ID: 902894497

View in Genome Browser
Species Human (GRCh38)
Location 1:19469571-19469593
Sequence GAGTCAGCTCAGAGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902894488_902894497 29 Left 902894488 1:19469519-19469541 CCAGAACAGGGAGATTGAGGAAG 0: 1
1: 0
2: 1
3: 18
4: 260
Right 902894497 1:19469571-19469593 GAGTCAGCTCAGAGGGCTCTGGG 0: 1
1: 1
2: 3
3: 27
4: 244
902894493_902894497 -4 Left 902894493 1:19469552-19469574 CCTGCTAGGCAGGGAGGATGAGT 0: 1
1: 0
2: 0
3: 21
4: 468
Right 902894497 1:19469571-19469593 GAGTCAGCTCAGAGGGCTCTGGG 0: 1
1: 1
2: 3
3: 27
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902894497 Original CRISPR GAGTCAGCTCAGAGGGCTCT GGG Intronic
900315224 1:2052918-2052940 AAGTGTGCTCAGAGGGCCCTGGG - Intronic
900353731 1:2249664-2249686 GAGCCAGCACAGAGGGCTCACGG + Intronic
900644924 1:3704698-3704720 CAGACACCTCAGAGGCCTCTTGG + Intronic
900737432 1:4308010-4308032 GTGACAGCAGAGAGGGCTCTGGG - Intergenic
901448916 1:9324489-9324511 GGGTCGGCTCGGAGGGCTGTGGG + Intronic
902894497 1:19469571-19469593 GAGTCAGCTCAGAGGGCTCTGGG + Intronic
903660169 1:24972270-24972292 GAGTGAGCTCAGAGGGCTCTGGG - Intergenic
903660174 1:24972299-24972321 GAGAGAGCTCAGAGGGCTCTGGG - Intergenic
903867492 1:26410191-26410213 GGGTCAGCTCAGAGGCCTGAGGG + Intergenic
904473413 1:30749619-30749641 GACCCAGCACACAGGGCTCTGGG + Intronic
904927412 1:34059834-34059856 GATTCAGCCCAGAGGGATCTGGG - Intronic
905869016 1:41392307-41392329 GAGTCAGGCCTGAAGGCTCTGGG + Intergenic
909548957 1:76877204-76877226 GAATCACCGCAGAGGCCTCTAGG - Intronic
912074063 1:105850317-105850339 GCTTCAGCTCAAAGGGGTCTAGG + Intergenic
912848902 1:113104212-113104234 GAGTCATATCAAAGGGCTCAAGG - Intronic
912970251 1:114274793-114274815 TGCTCAGCTCAGAGGGCCCTGGG + Intergenic
914841451 1:151252432-151252454 GAGTGAGCTGAGATTGCTCTGGG - Intergenic
916285311 1:163099488-163099510 GAATCACAGCAGAGGGCTCTAGG + Intergenic
916449606 1:164907476-164907498 GAGCCAGCCCAGAGGGCTGATGG + Intergenic
916536510 1:165708729-165708751 GAGGCCGCTCAGAGGCCTCAGGG + Intergenic
917116306 1:171607427-171607449 GAGACACCTCTGAGGACTCTAGG - Intergenic
917196055 1:172466910-172466932 GAGTCAGCTCAGAAGGGCCATGG - Intronic
917666216 1:177228443-177228465 GAGCCAGCCCAGAGTGCCCTGGG + Intronic
920332533 1:205220609-205220631 CAGGCAGCTCATATGGCTCTGGG - Intergenic
923685393 1:236149793-236149815 GAGCTAGCTCAGTGGGCTCATGG + Intronic
1063074890 10:2705093-2705115 GAGTGTGCTCAGAGGCCACTTGG - Intergenic
1063999255 10:11649694-11649716 GTGTGAGCTCACAGGGCTGTTGG + Intergenic
1067109188 10:43387376-43387398 GAGTTAGCTGAGAAGGCTCTAGG - Exonic
1067535953 10:47110110-47110132 GATTGAGCTCAGCTGGCTCTGGG + Intergenic
1069628012 10:69880305-69880327 GAGTCAACACAGAGGGCACAGGG - Intronic
1069797369 10:71062008-71062030 GAGGCATTGCAGAGGGCTCTGGG + Intergenic
1070972729 10:80580824-80580846 TGGACAGCTCAGAGGGCTTTGGG + Intronic
1071404569 10:85317793-85317815 CAGTCACCTCAGTTGGCTCTGGG + Intergenic
1071492862 10:86147905-86147927 GAGTAAGCCCAGTGGGCTCTGGG - Intronic
1073461207 10:103666979-103667001 GAGGCAGCTCAGAGCCCCCTGGG + Intronic
1073510790 10:104041211-104041233 AAGCCAGCCCAGAGGGCCCTGGG + Intronic
1075099549 10:119496457-119496479 GAGTCATTTCAGCAGGCTCTGGG - Intergenic
1076038431 10:127221505-127221527 CAGTCTGCTCAGGGAGCTCTGGG + Intronic
1078425635 11:11248590-11248612 GTGTCATCTCTGAGAGCTCTTGG - Intergenic
1079121568 11:17688746-17688768 GAGTCAGATCGGAAAGCTCTTGG - Intergenic
1080057973 11:27927077-27927099 GAGTCAGCACAGAAGGCAATAGG + Intergenic
1080875260 11:36269099-36269121 AAGTCAGCTCAGAGTAGTCTGGG - Intergenic
1082770670 11:57205259-57205281 CAGCCAGCTCAGAGCGCTCTAGG - Intergenic
1082983408 11:59144899-59144921 GAGTGAGCACACAGGGCGCTGGG + Exonic
1083236385 11:61353545-61353567 AAGTTAGCAGAGAGGGCTCTGGG + Intronic
1083733392 11:64665978-64666000 GTGTCAGGGCAGAGGGTTCTGGG - Intronic
1084462114 11:69301970-69301992 CAGTGAGGTCAGAGGGCTCCCGG - Intronic
1084537146 11:69763976-69763998 GAGGCGGCTCAGAGGGCTCCAGG - Intergenic
1084550749 11:69840413-69840435 GAGTCAGCCTGGAGGGGTCTGGG - Intergenic
1084557481 11:69883619-69883641 GAGCCAGCTCAGAGGGCACACGG + Intergenic
1084981254 11:72829961-72829983 GAGGCAGCCCAGAGGGGTCCCGG + Intronic
1088082814 11:105940019-105940041 CTGTCAGCTAAGAGGGCCCTGGG - Intronic
1088449347 11:109965302-109965324 GAATCAGAGCAGAGGCCTCTAGG + Intergenic
1088849118 11:113690816-113690838 GAGTCAGCTCCCTGGGCCCTCGG - Intronic
1089007581 11:115105389-115105411 GATTCAGCCCAGGGGGCTCAAGG + Intergenic
1089334476 11:117713575-117713597 AAATCAGCTCAAATGGCTCTGGG - Intronic
1089659559 11:119977246-119977268 GAGTGCGCTCAGAGCACTCTGGG + Intergenic
1090873115 11:130765449-130765471 GGGTCAGCAGAGATGGCTCTAGG - Intergenic
1091461332 12:645714-645736 GAGTCAGCTGTGAGGGCTGATGG + Intronic
1091626305 12:2123468-2123490 AAGTGACCTCAGAGGGTTCTAGG + Intronic
1091982475 12:4877523-4877545 GAATAATTTCAGAGGGCTCTGGG - Intergenic
1092161344 12:6317063-6317085 GAGGGAGCTCAGAGAGCTCTGGG + Intronic
1092616194 12:10218119-10218141 CAGTAAGGTCAGAGGGCACTAGG - Exonic
1094759766 12:33517806-33517828 TACCCACCTCAGAGGGCTCTTGG - Intergenic
1096099634 12:48961975-48961997 GAGTCACCACACTGGGCTCTAGG - Intergenic
1096431061 12:51543356-51543378 GAGTCACCCCAGAAGGCGCTTGG - Intergenic
1096600483 12:52725169-52725191 GACTCAGCTCAGAGGTCACCTGG - Intergenic
1097688818 12:62715158-62715180 GAGACATCTCAGAGGGCTGCGGG + Intronic
1099940698 12:89184425-89184447 GAGTCAGATCAGTTGGCCCTAGG - Intergenic
1102207435 12:111099940-111099962 GCGTCAGCTCAGAGTCCTGTGGG + Intronic
1102546957 12:113664289-113664311 GGGTAAGGTCAGAGGGCTCCGGG - Intergenic
1103281048 12:119758156-119758178 GATTCAGCTCAAAGTGCTCCTGG + Intronic
1106346666 13:28886130-28886152 GAGTGAGGTCAGAGGGATGTAGG + Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1108139348 13:47402405-47402427 GGATCAGCACAGAGGGCTCAAGG - Intergenic
1111738039 13:92166593-92166615 GAGTCACCTCACAGTTCTCTTGG - Intronic
1111847364 13:93528301-93528323 GAGTAAGCAAAGAGGGCTGTGGG + Intronic
1112249937 13:97770343-97770365 GAATCACCACAGAGGCCTCTAGG - Intergenic
1113062159 13:106334080-106334102 GAGTCAGCTCATAGATCTCCTGG - Intergenic
1113104633 13:106759125-106759147 CACTCAGCTCAGAGCCCTCTGGG + Intergenic
1113104707 13:106759529-106759551 CACTCAGCTCAGAGGCCTCATGG + Intergenic
1113584876 13:111458309-111458331 GAGTGATTTCAGTGGGCTCTGGG - Intergenic
1113792523 13:113036675-113036697 GCGCGAGCTCAGAGGGCTCCTGG - Intronic
1115320983 14:32078048-32078070 CAGTCAGCCCATAGGACTCTGGG - Intronic
1119720304 14:76885492-76885514 CACCCAGCCCAGAGGGCTCTGGG - Intergenic
1120344610 14:83270130-83270152 GGGTAAGGTGAGAGGGCTCTGGG + Intergenic
1120788721 14:88559947-88559969 GTGCCAGCTAAGAGGGCTCTGGG - Intergenic
1121325107 14:93015294-93015316 GAGTCTGCACTGAGGGCTGTGGG + Intronic
1121542951 14:94742083-94742105 GAGTCATCCCAGAGAGTTCTTGG - Intergenic
1121890849 14:97589030-97589052 GCCTCAGCTCAAAGGGCTCCAGG - Intergenic
1123003148 14:105307349-105307371 GGGTCATTTCAGTGGGCTCTGGG - Exonic
1123923716 15:25088756-25088778 GAGGAAACTCAGAGTGCTCTGGG - Intergenic
1126731388 15:51686758-51686780 TACTCAGCTCAAAGGGCTCATGG + Intronic
1128310625 15:66629935-66629957 CAGTCAGCCCAGAGGGATGTGGG + Intronic
1128600373 15:68990717-68990739 AAGTAATTTCAGAGGGCTCTGGG - Intronic
1128809386 15:70559676-70559698 AAGGCAGCTCAGATGTCTCTTGG + Intergenic
1129116107 15:73366316-73366338 GAGTTTGCAAAGAGGGCTCTGGG + Intronic
1130021236 15:80233608-80233630 AAGTGAGCTCAGAGGGCTGGGGG + Intergenic
1130282743 15:82532212-82532234 GGGTCCTCTCAGAGGGTTCTGGG - Intergenic
1131263716 15:90903350-90903372 GAGTCTGCTCCGCGGGCCCTGGG - Exonic
1132282451 15:100632057-100632079 GGGGCAGCTCTGAGGGCTCAGGG - Intronic
1132835543 16:1951101-1951123 GAACCAGCTCAGAGGCCTCCGGG - Intronic
1136994694 16:35181665-35181687 GAGCCAGCTCCCAGGGCTCTGGG + Intergenic
1137674584 16:50298014-50298036 GATGAACCTCAGAGGGCTCTCGG + Intronic
1138441956 16:57040677-57040699 GAGGCAGCTCAGAGGGCATCTGG - Exonic
1138656837 16:58496268-58496290 GCTGCAGCTCAGAGGGCTCAGGG - Intronic
1138854178 16:60667894-60667916 GGGTAAGTTCAAAGGGCTCTAGG - Intergenic
1140867478 16:79076528-79076550 GAGTTAGCTTAGATGGTTCTAGG - Intronic
1140876518 16:79157864-79157886 GAGTAAGTTCAGCAGGCTCTGGG + Intronic
1140913006 16:79470368-79470390 GGCTCAGCTCAGAGGGCCCAGGG + Intergenic
1142803446 17:2359374-2359396 GACTCAGCTCTGTGGGCTCCCGG - Intronic
1142997498 17:3769458-3769480 GAGGCAGCTCAGAGGGCCCCAGG - Intronic
1144751815 17:17653970-17653992 GCGTCAGTTCAAAGGGCTCTGGG - Intergenic
1145756660 17:27396782-27396804 AAGTCAGATAAGAGGGCTGTGGG + Intergenic
1146396126 17:32468747-32468769 GAGTAAGCTCATAGGACTGTTGG + Intronic
1146913420 17:36662831-36662853 GAGTCTGCTCTTTGGGCTCTTGG + Intergenic
1151222678 17:72624727-72624749 AAGTCAGCTCAGATGCTTCTAGG + Intergenic
1151669868 17:75566120-75566142 GACTGAGCTGGGAGGGCTCTTGG + Intronic
1152231221 17:79115051-79115073 GAGGCAGCTCGGAGGGCCCTGGG + Intronic
1152554442 17:81045961-81045983 GAGACCCCGCAGAGGGCTCTGGG - Intronic
1152586147 17:81190349-81190371 GAGTCAGCTCCCGGGGCCCTGGG - Intronic
1153666281 18:7370009-7370031 CAGGAAGGTCAGAGGGCTCTGGG + Intergenic
1154136816 18:11786927-11786949 GAGTGAGCTAAGAGGGCTATTGG + Intronic
1155354451 18:24937815-24937837 GAGTCAGCTGACAGGGCTTTTGG - Intergenic
1155645589 18:28073572-28073594 TAGTAAGCTAAGAGGGCTCAAGG - Intronic
1157518061 18:48325005-48325027 GAGTCAGTTCCCAGGGCTGTGGG + Intronic
1157596965 18:48869892-48869914 GAGGCAGCTCCCAGGGTTCTGGG - Intergenic
1158551141 18:58437329-58437351 GGGCCAGCCCAGAGGGCACTGGG - Intergenic
1160078989 18:75704709-75704731 GAGACAGCACAGAGGCGTCTAGG - Intergenic
1161642364 19:5432294-5432316 GGGTCAGATCAGGGGGCGCTGGG + Intergenic
1163450924 19:17377054-17377076 CAGTCAGCTCCTAGGGCTCACGG - Exonic
1165044009 19:33090027-33090049 GCCTCAGCTCACAGGGCCCTTGG + Intronic
1165322693 19:35096074-35096096 GAGTCAGATCAGGGGCCTCCTGG - Intergenic
1165819386 19:38665028-38665050 GAGGCAGCTCAGATGTCACTGGG + Intronic
1166733400 19:45071022-45071044 GAGCCAGCTGGGAGGGCGCTTGG + Intergenic
1167263214 19:48470348-48470370 GAGTCAGGTCTGGGGGTTCTAGG - Exonic
1168469911 19:56631292-56631314 GAGAGAGCACAGAGGCCTCTTGG - Intergenic
925315718 2:2921603-2921625 GACTCAGCTCCCAGGTCTCTTGG - Intergenic
925370328 2:3340251-3340273 GGTTCAGCTCACATGGCTCTGGG - Intronic
927379556 2:22463170-22463192 GAGTCAGTCCAGAGTGCTTTAGG + Intergenic
927493941 2:23540002-23540024 GAGTCAACTCACAGGGCTGGTGG - Intronic
928193216 2:29193397-29193419 CAGTCAGCGAAGAGGGCTCTAGG + Exonic
929607633 2:43245597-43245619 GAGTAAGCTCAGAGGGTTGAGGG - Intronic
929666757 2:43839294-43839316 AAGTGACCTCAGAGGCCTCTGGG - Intronic
929822433 2:45284211-45284233 GAGTAAGCTCTGAGGGCCATGGG + Intergenic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
932068345 2:68590402-68590424 GAGTCAGCTCAGAGCTGTGTAGG + Intronic
932752773 2:74382042-74382064 TAGAAAGCACAGAGGGCTCTGGG - Intronic
935019471 2:99215922-99215944 GAATAAGTTCAGTGGGCTCTGGG - Intronic
935593456 2:104862272-104862294 AAGTGACCTCAGAGGGGTCTGGG + Intergenic
935817451 2:106859996-106860018 GAGTCAGCTCACACAGCTCCTGG + Intronic
938150427 2:128877738-128877760 GAGTCAGCACAGAGAGCTCGGGG + Intergenic
938400381 2:130986496-130986518 AAAGCAGCTCAGAGGGCGCTGGG + Intronic
938713940 2:134001558-134001580 GAGTCACCTGAGCTGGCTCTTGG + Intergenic
942501593 2:176596552-176596574 GAGTCAGCTCAAGGGATTCTTGG + Intergenic
944210132 2:197198416-197198438 TAGTCTGCACAAAGGGCTCTGGG + Intronic
945990106 2:216388899-216388921 GAGTCAGCCCAGAGAGTTCCTGG + Intergenic
946226534 2:218266806-218266828 GAGTCAGCTCTGTGGGGCCTTGG - Intronic
948525548 2:238568669-238568691 GGCAGAGCTCAGAGGGCTCTCGG - Intergenic
1168790504 20:572854-572876 GAGACAGCAGAGAGGGCTGTGGG + Intergenic
1170636112 20:18106076-18106098 GAGTAATTTCAGTGGGCTCTAGG + Intergenic
1170819567 20:19744904-19744926 GAGTAATTTCAGTGGGCTCTGGG + Intergenic
1170980821 20:21211141-21211163 GAGTCAGCTTAGATGATTCTTGG + Intronic
1172182784 20:33013813-33013835 GCGTCAGCTCCAGGGGCTCTGGG - Exonic
1172941602 20:38658189-38658211 GAGTGAGTTCAGAGGACACTGGG - Intergenic
1172973174 20:38888237-38888259 GAGGAGGCTCAGAGGGCTCAGGG + Intronic
1174078006 20:47951593-47951615 GAGTCACTTCAGCAGGCTCTGGG + Intergenic
1174262976 20:49310720-49310742 GATTCAGTTCTGAGGGTTCTTGG + Intergenic
1175458260 20:59131396-59131418 GTGTCAGCTCAGGGGGTCCTTGG + Intergenic
1179637801 21:42724595-42724617 GACTCAGCACAGTGGGCTCACGG - Intronic
1180762898 22:18222826-18222848 GAGACAGCTGCGAGGGCTCCAGG + Intergenic
1180772747 22:18401721-18401743 GAGACAGCTGCGAGGGCTCCAGG - Intergenic
1180804127 22:18651337-18651359 GAGACAGCTGCGAGGGCTCCAGG - Intergenic
1180806648 22:18718140-18718162 GAGACAGCTGCGAGGGCTCCAGG + Intergenic
1181217593 22:21343922-21343944 GAGACAGCTGCGAGGGCTCCAGG + Intergenic
1182132044 22:27861536-27861558 GGGTCAGCTCAGAAGTATCTTGG - Intronic
1182485152 22:30635031-30635053 GAGTCAGCTTCGAGTGCTCAGGG + Intergenic
1182582976 22:31326344-31326366 GGCTGAGCTCAGGGGGCTCTTGG + Exonic
1182685143 22:32116619-32116641 GAATAATTTCAGAGGGCTCTGGG - Intergenic
1183406713 22:37633748-37633770 GAGTCACCAGAGAGGGCGCTGGG + Intergenic
1183662805 22:39231405-39231427 GAGCCACCTCAGAGGACTCATGG + Intronic
1183983878 22:41558586-41558608 GAAACAGCTCAGAGAGCTCGTGG - Intergenic
1184356116 22:43980601-43980623 GACTCTGCTCAGAAGGCTCCAGG - Intronic
1184727636 22:46355985-46356007 GGGTCAGCACACAGGGCACTGGG - Exonic
1184909096 22:47514094-47514116 GAGGCTGCCCAGGGGGCTCTGGG - Intergenic
1185120051 22:48960669-48960691 GAGACAGCTGAGTGGGCTCAAGG - Intergenic
1203234583 22_KI270731v1_random:142709-142731 GAGACAGCTGCGAGGGCTCCAGG - Intergenic
949872936 3:8605018-8605040 AAGTCAGCTAGGAGGGTTCTGGG - Intergenic
950190902 3:10975412-10975434 GAGACTGCACAAAGGGCTCTAGG + Intergenic
950255806 3:11504567-11504589 GATCCAGGCCAGAGGGCTCTAGG + Intronic
950553914 3:13684032-13684054 CAGTCACCTCAGGTGGCTCTCGG - Intergenic
950640866 3:14347195-14347217 GAGCCAGCTGAGAGTGCCCTAGG + Intergenic
951706812 3:25552024-25552046 GGGCCAGCTCAGTGGGCTATGGG - Intronic
953180438 3:40589756-40589778 CAGCATGCTCAGAGGGCTCTTGG - Intergenic
954247777 3:49345303-49345325 GATTCAGCTCAGAGACATCTTGG + Intergenic
958986170 3:100782069-100782091 GAGACAGAGTAGAGGGCTCTGGG - Intronic
960640361 3:119817252-119817274 GTGGCGGCTCAGAGGGCTCTGGG - Exonic
961479005 3:127167506-127167528 GAGTCATTTCAGCGGGCTCTGGG - Intergenic
961640749 3:128363499-128363521 CATTCAGCTCAGTGGGCCCTTGG + Intronic
962084957 3:132180921-132180943 AAGTTAGCACAGAGGGCTGTAGG + Intronic
962630611 3:137272060-137272082 AAGAGAGCTCAGACGGCTCTGGG - Intergenic
963498981 3:146101008-146101030 GAGTTAGAACAGAGGGCTTTTGG + Intronic
964824639 3:160811760-160811782 GAGTCTACTCTGAGGACTCTGGG - Intronic
965298366 3:166977641-166977663 GGCACAGCTCAAAGGGCTCTAGG + Intergenic
967092761 3:186149367-186149389 CAGGCAGCTCTGGGGGCTCTTGG + Exonic
968628350 4:1637940-1637962 GGGTCACCCCAGAGGGCCCTGGG + Intronic
968652015 4:1763886-1763908 GAGGCTGCCCAGAGGGCTCTGGG - Intergenic
968721878 4:2212834-2212856 AAGTTAGTTCAGAGTGCTCTGGG - Intronic
968951625 4:3697886-3697908 GAGTGACCTCAGAGGGTTCTTGG + Intergenic
970410778 4:15806187-15806209 GAGTCAGATAAGAGGGCACGGGG - Intronic
970601502 4:17643950-17643972 AAGACAGCTCAGCTGGCTCTAGG - Intronic
973301770 4:48593304-48593326 TAGTCAGCTCAGCTGGCTCCTGG - Intronic
973330947 4:48909819-48909841 GAGTCACTCCAGAGGGCCCTGGG - Intergenic
975684016 4:76901985-76902007 AAGTCAGCTCAGAGGGTTAGTGG + Intergenic
976521533 4:86033361-86033383 CCAACAGCTCAGAGGGCTCTGGG - Intronic
985173461 4:187176631-187176653 GAGTCAGGACAGAGGGGTCATGG + Intergenic
985544895 5:504603-504625 GGGTGAGCCCAGAGGGCTCGGGG + Intronic
986849118 5:11790360-11790382 CAGTCAACTCAGAGGGCTCCAGG - Intronic
997776986 5:136618471-136618493 TGGTCACCTCAGAGGGCTGTTGG - Intergenic
1002027820 5:176407288-176407310 GATCCAGCTCAGAGTGTTCTAGG + Intronic
1002183443 5:177443022-177443044 GAGTCAGCCCTGGGGGCTCCTGG - Intergenic
1002703292 5:181142456-181142478 CAGTCAGATCAGAGGGCTGAGGG - Intergenic
1003290933 6:4777078-4777100 GACTGAGCTCAAAGTGCTCTTGG + Intronic
1004005657 6:11635100-11635122 GAGTCAGCACAGATGGCTACAGG - Intergenic
1006591623 6:35162184-35162206 GGGTCATCTCAGAGGGAGCTTGG + Intergenic
1007263545 6:40580624-40580646 GAATGAGGTCAGAGGGCTATAGG + Intronic
1007628181 6:43258315-43258337 GACTCAGCTGAGAGTGCTTTGGG - Intronic
1010760760 6:79719776-79719798 GAGTCAGCACAGAGGGCAGTGGG - Intergenic
1013416622 6:109931408-109931430 GAGAGATCTCAGAGGGCTCTTGG + Intergenic
1013533695 6:111043501-111043523 GTTTCAGCTTAGAGGGCTTTGGG + Intergenic
1016144283 6:140649336-140649358 GAATCAGAGCAGAGGCCTCTAGG + Intergenic
1018103187 6:160459246-160459268 GTGCCAGCTCAGAGGGCTCTGGG - Intergenic
1018111156 6:160538045-160538067 GTGCCAGCTCAGAGGGCTCTGGG - Intronic
1018132070 6:160741205-160741227 GTGCCAGTTCAGAGGGCTCTGGG + Intronic
1019496903 7:1345036-1345058 GAGGGGGCTCAGATGGCTCTGGG + Intergenic
1020710341 7:11597559-11597581 GAATCACATCAGAGGCCTCTAGG + Intronic
1024229448 7:47353127-47353149 CTGCCAGCTCAGAGAGCTCTTGG + Intronic
1025028214 7:55535371-55535393 CAGTGAGCTCAGAGGGCACTGGG + Intronic
1029598035 7:101548103-101548125 GAGTAAGCTCAGAGGGTACCTGG + Intronic
1031870033 7:127081319-127081341 TAGTCAGGTAAAAGGGCTCTAGG - Intronic
1031974589 7:128085660-128085682 GAGACAGCCCTGAGGACTCTGGG - Intronic
1031998405 7:128247870-128247892 GAGTCAGAGCACAGGGCCCTAGG - Intronic
1034188956 7:149198996-149199018 CAGACAACTCAGAGGGGTCTAGG - Intronic
1034531216 7:151697399-151697421 GAGCCTCCTCAGAGGGCTCCCGG - Intronic
1035239474 7:157520442-157520464 GATTCAGCTCAGGGGACTCGGGG - Intergenic
1037487368 8:19360702-19360724 GATTCAGCTGAGATTGCTCTGGG + Intronic
1037831788 8:22194201-22194223 GAGTCAGATAGGAGGTCTCTGGG + Intronic
1040060569 8:43100045-43100067 GAGTCATCTGAGAGGGCACAGGG + Intronic
1040896792 8:52376345-52376367 GAGCCAGCACAGAGGCCTCGTGG - Intronic
1042374073 8:68028688-68028710 GAGTCAAGTCAGAGGTCTGTAGG - Intronic
1046794093 8:118351700-118351722 GAGAGAGTTCTGAGGGCTCTGGG + Intronic
1047753381 8:127899432-127899454 GAGTCAGCTCAGGCAGTTCTTGG + Intergenic
1048338689 8:133522536-133522558 GAGTCAGATCAGAAGGCTTAAGG - Intronic
1048565658 8:135593968-135593990 GAGTCTGCGCAGAGTCCTCTTGG - Intronic
1056232927 9:84565331-84565353 GAGTCCGCTCAGGGGGCTGCTGG + Intergenic
1056675735 9:88675445-88675467 TTGTCTGCTCAGATGGCTCTGGG - Intergenic
1056681764 9:88725389-88725411 GAATCATTTCAGTGGGCTCTGGG + Intergenic
1057184401 9:93048818-93048840 GAATCATTTCAGTGGGCTCTGGG + Intergenic
1057301901 9:93891419-93891441 GAATCATTTCAGTGGGCTCTAGG + Intergenic
1058879673 9:109275448-109275470 GAGTCTGCTGAGATGGCTTTTGG - Intronic
1059796399 9:117701820-117701842 GAATAACCTCAGTGGGCTCTGGG + Intergenic
1060172059 9:121469889-121469911 GAGTAATTTCAGAGGGCTTTAGG - Intergenic
1060473941 9:123971161-123971183 GACTGAGCCGAGAGGGCTCTGGG - Intergenic
1061264955 9:129499505-129499527 GAGTCAGCTCAGAGCCATTTGGG - Intergenic
1061868972 9:133510070-133510092 GGGACAGCTCTGAGGACTCTTGG - Intergenic
1062057243 9:134475018-134475040 GAGCCTTCTCAGAGGGCTCGAGG + Intergenic
1062701321 9:137905906-137905928 GAGGCAGCCCAGAGGGCACAAGG - Intronic
1191769505 X:64740167-64740189 GAGTCACCACGGAGGGTTCTAGG - Intergenic
1194017185 X:88637554-88637576 GAGTCATCTGAGGGGTCTCTTGG - Intergenic
1195248111 X:103015181-103015203 GAGGCTGCTCAGAGTCCTCTAGG - Intergenic
1196776262 X:119340715-119340737 GAGTAAGCACAAAGTGCTCTGGG + Intergenic
1197867678 X:131036188-131036210 GAGTCAGCTCAGAGAGAGGTAGG - Intergenic
1199024372 X:142919649-142919671 GAGTCACAGCAGAGGCCTCTAGG + Intergenic
1199615428 X:149651828-149651850 GAGTCCTCTCTCAGGGCTCTAGG + Intergenic
1199870606 X:151894969-151894991 GAGCCAGCTCTGAGGGCACTTGG - Intergenic
1200138134 X:153884887-153884909 GAGTCAGCAGAGATGGCACTGGG + Intronic