ID: 902892847

View in Genome Browser
Species Human (GRCh38)
Location 1:19457045-19457067
Sequence CTGGAACTTCCTGCCTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902892847_902892851 11 Left 902892847 1:19457045-19457067 CCCAGAAAGGCAGGAAGTTCCAG 0: 1
1: 0
2: 1
3: 31
4: 270
Right 902892851 1:19457079-19457101 TCATTCTACCCAAGTCTTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 117
902892847_902892855 28 Left 902892847 1:19457045-19457067 CCCAGAAAGGCAGGAAGTTCCAG 0: 1
1: 0
2: 1
3: 31
4: 270
Right 902892855 1:19457096-19457118 TGTTGGAACTAAAGCACAGCGGG 0: 1
1: 0
2: 1
3: 13
4: 130
902892847_902892854 27 Left 902892847 1:19457045-19457067 CCCAGAAAGGCAGGAAGTTCCAG 0: 1
1: 0
2: 1
3: 31
4: 270
Right 902892854 1:19457095-19457117 TTGTTGGAACTAAAGCACAGCGG 0: 1
1: 0
2: 0
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902892847 Original CRISPR CTGGAACTTCCTGCCTTTCT GGG (reversed) Intronic
900110246 1:1002136-1002158 CCCGAACTCCCTGCCTGTCTAGG - Intergenic
901260856 1:7869514-7869536 CTTGAAAATGCTGCCTTTCTAGG + Intergenic
901855521 1:12041962-12041984 TTGGGACTTCTTGCCTTGCTGGG + Intergenic
902129743 1:14249445-14249467 CTGGAACTTCCTGATTTTGTGGG - Intergenic
902892847 1:19457045-19457067 CTGGAACTTCCTGCCTTTCTGGG - Intronic
903413609 1:23167369-23167391 CTGGACCTCCCTGCCTTTTGGGG - Intronic
904344109 1:29856921-29856943 CTGGCTGTTCCTGCCTCTCTGGG + Intergenic
905334809 1:37237303-37237325 ATGAAACTTTCTGCCTTTCAGGG - Intergenic
906445092 1:45889418-45889440 CTAAAACTACCTGCCTTCCTCGG + Intronic
907267983 1:53274385-53274407 CTGGAACTTTCTCTCTTCCTCGG - Intronic
907734162 1:57095461-57095483 CTGCTACTTCCTACCTGTCTTGG + Intronic
908367179 1:63436933-63436955 CTTGAACTTCCTGTTCTTCTTGG + Exonic
908781376 1:67693645-67693667 CTAGTACTTTCTGCCTTTCATGG + Intergenic
911758408 1:101587925-101587947 CTAGAGCTTCCTGCATTTTTTGG + Intergenic
913520068 1:119636927-119636949 CTGTAACACCCTGCCTCTCTTGG + Intronic
913660384 1:121001778-121001800 CTGGCCCTTCCTGCCTTTGATGG - Intergenic
914011749 1:143784935-143784957 CTGGCCCTTCCTGCCTTTGATGG - Intergenic
914166084 1:145176199-145176221 CTGGCCCTTCCTGCCTTTGATGG + Intergenic
914506702 1:148295862-148295884 CTGGAACTTCAGGCCTGTTTCGG + Intergenic
914650375 1:149693594-149693616 CTGGCCCTTCCTGCCTTTGATGG - Intergenic
914953266 1:152138112-152138134 CTGGAAATTCCTATCTTTCTTGG + Intergenic
915586690 1:156847614-156847636 CGGGAAGTGCCTGCCTTTGTTGG + Intronic
917455348 1:175181368-175181390 ATGGAAGTTCCTGGCTTCCTTGG - Intronic
917503181 1:175604383-175604405 TTGGAACTTCATGCCTTTTGAGG - Intronic
918202648 1:182281601-182281623 CTGAAACTTCCTCCCTGTGTTGG - Intergenic
918317127 1:183331560-183331582 TTCCAACTCCCTGCCTTTCTGGG + Intronic
919386215 1:196926092-196926114 CTGTAACTTTCTCTCTTTCTGGG + Intronic
920159881 1:203988521-203988543 CTGCTGCTTCCTGACTTTCTGGG - Intergenic
920244149 1:204575492-204575514 CTGGAACCTGCTGCCTTCCTTGG + Intergenic
920417903 1:205811005-205811027 CAGAAACTTCCTCCCTTCCTGGG + Exonic
920521120 1:206627447-206627469 TTGGCTCTACCTGCCTTTCTTGG - Intergenic
921063629 1:211607445-211607467 CTGGCCCTCCCTCCCTTTCTGGG - Intergenic
923448388 1:234093756-234093778 CTGGCATTTCCTTTCTTTCTTGG - Intronic
1063391255 10:5651153-5651175 CTGGAAGTTTCCTCCTTTCTGGG - Intronic
1063459992 10:6209141-6209163 CTGGGACTTGGTGACTTTCTGGG + Intronic
1063686017 10:8237783-8237805 CTGGTGCTTCCAGCCTGTCTCGG + Intergenic
1066001214 10:31105680-31105702 CTGGATCATCCTGCCCTTCTAGG + Intergenic
1066217526 10:33302279-33302301 TTGTTACTTCCTGCCCTTCTGGG + Intronic
1067525559 10:47036280-47036302 CTTGAACTACCTGCCTTCCTGGG - Intergenic
1068257184 10:54527634-54527656 CTGGAAATTCATGCTTTACTTGG - Intronic
1069064745 10:63930650-63930672 CTGGCACTGACTGCCGTTCTTGG + Intergenic
1069420847 10:68245100-68245122 TTGGCACTTCCTTCCTTTCCTGG - Intergenic
1069535138 10:69247659-69247681 CTGGACTATCCTGCCTATCTGGG + Intronic
1070616765 10:77975392-77975414 CTGGAACTGCCAGCCTTGCTAGG - Exonic
1071231643 10:83594868-83594890 CTGGAATTTCCAGCCTTCCAGGG + Intergenic
1072213827 10:93271546-93271568 TGGGAACTTCCTGCCTCTCAGGG + Intergenic
1073736683 10:106355561-106355583 CTTAGCCTTCCTGCCTTTCTGGG + Intergenic
1073958492 10:108899087-108899109 TTGTTTCTTCCTGCCTTTCTAGG - Intergenic
1075444511 10:122504331-122504353 CTGGGCCTGCCTCCCTTTCTAGG + Intronic
1075621248 10:123929746-123929768 CAGGACCTGCTTGCCTTTCTGGG - Intronic
1076461382 10:130649710-130649732 CTCCAATGTCCTGCCTTTCTAGG + Intergenic
1076690886 10:132223440-132223462 CTGGCACCTCCCGCCTTTCCAGG + Intronic
1077502812 11:2916962-2916984 CTGGGCCTTCCTGCCTCTCTGGG - Intronic
1077597476 11:3546445-3546467 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
1078556525 11:12331380-12331402 ATGGAGCTTCTTGCCTTTTTTGG + Intronic
1078735506 11:14016149-14016171 CAGGAACTTCCTTTCTTTTTGGG + Intronic
1078871657 11:15351012-15351034 CTAGAAATTCCTGCCTTCATGGG + Intergenic
1080394318 11:31875913-31875935 CTGCAGCTTCCTGGCTTTCTTGG + Intronic
1080731446 11:34959004-34959026 GTGGAACTTGCTGCATTTCAGGG - Intronic
1083350202 11:62022577-62022599 ATGGAACTTCATGCCCTTTTTGG - Intergenic
1084333030 11:68440709-68440731 CTGGTTCCTCCTGCCCTTCTGGG + Intronic
1085100004 11:73792629-73792651 TTTGGACTTCCTGCCCTTCTAGG - Intronic
1086046549 11:82539463-82539485 CTGGACCACCCTGGCTTTCTGGG - Intergenic
1087189154 11:95233914-95233936 CCTGACCTTCCTTCCTTTCTTGG + Intergenic
1089441556 11:118522144-118522166 TAGGAACTTCCGGCATTTCTTGG - Exonic
1090066822 11:123510508-123510530 CTGGGACTTCCTCAGTTTCTGGG - Intergenic
1090959102 11:131539952-131539974 CTGGAACTTCGTGTGTTCCTTGG - Intronic
1091202588 11:133793483-133793505 AGGGAATTTCCTTCCTTTCTTGG + Intergenic
1092128028 12:6088975-6088997 CTGGTGCTTTCTGTCTTTCTAGG - Intronic
1092297459 12:7211814-7211836 CTGGCTCTGCCTGCCTTTATCGG + Intronic
1092423661 12:8355739-8355761 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
1093670042 12:21862756-21862778 CTGGAAGTTCCAGCCCATCTTGG - Intronic
1094533339 12:31298332-31298354 CTTGAGCTGCCTGCCTGTCTTGG - Intronic
1094834552 12:34316159-34316181 CTGGACCTTCTTGCCTCTTTGGG + Intergenic
1095051391 12:37557721-37557743 TTGGAATCTCCTGCCTATCTGGG + Intergenic
1095054714 12:37585323-37585345 TTGGAATCTCCTGCCTATCTGGG + Intergenic
1097235924 12:57539555-57539577 GTGGTATGTCCTGCCTTTCTAGG + Intronic
1097882227 12:64696266-64696288 GTGGACTTTCCTCCCTTTCTTGG - Exonic
1101998610 12:109542695-109542717 CTGGAAGTCCCTGCGTTCCTTGG - Intergenic
1103465125 12:121136281-121136303 ATGGGACTTCCTGACATTCTTGG + Intronic
1103911102 12:124352869-124352891 CAGGGACTTCCTGCCCATCTTGG - Intronic
1104278395 12:127351840-127351862 CTGGCACTGCCAGCCTCTCTGGG - Intergenic
1106547593 13:30744096-30744118 CTGGAAGCTCCTCCCATTCTGGG - Exonic
1106671817 13:31914304-31914326 CTGGAACTTCCTTCCTTTTAAGG - Intergenic
1107429216 13:40323924-40323946 CTGGTAATTTCTGCCTTTCAAGG + Intergenic
1109914147 13:68957813-68957835 CTGGATCTTCCAGCCTCCCTCGG + Intergenic
1110969091 13:81739275-81739297 CTGGCCCTTCCTGCCTTCTTTGG + Intergenic
1111700550 13:91682654-91682676 CTGTACCCTCCTGCCTTTCCTGG - Intronic
1112248686 13:97757920-97757942 CAGGCACTTCCTGCTTTGCTAGG + Intergenic
1112409790 13:99153064-99153086 ATGGAACTGCCTGCCATTCTGGG + Intergenic
1117255023 14:53968893-53968915 CTGGCACTTCCTGCTTGGCTGGG + Intergenic
1117325330 14:54663646-54663668 CTCTAACCTGCTGCCTTTCTAGG - Intronic
1118721959 14:68600621-68600643 CTGGCATTTCCTTCCTTTCATGG + Intronic
1119234107 14:73005290-73005312 CTGGAGCTTCGTTCCTTCCTGGG - Intronic
1119331092 14:73794347-73794369 CAGAAACTACCTGCATTTCTTGG - Intergenic
1119429931 14:74559997-74560019 ATGGAACTTGCTATCTTTCTGGG + Intronic
1119720579 14:76887432-76887454 CTGTTACTTCCTGCTTCTCTCGG - Intergenic
1121402034 14:93688461-93688483 CTGGATCTTTCTGGCTTTGTAGG + Intronic
1123143512 14:106106008-106106030 CTGCAGCTTCCTGCTTTTTTCGG + Intergenic
1128438888 15:67684073-67684095 CTGCATGTTCTTGCCTTTCTAGG - Intronic
1128997151 15:72305652-72305674 CTGGCTCTTCCTACTTTTCTTGG + Intronic
1129511989 15:76131000-76131022 ATGGACCTTCCTGTCTCTCTGGG - Intronic
1130296261 15:82648473-82648495 CTGGAACTTCCTGACTCTCGCGG - Intronic
1130548436 15:84873290-84873312 CTTTGAATTCCTGCCTTTCTTGG + Exonic
1130717835 15:86353501-86353523 GTGGAAGGTCCTGCCTTTCCAGG + Intronic
1131294981 15:91139876-91139898 CCGGATCTTCCTCCCTTCCTTGG - Intronic
1132101324 15:99025421-99025443 CTACATCTTCCAGCCTTTCTGGG - Intergenic
1132949709 16:2554312-2554334 CTGCAACTTCCTTCCTGCCTCGG - Intronic
1132964639 16:2645855-2645877 CTGCAACTTCCTTCCTGCCTCGG + Intergenic
1133497697 16:6335379-6335401 CTAGAACTTCCTCCCTCTCCTGG - Intronic
1133691492 16:8220049-8220071 CTGGAAGTTCCTGTATTCCTTGG + Intergenic
1133845267 16:9447628-9447650 TTTGAACTTCCTGCTATTCTGGG - Intergenic
1135978494 16:27127607-27127629 CTGGAACTTACTGCCTTTAAGGG - Intergenic
1136287539 16:29253310-29253332 CTGGACCTTCCTGGCTGTCTCGG + Intergenic
1136507279 16:30712787-30712809 CTTGAGCTTCCTCTCTTTCTGGG - Exonic
1137253765 16:46758782-46758804 CTGGAACTCCCTGGCTCTGTGGG + Intronic
1138240742 16:55425191-55425213 CTGGAACTTCCTTCCTGTGCTGG + Intronic
1138371195 16:56527699-56527721 CTGGACCATGCTGCCATTCTGGG - Intergenic
1138497143 16:57415645-57415667 CAGCAACTTCCTGCCCCTCTTGG + Intronic
1139255498 16:65537742-65537764 CAGAAACTTACTGGCTTTCTTGG - Intergenic
1139717276 16:68823575-68823597 TTGCAAATTCCTGCCATTCTGGG + Exonic
1140925082 16:79574922-79574944 CAGCAGCTTCTTGCCTTTCTGGG + Intergenic
1141916154 16:87098707-87098729 TTGGAACTTTCTCCCTTCCTCGG - Intronic
1142030062 16:87834105-87834127 CTGCCTCTTTCTGCCTTTCTGGG + Intronic
1143649810 17:8256484-8256506 ATGGACCTTGCTTCCTTTCTGGG - Intronic
1143722095 17:8819515-8819537 CTTGAACTTCCTGCAGCTCTTGG + Intronic
1145375388 17:22342799-22342821 TTGGAATCTCCTGCCTATCTGGG + Intergenic
1146038470 17:29429097-29429119 TTAGAACTTAATGCCTTTCTAGG + Intronic
1150839556 17:68595266-68595288 CAGGAAGTGCCTGTCTTTCTTGG + Intronic
1152713328 17:81885895-81885917 TTGGGACTTCCTGGCATTCTCGG - Intergenic
1152927072 17:83092253-83092275 CTGGAACTCACTGCCCTGCTGGG + Intronic
1154247621 18:12713691-12713713 CTGAAACTTCCTCCCCTTATGGG - Intronic
1154339027 18:13488113-13488135 CTGGAAGTCCCTGCCAGTCTAGG - Intronic
1156391188 18:36652171-36652193 CTGGAACTTCATCTCTGTCTTGG - Intronic
1157568357 18:48695878-48695900 AGGGAACTTCCTGCCATTGTTGG + Intronic
1158439942 18:57466785-57466807 CTCTAAAATCCTGCCTTTCTAGG + Intronic
1160789157 19:915183-915205 CTGGGCCTTCCTCCCATTCTGGG + Intergenic
1161298350 19:3531058-3531080 CTGGACCTGCCATCCTTTCTAGG - Intronic
1163698716 19:18776656-18776678 CTGAAACGCCCTGTCTTTCTGGG - Intronic
1164861867 19:31567966-31567988 GTGGACCTACCTGCCTTTATAGG + Intergenic
1165721286 19:38081687-38081709 CTGGGACATGCTGCCATTCTGGG - Exonic
1166357648 19:42236533-42236555 CTGGAGCCTCCTGCCTTTTATGG - Intronic
1166914822 19:46188226-46188248 CTGGGGTTACCTGCCTTTCTGGG - Intergenic
1167615302 19:50529865-50529887 CTGGAACTTTCCCCCTCTCTGGG + Intronic
925166429 2:1718732-1718754 CTGGATCTCCAGGCCTTTCTAGG + Intronic
926742234 2:16121785-16121807 CAGGAACTTCCTCCCCTCCTTGG - Intergenic
927143186 2:20143459-20143481 CTGGAAATGCCTGCCTTTTATGG + Intergenic
928623428 2:33114621-33114643 CTGGTAGTTCATGCTTTTCTGGG - Intronic
929410456 2:41693248-41693270 CAGAAAGTTCCTGGCTTTCTTGG - Intergenic
931971223 2:67589175-67589197 CTGGAATTTCCTGATTTTCCAGG - Intergenic
933135878 2:78734492-78734514 CTGGAGCCTCCTGCATTCCTTGG - Intergenic
935422279 2:102881624-102881646 TTGGAACTTCCTGCTTTGCTGGG - Intergenic
936507859 2:113122384-113122406 CTGAATCTCCCTGCCTCTCTGGG + Intronic
937346644 2:121130233-121130255 CTGGAACTTCCTGCCATCATGGG - Intergenic
938019146 2:127891943-127891965 CTGGAACTTCCTGCACTTGCTGG + Intergenic
938066049 2:128282622-128282644 CTGCCACTTCCTGCCTTGCAGGG - Intronic
938308207 2:130268606-130268628 CTGGGATTTCCTGGCTTTCCTGG + Intergenic
938447123 2:131388230-131388252 CTGGGATTTCCTGGCTTTCCTGG - Intergenic
938981596 2:136532239-136532261 TTGGAACTGCTTGCCTTTCAGGG + Intergenic
939587049 2:144018853-144018875 CTGGCACTAACTCCCTTTCTAGG - Intronic
940207153 2:151215852-151215874 CTGGAACTTCCAGTCTTGATTGG - Intergenic
941598136 2:167504057-167504079 CAAGAACTTCCTGGCTTCCTGGG + Intergenic
942199441 2:173556307-173556329 CTAAAACTTGCTGCCTTTTTAGG + Intergenic
943127304 2:183810534-183810556 CTGGTACTTCCTGACTTCCTGGG + Intergenic
945630585 2:212270628-212270650 CTGGAACTTTCTACGTTTTTTGG + Intronic
947624406 2:231610813-231610835 CTGGTGTCTCCTGCCTTTCTGGG - Intergenic
947685611 2:232081701-232081723 CTGGAACCTCCTGTCATACTGGG - Intronic
948143056 2:235688476-235688498 CCGAAACTTTCTGCCTCTCTTGG + Intronic
948427014 2:237894766-237894788 CTGGAACCTTCTCCCTTGCTCGG + Intronic
1168794988 20:605447-605469 CTAGCACTTCCTGCCTTTCTGGG + Intronic
1169272681 20:4212690-4212712 CTAGAACTGCCTGCCTTATTAGG - Intergenic
1170161867 20:13321405-13321427 CTGAAGCCTGCTGCCTTTCTAGG + Intergenic
1171527543 20:25826982-25827004 TTGGAATCTCCTGCCTATCTGGG - Intronic
1171545920 20:26001236-26001258 TTGGAATCTCCTGCCTATCTGGG + Intergenic
1171549283 20:26028902-26028924 TTGGAATCTCCTGCCTATCTGGG + Intergenic
1172702490 20:36862157-36862179 CTGTCTCTGCCTGCCTTTCTGGG - Intronic
1173324252 20:42018319-42018341 ATGGCACATCCTGCCTTGCTAGG - Intergenic
1173581035 20:44146623-44146645 GTGGAACTTCCTACCTATCCAGG + Intronic
1175134059 20:56809812-56809834 CTGGAACATGCTTCCATTCTTGG - Intergenic
1175204121 20:57298513-57298535 TTGGAACTTCATTCCTTTCACGG - Intergenic
1176013471 20:62913710-62913732 CTGCAACTTTGTGCCCTTCTGGG - Intronic
1176429592 21:6567623-6567645 CTGGAACAGCCTGCCTTGCAAGG + Intergenic
1176923005 21:14711503-14711525 CTAGTATTTCCTGCCTTTCAGGG - Intergenic
1178361968 21:31956130-31956152 CAGGATCTTCCCACCTTTCTGGG - Intronic
1179006385 21:37519018-37519040 CTGGCAATTTCTGCCTTTCCCGG - Intergenic
1179098210 21:38334469-38334491 CTGGAAATTCTTCCCTTTGTTGG - Intergenic
1179214976 21:39359670-39359692 CTAGAAATACCTGACTTTCTGGG - Intergenic
1179482664 21:41688269-41688291 CTGGATTGTCCTGCCTTTCCCGG + Intergenic
1179704986 21:43175085-43175107 CTGGAACAGCCTGCCTTGCAAGG + Intergenic
1183335062 22:37241657-37241679 CTTGCACTTCCTGTCTTTCAGGG - Exonic
1184294669 22:43515825-43515847 CTGCCCCTTCCTGCCTTCCTGGG - Intergenic
1184951649 22:47847303-47847325 CTGGAAAGTCCTGACTTTCTGGG - Intergenic
1185071175 22:48657296-48657318 CTGGAAGTTTGTGTCTTTCTAGG - Intronic
949368163 3:3305530-3305552 CAAGAGCTTCCTGCCTATCTTGG - Intergenic
953200964 3:40778208-40778230 CTGGAAGTTTCTGCCTTTGTTGG - Intergenic
953379665 3:42459227-42459249 AAGGAACTTCCTGACTTTCAGGG + Intergenic
957067643 3:75538817-75538839 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
958699363 3:97568464-97568486 CTGGCACTTGCTTCCTTTCTAGG + Intronic
958891790 3:99791754-99791776 GTGGAGCTTCCTGCCATTGTAGG - Intronic
959022823 3:101207380-101207402 TTGGAAATTCTTGCCTTTCATGG - Intergenic
961163447 3:124748725-124748747 CTGGATCTTCCTGCTCTCCTGGG - Intergenic
961426047 3:126849084-126849106 CTGTAGCTTCCAGGCTTTCTAGG + Intronic
961453103 3:127011382-127011404 CTGGGCCTTCCTGCCTGCCTTGG + Intronic
961496824 3:127299156-127299178 ATTGAATTTCCTGCCTTTTTTGG - Intergenic
963523712 3:146389373-146389395 GTGGAAATTCCTGCCTTCCAGGG - Intergenic
965514519 3:169606629-169606651 CTGGGACTGCCTGCCTAACTTGG - Intronic
967984473 3:195084969-195084991 CTGGAAGTGGCTGCCTTGCTAGG - Intronic
968962427 4:3752436-3752458 CTGGGGCTTCCCTCCTTTCTGGG + Intergenic
969012219 4:4075383-4075405 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
969307782 4:6335642-6335664 CTGGAACTTCCTTCCTCCGTCGG - Intronic
969741865 4:9034325-9034347 CTGGAACTTTCTTCCTCTGTGGG - Intergenic
969801238 4:9567222-9567244 CTGGAACTTCCTTCCTCTGTGGG - Intergenic
970769027 4:19587795-19587817 CTTGATCTACCTGCCTTTCATGG - Intergenic
970866017 4:20759736-20759758 CTGGAAATTCCTCCATTTTTTGG + Intronic
972703368 4:41515742-41515764 CTGGAGCTTCCTGCTGCTCTTGG + Intronic
973778280 4:54263874-54263896 CTGGAACTTCTTTCCTTTGACGG - Exonic
974574269 4:63697836-63697858 CTAGGAGTTCCTGACTTTCTGGG - Intergenic
975840060 4:78464421-78464443 CTGCACTTTCCTGCCATTCTAGG + Intronic
986337833 5:6768235-6768257 CTGGCACCTCCTCCCTCTCTCGG + Intergenic
988483831 5:31651893-31651915 CTGGAACTTCCACCCTCTCTGGG + Intronic
989085149 5:37668378-37668400 ATGAAACATCCTGTCTTTCTTGG - Intronic
991492967 5:67201251-67201273 TGGGATCTTCCTGTCTTTCTAGG - Intergenic
991925064 5:71697700-71697722 GTTGAACTTCCTTCCTCTCTCGG - Intergenic
993651575 5:90529280-90529302 CTGGAAGTTCTTCCCTGTCTCGG + Intronic
994102679 5:95911141-95911163 CTGTATCTTCCTGCCTCTTTGGG - Intronic
994156686 5:96511569-96511591 CTAGAAGTTCCTGCATGTCTGGG - Intergenic
996928765 5:128860960-128860982 CTGCTTCTTCCTGCCATTCTAGG - Intronic
997738088 5:136229111-136229133 CTAGTCCTTCCTGCCCTTCTGGG - Intronic
998784212 5:145691167-145691189 CAGGAACCTCCTGTCTTTTTGGG - Intronic
1000261089 5:159589271-159589293 CTGGAAGATCCTTCCCTTCTAGG + Intergenic
1000324529 5:160162226-160162248 CAGGAACTTCCTGTCTCTCCAGG + Intergenic
1001130937 5:169062880-169062902 CTGGACATTCCTGTCATTCTTGG - Intronic
1001237658 5:170043704-170043726 CTTGAACCTCCTGCCCTGCTGGG + Intronic
1001955256 5:175844288-175844310 CAGAAACTTCTTGCCTTTCTGGG - Intronic
1003260175 6:4509813-4509835 CTGCAGCTGCCTGTCTTTCTTGG - Intergenic
1003330058 6:5122280-5122302 CTAGAAGTTCCTGACTTTGTGGG + Intronic
1003613731 6:7636280-7636302 CTTGGACTTCCTGCCTTTGGAGG - Intergenic
1004656140 6:17663377-17663399 CCGCAACCTCCTGCCTTGCTAGG + Intronic
1006126369 6:31841376-31841398 CTGCAACTTTCTGCTTTTCTGGG + Intergenic
1006276370 6:33007968-33007990 CTGGACCTTCCCGCCTGACTGGG + Intronic
1008464909 6:51819602-51819624 CTGGAACATACTGCCTAGCTGGG - Intronic
1009691527 6:67039684-67039706 ATGTTACTTCCTGCCTTTCTGGG - Intergenic
1010968986 6:82244434-82244456 CTGCGACTTCCTGCCCTTCCTGG - Intronic
1012760744 6:103297418-103297440 CTGGAACTAACTGCCTTTGCTGG + Intergenic
1012814879 6:104010676-104010698 CTTGCACTGCCTGCATTTCTTGG - Intergenic
1014376199 6:120678158-120678180 CTTGAACTTCCTTCCTTTATAGG - Intergenic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1015377620 6:132528292-132528314 CTGGATCCTCCTGTTTTTCTGGG + Intergenic
1019497947 7:1349263-1349285 CTGGTCCTTCCTGCCATTCTTGG + Intergenic
1021176354 7:17454200-17454222 TTGGAACTTCGTTCTTTTCTTGG + Intergenic
1022040404 7:26576040-26576062 CTGCCACTTCCTGACTTGCTTGG - Intergenic
1022410066 7:30132745-30132767 CTGCAACTTCCTTCATTGCTCGG - Intergenic
1023508162 7:40921728-40921750 CTGTAACCTCCTGCTTTTCGTGG + Intergenic
1023615948 7:42019864-42019886 CTTGTACTTCATCCCTTTCTTGG - Intronic
1023854122 7:44170943-44170965 CTGGAATATCCTTCCCTTCTTGG - Intronic
1025298102 7:57792887-57792909 TTGGAATCTCCTGCCTATCTGGG + Intergenic
1027168699 7:75854528-75854550 CTTGAACTTCCAGTCTTCCTGGG + Intronic
1027815028 7:82957881-82957903 CTTGAACTTGTTGCCTTTCTTGG + Intronic
1031084233 7:117286518-117286540 CTGGAAATTCCTGCCACTCTAGG + Intronic
1031348545 7:120699588-120699610 TTGGAAATTCCTGACCTTCTTGG - Intronic
1033028633 7:137802743-137802765 CTCGAACTTCTTCCCTTGCTGGG + Intronic
1033655361 7:143369962-143369984 TTGGACCTTCCTGCCTGTGTGGG - Intergenic
1034402314 7:150870859-150870881 CTGCCAGTCCCTGCCTTTCTAGG - Intergenic
1034497946 7:151433267-151433289 CCGCACCTTCCTGCTTTTCTGGG - Intronic
1034956916 7:155340481-155340503 AGGGAACTCACTGCCTTTCTTGG + Intergenic
1035314989 7:157991988-157992010 CTGGAGCCTCCTGCATGTCTGGG - Intronic
1035717817 8:1767213-1767235 CTCAAACCTCCTGACTTTCTGGG - Intronic
1036253734 8:7187474-7187496 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
1036887201 8:12567073-12567095 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
1036894796 8:12625174-12625196 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
1037961851 8:23103410-23103432 CTGGAACTTCCCTCCCTTCGCGG - Intronic
1038261911 8:26003052-26003074 CAGGAACTTCCTGTGTTCCTTGG - Intronic
1042080072 8:65041884-65041906 CTGGTAATTCCTGCCTTCCCTGG - Intergenic
1043202407 8:77386744-77386766 CTGGCATTTCCTTCCTTTGTGGG + Intergenic
1044384851 8:91575742-91575764 CTGGATTGTCCTGTCTTTCTGGG + Intergenic
1047564628 8:126030331-126030353 CTGGAACATACAGCATTTCTAGG - Intergenic
1049127473 8:140804915-140804937 CTGGGACATCCTGCCCTTTTGGG + Intronic
1050745513 9:8871235-8871257 CTGGAACATCCTTCCTATTTGGG + Intronic
1054651209 9:67625542-67625564 TTGGAATCTCCTGCCTATCTGGG + Intergenic
1056115557 9:83438049-83438071 CTGGCACTTCCAGCCTCCCTGGG - Intronic
1057808782 9:98241573-98241595 CTGAAGCTTCCTTCCTTTCTTGG + Intronic
1057962739 9:99472131-99472153 ATGGAACTTCCTGCCTCACAGGG - Intergenic
1059426645 9:114225302-114225324 CTGGGACTTTCTGCATTTCATGG + Intronic
1060913453 9:127369506-127369528 CTGGTAATCCCTGCCTTTCCGGG - Intronic
1061164500 9:128914441-128914463 CTGGAAGTCCCTCCCTCTCTGGG - Intronic
1061390154 9:130313172-130313194 ATGGAATTTCCTGCCTATCTGGG + Intronic
1062130270 9:134888736-134888758 GTGGCACTTCCTTCCTTCCTGGG + Intergenic
1062147531 9:134998034-134998056 CTGGAACTCCCTTCATTCCTTGG - Intergenic
1062229845 9:135475859-135475881 CTGGAACCTCCTGCACCTCTGGG - Intergenic
1062428447 9:136516673-136516695 CTGGAGCCTCCTCCCTGTCTGGG + Intronic
1185734540 X:2486897-2486919 AAGGAACTACCTGCCTTTCACGG - Exonic
1185755226 X:2647936-2647958 CTGAAGTTTGCTGCCTTTCTTGG - Intergenic
1186705621 X:12137450-12137472 CTGGATCTTCCAACATTTCTGGG + Intergenic
1186846239 X:13533829-13533851 CTGACAGTTCCTGCCTTTCAGGG - Intergenic
1189319377 X:40078473-40078495 CTCAAACTACCTGCGTTTCTAGG + Intronic
1190380676 X:49837157-49837179 CTGGAGCTTCATCCTTTTCTGGG + Intergenic
1192472484 X:71411154-71411176 CTGCAACTTCCTCCTTTTCTGGG + Intronic
1194186834 X:90781067-90781089 TTGAAATGTCCTGCCTTTCTAGG + Intergenic
1195325686 X:103756500-103756522 CTGGCATTTCCTGCTGTTCTTGG - Intergenic
1195758149 X:108219714-108219736 ATGGGAGTTCCTGGCTTTCTTGG - Exonic
1196393323 X:115233353-115233375 CTGGATCTTCCCGTCTTTCCCGG - Intronic
1199768831 X:150960510-150960532 TGGCAACTTCCTGCATTTCTTGG + Intergenic
1200533430 Y:4363141-4363163 TTGAAATGTCCTGCCTTTCTAGG + Intergenic