATGGTGGACTAATGAGG + Intergenic
1076748292 10:132525565-132525587 CTGAGCCTTATGGAGTAAGGTGG + Intergenic
1077281938 11:1749763-1749785 CTGGACTTGGTGGGCTAAGGAGG - Intronic
1077456966 11:2687145-2687167 CTGTGCTTTGTGGAGGAAGCTGG - Intronic
1079307500 11:19336442-19336464 CTGGGCTTTGAGTAGTTAGGAGG + Intergenic
1081043381 11:38239650-38239672 CTGGGCTTTGTGGAGTTGGTAGG + Intergenic
1081692062 11:45085413-45085435 CTGGTCTTTGTGGGATAAAGGGG + Intergenic
1081736540 11:45408481-45408503 CTGGGCTGTGTGGAAGAAGGTGG - Intergenic
1083333426 11:61909589-61909611 GTGGGTCTTGAGGATTAAGGTGG + Intronic
1084162063 11:67355417-67355439 CAGGGCTTGGTGGACTCAGGAGG - Intronic
1084225821 11:67714155-67714177 CCGGGCTGTGTGGATGCAGGTGG + Intergenic
1084809765 11:71605109-71605131 CCGGGCTGTGTGGATGCAGGTGG - Intergenic
1085034640 11:73292670-73292692 CTGGGCTTAGAGGAGCAAGGAGG - Intronic
1085679788 11:78562347-78562369 TTGGGCCTGGGGGATTAAGGTGG + Intronic
1086495447 11:87399926-87399948 CTGGGTTTTGGGGATTGAGATGG + Intergenic
1087059045 11:93960662-93960684 CTGGCTTCTGTGGATGAAGGAGG + Intergenic
1088846666 11:113674078-113674100 CTGGGCTCAGTGGTATAAGGAGG - Intergenic
1088903375 11:114135601-114135623 CAGGGCTTTGTGGCTTCTGGAGG - Intronic
1089279935 11:117366804-117366826 CTGTGCTGTGTGGATTACAGGGG + Intronic
1089299228 11:117488445-117488467 CAGGGCTTTTTGGGTGAAGGCGG + Intronic
1089339574 11:117748470-117748492 CTGGGCTGTGTGGCTGAAGGTGG - Intronic
1089590964 11:119540509-119540531 CTGGGCTGTGTGGGTTAGTGGGG - Intergenic
1090605482 11:128419260-128419282 CTGGGCTTTCTGGGTAATGGTGG + Intergenic
1091921820 12:4310723-4310745 CTGGGCTTGGTGGGGGAAGGAGG - Intergenic
1092506003 12:9100880-9100902 ATGGACTTTGTGGATTCAGGGGG + Intronic
1094084186 12:26571525-26571547 GTGTGCATTGTGGATCAAGGTGG - Intronic
1094594781 12:31855285-31855307 CTGGGCTAGTTTGATTAAGGAGG + Intergenic
1095062965 12:37724437-37724459 CAGCGCTTTGAGGACTAAGGTGG + Intergenic
1095063002 12:37725120-37725142 GAGTGCTTTGAGGATTAAGGTGG + Intergenic
1095702139 12:45201407-45201429 CTGGGCAGTGTGCATTCAGGAGG - Intergenic
1096866383 12:54566125-54566147 CTGGGGTTTGTTGATTAACTGGG - Intronic
1099657938 12:85519383-85519405 CAAGGGTTTGTGGATTAAGAGGG + Intergenic
1099952379 12:89318544-89318566 ATGGGCTTTGAGGAATAAGAAGG + Intergenic
1100456345 12:94755279-94755301 ATGGACTTTGTGGACTCAGGAGG + Intergenic
1100696754 12:97102428-97102450 ATGGACTTTGGGGATTCAGGGGG - Intergenic
1104147252 12:126047067-126047089 CTGGACTTTGGGGACTTAGGGGG + Intergenic
1104493633 12:129216387-129216409 ATGGTCTTAATGGATTAAGGTGG + Intronic
1104533062 12:129590767-129590789 CTGGACTGTGTGGATGAAGGAGG - Intronic
1106072558 13:26426398-26426420 CCCAGCTATGTGGATTAAGGGGG + Intergenic
1107549924 13:41464777-41464799 CTGGGCTTTGAGGATGAACATGG - Intronic
1107563114 13:41575240-41575262 ATGGACTTTGGGGACTAAGGTGG + Intronic
1109432574 13:62254456-62254478 CGGGGCTTTGTGGATTTTTGAGG + Intergenic
1116406581 14:44573982-44574004 GTGGACTTTGGGGACTAAGGGGG + Intergenic
1117319849 14:54611223-54611245 CAGGGCTTTATGGATTAAAAGGG - Intronic
1117490590 14:56242831-56242853 ATGGACTTTGGGGATTCAGGGGG + Intronic
1118605479 14:67499911-67499933 CTGGGGGCTGCGGATTAAGGAGG + Intronic
1119849784 14:77858963-77858985 CTGGGCATTGTGGGGTAATGAGG + Intronic
1120288858 14:82540987-82541009 ATGGACTTTGGGGACTAAGGAGG - Intergenic
1121031931 14:90665491-90665513 CTGGGCTTTGTGTACTAGGGAGG - Intronic
1121245894 14:92460635-92460657 CTGGGCTTTGTGGATCAGGTAGG + Intronic
1121251406 14:92502537-92502559 GTGGGCTTTGTGGATTCTGCAGG + Intergenic
1121668019 14:95686945-95686967 CTGGGCTTTGTGGGATGAGTAGG + Intronic
1124692608 15:31838449-31838471 CTGGTCTTTGTGGGTTTGGGTGG - Intronic
1125111748 15:36042144-36042166 CTGGGTTTTATGTATTTAGGGGG + Intergenic
1125679092 15:41519740-41519762 TTGGGCTTTGTGGAAGAAGTGGG - Intronic
1127351964 15:58162175-58162197 CTGGGCTCTGTGTTTTAAGAGGG + Intronic
1128837690 15:70824333-70824355 CTGGGCATTGTTGATTGAGTTGG + Intergenic
1128866413 15:71118058-71118080 CTGGGCTTTGAAGCCTAAGGAGG + Intronic
1130323326 15:82857850-82857872 CTGAGCTTCGTGGTTTAGGGCGG - Intronic
1131586146 15:93695019-93695041 ATGGACTTTGGGGATTCAGGGGG - Intergenic
1133712225 16:8412303-8412325 ATGGGCTTTGGGGACTTAGGGGG + Intergenic
1135398920 16:22152241-22152263 GTGGGCTGTGTGGTTTCAGGGGG + Intronic
1136137281 16:28264222-28264244 CTGGGCTTTGGGGATTGCAGAGG + Intergenic
1139292456 16:65870999-65871021 CTGGGCTTTAAGGATACAGGAGG + Intergenic
1139318914 16:66097163-66097185 CTGGGCTTTGATGGATAAGGGGG + Intergenic
1139464245 16:67145659-67145681 CTGGGCTCTGAGGAGTCAGGTGG - Intronic
1139970243 16:70769837-70769859 CTGGGCTATGGGGATTGAGGGGG - Intronic
1143584134 17:7843010-7843032 TGGGGCTTTGTGGATAAAGGTGG + Intronic
1145488758 17:23795897-23795919 GAGGGCTTTGTGGGTTATGGTGG + Intergenic
1145572881 17:25019811-25019833 CAGGGCTTTGTGGTTTGTGGTGG + Intergenic
1145814915 17:27788733-27788755 CAGGGCTTTGTGGATCAAACAGG - Intronic
1146209436 17:30930645-30930667 CTGGGCTGTGTGGACTGAGAGGG - Intronic
1147763798 17:42819083-42819105 TTGGCCTTGGTGGACTAAGGAGG + Intronic
1149121922 17:53179557-53179579 GTGGGCTTTGGGGACTCAGGAGG - Intergenic
1150284075 17:63945728-63945750 CTGGGCATTGTCAATTAGGGAGG + Intronic
1153033335 18:735473-735495 ATGGACTTTGGGGAGTAAGGGGG + Intronic
1153683037 18:7518627-7518649 CTTTGCTTTGTGACTTAAGGAGG - Intergenic
1156307844 18:35895519-35895541 CTGGGCATGGTGGCTTATGGCGG - Intergenic
1157970835 18:52266758-52266780 GTGGGCTTTGGGGATTTAGGGGG + Intergenic
1160506152 18:79427767-79427789 CTGGTCTTTGTGCAGTGAGGGGG + Intronic
1160764291 19:800485-800507 CTGGTCATTGTGGGTTGAGGGGG + Intronic
1162184948 19:8897599-8897621 CAGGGCTTTGAGGGTTAAGGTGG + Exonic
1163221402 19:15924074-15924096 CTGGGCTTCCTGCATGAAGGAGG + Exonic
1163270685 19:16251673-16251695 CTGGGCTTTGTAAAATAAGCTGG - Intergenic
1163425961 19:17241216-17241238 CTGGACTTTGTGAATTAACTAGG + Intronic
924999657 2:394786-394808 CTGGGCTTTGTGGCCCAAGCTGG + Intergenic
925441424 2:3889841-3889863 GTGGGCTTTGGGGACTCAGGGGG - Intergenic
925772956 2:7301308-7301330 CTGGGGTTTGTGGGTGTAGGAGG - Intergenic
926120174 2:10237486-10237508 CTGGGCTCTGGGGGCTAAGGAGG + Intergenic
926120187 2:10237526-10237548 CTGGGCTCTGGGGGCTAAGGAGG + Intergenic
926120199 2:10237566-10237588 CTGGGCTCTGGGGCCTAAGGAGG + Intergenic
926120209 2:10237606-10237628 CTGGGCTCTGAGGGCTAAGGAGG + Intergenic
926525535 2:13975184-13975206 CTGTGTTTTGTGGATCAAGAGGG - Intergenic
927488429 2:23504870-23504892 CTGAGCTTGGTGGTTTGAGGAGG - Intronic
929244280 2:39685219-39685241 CTGGGCTGTGGAGAGTAAGGGGG - Intronic
929273271 2:39997949-39997971 CTTCGGTTTGTGGATTAAGAAGG + Intergenic
930077067 2:47414898-47414920 CTGGGCTTGGTGGAGTGAAGTGG + Intronic
931066981 2:58598337-58598359 CTGCTCTTTGTGGGTCAAGGAGG + Intergenic
932013234 2:67999159-67999181 TTGGACTTTGTGGAGTCAGGAGG + Intergenic
932438267 2:71715977-71715999 CTGGGCTTTGTGGGATTTGGAGG + Intergenic
932502385 2:72194801-72194823 CTGATCTCTGTAGATTAAGGGGG + Intronic
932865496 2:75337097-75337119 CTAGGTTTTGTGAATTAAAGAGG - Intergenic
935001242 2:99017792-99017814 TTGGACTTTGGGGATTCAGGGGG + Intronic
935361423 2:102249943-102249965 CTGGGCATTCTGGGTTGAGGGGG + Intergenic
937570308 2:123349989-123350011 TTGGGTTTTGTGGATGGAGGTGG - Intergenic
938533150 2:132211872-132211894 GTGCGCTTTGTGGCCTAAGGTGG + Intronic
939683101 2:145162945-145162967 CTGGGCACTGTGGATTCAGAGGG - Intergenic
939900258 2:147843113-147843135 CTTGGCTTTGTGGGAAAAGGTGG + Intergenic
940944100 2:159596692-159596714 GTGGACTTTGGGGATTCAGGGGG - Intronic
944129994 2:196337404-196337426 CTGGGCTCTGTGGATCACTGGGG - Intronic
944940687 2:204622288-204622310 TTGGGCTTTGTGGAAGAAGCAGG - Intronic
945177360 2:207056008-207056030 CTGGGCTTTGTCGATTATTAGGG + Intergenic
946377682 2:219323212-219323234 CTGGGCTTTGTTGAGAAAGGAGG - Intergenic
947186299 2:227458610-227458632 CTGGCCTTTGTGGAGAATGGAGG + Intergenic
947955225 2:234184082-234184104 CTGGGCTTCGTGGTTACAGGAGG - Intergenic
948626627 2:239273237-239273259 CAGGGCCTCGTGGATCAAGGAGG + Intronic
1169977135 20:11342425-11342447 CTGTGCTTTGGGAATTAAGATGG + Intergenic
1171420988 20:25017609-25017631 CTGGGTTTTGTGTATTTAGCTGG - Intronic
1174304021 20:49602538-49602560 CTGGGCCTTGTGGAGAAATGAGG - Intergenic
1175260908 20:57673548-57673570 CTGGGCTTTGAGGGTTAAAGAGG - Intronic
1176046955 20:63097675-63097697 CTGGGCATTGGGGATTTAGCCGG - Intergenic
1176321961 21:5336405-5336427 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1176479617 21:7268190-7268212 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1176758829 21:10752277-10752299 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1176922102 21:14700086-14700108 CTGGGCTCTGTGGACAAAGGTGG - Intergenic
1180398323 22:12380195-12380217 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1180510491 22:16082195-16082217 GTGCGCTTTGTGGCCTAAGGTGG - Intergenic
1181644748 22:24225305-24225327 CTGGGCTTTGTTGATCAAGATGG + Exonic
1182413866 22:30208641-30208663 CTGGACCGTGTGGATTCAGGAGG + Intergenic
1183829285 22:40409385-40409407 CTGGGCTTGGGGGATGGAGGTGG + Intronic
1183972551 22:41488767-41488789 CAGGCCTTTGGGGATTAAGGGGG + Intronic
1184349725 22:43935775-43935797 CTGGGCCTTTTGGATACAGGGGG + Intronic
1184631113 22:45780786-45780808 CTTGGGATTCTGGATTAAGGTGG + Intronic
1185136539 22:49076559-49076581 CTGGGCTCTGTCACTTAAGGAGG + Intergenic
950565370 3:13766823-13766845 CTGGGCTTTGAGGGGTAAGTAGG - Intergenic
953540587 3:43814356-43814378 CTGGGCTTGGGAGATTCAGGAGG - Intergenic
955693554 3:61613651-61613673 CTGGGCATTGTTTGTTAAGGGGG + Intronic
957079080 3:75621963-75621985 TCGGGCTTTGTGGATGCAGGTGG + Intergenic
958080003 3:88735642-88735664 ATGGACTTTGAGGATTCAGGGGG + Intergenic
958539203 3:95448336-95448358 GTGGGTTCAGTGGATTAAGGTGG + Intergenic
958678365 3:97294231-97294253 GTGTGCTTTGTGGATTCAGTGGG - Intronic
958740239 3:98060402-98060424 TTGGACTTTGAGGATAAAGGGGG + Intergenic
958789756 3:98637882-98637904 ATGGACTTTGGGGATTCAGGGGG - Intergenic
958998945 3:100939520-100939542 CTGGTCTTTGTGGCTTGTGGGGG - Intronic
961492361 3:127264672-127264694 CTGGGCTTTGAGGAATGAAGAGG + Intergenic
963299480 3:143582681-143582703 CTTGGCTCAGTGGATCAAGGAGG + Intronic
963326556 3:143869423-143869445 CTAGGCTCTGTGGAGGAAGGTGG + Intergenic
965971365 3:174560089-174560111 CTGGTCTGTGTGGATCAATGAGG + Intronic
966753324 3:183343615-183343637 CTGCACTTTGGGGATTGAGGTGG - Intronic
968831911 4:2936695-2936717 CTTGGCTTGGTGAATTAAAGTGG + Intergenic
969022160 4:4145918-4145940 CCGGGCTGTGTGGATGCAGGTGG + Intergenic
969564906 4:7971811-7971833 GTGGGCTGTGTGGAGGAAGGAGG - Intronic
969791300 4:9495581-9495603 CCGGGCTGTGTGGATGCAGGTGG - Intergenic
971170824 4:24230877-24230899 CTGGGAGTTGTTGACTAAGGGGG + Intergenic
973628179 4:52793351-52793373 CTGGGCTTCGTGCAGTATGGTGG - Intergenic
973855716 4:55008490-55008512 CTGGGCAGTGGGGATTAAAGGGG - Intergenic
974276821 4:59731344-59731366 GTGGACTTTGGGGATTCAGGGGG + Intergenic
975013332 4:69380958-69380980 CTGGGCTTTCTGGGTTAAGTAGG + Intronic
977782331 4:100994614-100994636 CTAATATTTGTGGATTAAGGTGG + Intergenic
977948639 4:102943722-102943744 ATGGGCTTTGGGGACTTAGGGGG + Intronic
981050121 4:140301322-140301344 CTGATCTCTGTGGATTTAGGGGG + Intronic
981591708 4:146371456-146371478 CTGGGCCTTGTGGAACAAGTAGG + Intronic
982983492 4:162172232-162172254 ATGGACTTTGGGGATTCAGGGGG - Intergenic
984734168 4:183095674-183095696 CTGGGATTGCTGGATTAAAGGGG + Intergenic
987267449 5:16271858-16271880 CTGAGTTTTGTTGATTCAGGTGG - Intergenic
990121530 5:52460099-52460121 TTGGGTTTTGTGGTCTAAGGTGG + Intergenic
992263419 5:74993167-74993189 CTGGGTTTTGTAGAATAAAGGGG - Intergenic
994012443 5:94921488-94921510 ATGTGCTTTGTGGGTTAAGCAGG - Intronic
994220382 5:97188322-97188344 ATGAGCTTTGTGGATTCAGGTGG - Intergenic
995694199 5:114861446-114861468 GTGGTCTTTGGGGACTAAGGGGG - Intergenic
997084365 5:130780389-130780411 ATGGGCTTTGGAGATTCAGGGGG + Intergenic
999396761 5:151234492-151234514 CTGAGCTGTGTAGATTAAGCAGG + Intronic
1000238339 5:159384780-159384802 ATGGACTTTGGGGATTCAGGGGG + Intergenic
1001134977 5:169094998-169095020 CTGGTCCCTGTGGTTTAAGGTGG - Intronic
1001919848 5:175591157-175591179 CTGGGCAGTGTGGATGCAGGTGG + Intergenic
1003857624 6:10292456-10292478 CTGGGCCTTGAGGATTTAGGGGG - Intergenic
1006026717 6:31151578-31151600 CTGGGGTCTGTGGAGCAAGGAGG - Intronic
1006452558 6:34113571-34113593 CTGAGCTTTGAGGATTGGGGTGG + Intronic
1007870696 6:45034190-45034212 CTAGGCCTAGAGGATTAAGGGGG + Intronic
1008096012 6:47340209-47340231 ATGGACTTTGTGGATTCAGGGGG + Intergenic
1008361691 6:50626519-50626541 ATGGGCTTTGGGGAATCAGGGGG + Intergenic
1008416230 6:51244052-51244074 ATGGACTTTGTGGACTCAGGGGG + Intergenic
1011789190 6:90879653-90879675 ATGGACTTTGGGGATTTAGGGGG - Intergenic
1012207913 6:96483921-96483943 ATGGGCTTTGGGGACTCAGGGGG - Intergenic
1012225268 6:96696068-96696090 ATGGACTTTGGGGATTCAGGGGG + Intergenic
1013452762 6:110301255-110301277 CTGAGCTGTGTGGATTCAGTAGG - Intronic
1014636654 6:123855682-123855704 CTGGTGTTTTTGCATTAAGGAGG + Intronic
1014792262 6:125686765-125686787 ATGGACTTTGGGGATTCAGGGGG - Intergenic
1017221074 6:151966839-151966861 CTGGGCATTGAGGCTTGAGGAGG - Intronic
1018282116 6:162198233-162198255 CTGGGCTTTGGAGATAGAGGTGG + Intronic
1020224080 7:6266094-6266116 CGGGGCTTGGTGGGTTAGGGTGG - Intronic
1022740202 7:33113079-33113101 CTGGCCTTAGTGGATTACGTTGG + Intergenic
1027141458 7:75660821-75660843 GAGGGCTTTGAGGATGAAGGGGG - Intronic
1027570858 7:79865055-79865077 CTGGACTTTCTGGATTGAGTGGG - Intergenic
1030641429 7:112010910-112010932 CTTGGCCTTGTGGTTCAAGGAGG - Intronic
1031980588 7:128121961-128121983 CTGGGCCCTTTGGCTTAAGGAGG + Intergenic
1032151186 7:129431542-129431564 CTGACCTCTGTGGATTAAAGTGG + Intergenic
1032748816 7:134815182-134815204 CTGGCCTTTGGGGATGAAGTGGG + Intronic
1037221388 8:16526755-16526777 CTGGGCATGGTGGAGTAAGCAGG - Intronic
1037611568 8:20480530-20480552 GAGGGCTTTATGGATTCAGGTGG + Intergenic
1038115677 8:24552562-24552584 ATGGACTTTGAGGATTCAGGAGG - Intergenic
1038423475 8:27449622-27449644 CTGGGCTTTGTGCAATCAAGAGG + Intronic
1039839635 8:41284633-41284655 CTGGGCTCTGTGGAGTGAGCAGG - Intronic
1040592866 8:48811283-48811305 TGGGGCTTTGTGGATTAACGAGG + Intergenic
1042128799 8:65565881-65565903 CTGGGATTGGTAGATTTAGGGGG + Intergenic
1042145355 8:65722603-65722625 TTGGGCTTTGGGTATAAAGGAGG - Intronic
1047696345 8:127407086-127407108 CTGAGCTTTGTGAACTAAGATGG - Intergenic
1049406704 8:142454860-142454882 CAGGGCTCTGTGGAGGAAGGAGG - Intronic
1049989054 9:975694-975716 CTGGGGTCTATGGGTTAAGGAGG + Intergenic
1050722327 9:8604732-8604754 CTGAGTTTGGTGGAATAAGGAGG + Intronic
1052254044 9:26432683-26432705 TTGGACTTTGGGGATTCAGGGGG + Intergenic
1054421620 9:64938716-64938738 GTGCGCTTTGTGGCCTAAGGTGG + Intergenic
1056511799 9:87313602-87313624 ATGGACTTTGGGGATTCAGGGGG + Intergenic
1056660301 9:88538270-88538292 CTGGGCTTTGAGGAATCAGGAGG - Intronic
1058645607 9:107128936-107128958 CTGGGCTGTGTGGAGTGAGATGG - Intergenic
1059211839 9:112520095-112520117 CTGGGCTTGATGGATTAAATTGG + Intronic
1060276718 9:122188062-122188084 CTGGACTTTGATGATTATGGAGG + Intronic
1060489418 9:124071569-124071591 CTGGGCTTTGAAGAATAAGTAGG - Intergenic
1060552324 9:124491492-124491514 CTGGGGTTTGTGTGTGAAGGAGG - Intronic
1061272438 9:129550784-129550806 CTGGGCTTTGTGGATGACCTTGG + Intergenic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1062101463 9:134730758-134730780 CCGGTCTTTGAGGATTCAGGTGG + Intronic
1062123797 9:134848698-134848720 CTGGGAGGTGTGGATTCAGGAGG - Intergenic
1203379009 Un_KI270435v1:11535-11557 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1203379534 Un_KI270435v1:18890-18912 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1203397342 Un_KI270519v1:36159-36181 GAGGGCTTTGAGGACTAAGGTGG - Intergenic
1203397511 Un_KI270519v1:38857-38879 GAGGGCTTTGAGGACTAAGGTGG - Intergenic
1186303389 X:8226705-8226727 ATGGACTTTGGGGATTCAGGGGG - Intergenic
1187536915 X:20149414-20149436 TTGGGATTTGTGGATTCATGAGG + Intergenic
1188085650 X:25898580-25898602 GTGGGTTTTGTGTCTTAAGGGGG - Intergenic
1189368497 X:40408977-40408999 TTGTGCTGTGGGGATTAAGGAGG + Intergenic
1190631661 X:52392982-52393004 ATGGACTTTGTGGACTCAGGGGG - Intergenic
1193203605 X:78721656-78721678 GTGGACTTTGGGGACTAAGGGGG + Intergenic
1193354405 X:80501050-80501072 ATGGACTTTGGGGATTCAGGCGG + Intergenic
1199745083 X:150767387-150767409 CTGGACTGTGTGGCTGAAGGGGG - Exonic
1201271633 Y:12261438-12261460 CTGGACTTTGTGGGTTGAGTGGG - Intergenic
1201579226 Y:15493605-15493627 ATGGACTTTGGGGATTCAGGGGG - Intergenic
1201639519 Y:16164512-16164534 CTGGGCTTCCTGGATTCAGTAGG - Intergenic
1201663294 Y:16420812-16420834 CTGGGCTTCCTGGATTCAGTAGG + Intergenic