ID: 902896718

View in Genome Browser
Species Human (GRCh38)
Location 1:19484954-19484976
Sequence ATGGAGAAGGCAAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1302
Summary {0: 1, 1: 0, 2: 8, 3: 126, 4: 1167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902896709_902896718 -10 Left 902896709 1:19484941-19484963 CCAGCCTGAGGCCATGGAGAAGG 0: 1
1: 1
2: 2
3: 33
4: 340
Right 902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG 0: 1
1: 0
2: 8
3: 126
4: 1167
902896701_902896718 22 Left 902896701 1:19484909-19484931 CCTAGGCCGCTGCAGAAGGGGCT 0: 1
1: 0
2: 3
3: 24
4: 223
Right 902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG 0: 1
1: 0
2: 8
3: 126
4: 1167
902896702_902896718 16 Left 902896702 1:19484915-19484937 CCGCTGCAGAAGGGGCTGACCGG 0: 1
1: 0
2: 0
3: 14
4: 118
Right 902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG 0: 1
1: 0
2: 8
3: 126
4: 1167
902896707_902896718 -3 Left 902896707 1:19484934-19484956 CCGGGGTCCAGCCTGAGGCCATG 0: 1
1: 0
2: 3
3: 31
4: 325
Right 902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG 0: 1
1: 0
2: 8
3: 126
4: 1167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902896718 Original CRISPR ATGGAGAAGGCAAAGGGGGA GGG Intronic
900031197 1:374121-374143 AGGGAGAAAGGAGAGGGGGATGG - Intergenic
900031205 1:374146-374168 ATGAAGAAAGGAGAGGGGGATGG - Intergenic
900051751 1:602321-602343 AGGGAGAAAGGAGAGGGGGATGG - Intergenic
900051759 1:602346-602368 ATGAAGAAAGGAGAGGGGGATGG - Intergenic
900393755 1:2444764-2444786 AGGGAGAAGGCCATGGGGGAAGG - Intronic
900877109 1:5350635-5350657 AAGGAGAAGGTGGAGGGGGAGGG + Intergenic
901136283 1:6998580-6998602 ATGGAGAAGGCAAAGTGCATGGG - Intronic
901228367 1:7628163-7628185 ATGGAGAAGGAGAAGGGAGCTGG - Intronic
901395906 1:8981409-8981431 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
901816060 1:11794221-11794243 GTGGACATGGCAAAGGGAGAAGG - Intronic
902216144 1:14935683-14935705 AGGGAGAAGGGGAAGGGAGAGGG - Intronic
902709962 1:18232110-18232132 GTGGAGAAAGCAGAGGGGGATGG - Intronic
902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG + Intronic
903324961 1:22564183-22564205 GGGCAGAAGGCAAAGGGGGTGGG + Intronic
904289386 1:29474465-29474487 ATGGGGAAGGCACACGGGGGCGG - Intergenic
904352430 1:29917378-29917400 AAGGAGAAGGGAAAGGGAGAAGG - Intergenic
904701886 1:32362612-32362634 AAGGAGCAGGCCAAGGGCGATGG + Exonic
904902209 1:33866369-33866391 ATGCAGAAAGTAATGGGGGAGGG + Intronic
905094091 1:35454199-35454221 ATGAAGAAAGCACAAGGGGAAGG + Intronic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906477933 1:46182333-46182355 ATGGAGAAGGAGCAGTGGGAGGG + Intronic
906500882 1:46341258-46341280 ATGGGCAAGGGAAAGGGGGAGGG - Intronic
906587748 1:46994606-46994628 GTGGGGAAGGTAAAGTGGGAAGG + Intergenic
906588541 1:47001918-47001940 ATGCAGAAGGCAGAGGTGGAGGG - Intergenic
907133264 1:52116356-52116378 GTGGAGAAAGGAAAGGGGAATGG - Intergenic
907381192 1:54091711-54091733 AGGGAGAAAGTAAAGGGGAATGG - Intronic
907621285 1:55983443-55983465 AAGGACAAGGCGAAGGGGAAGGG + Intergenic
907703540 1:56813319-56813341 TGGTAGAAGGCAAAGGAGGAAGG + Intronic
907904066 1:58768213-58768235 ATGGAGATGGAAAGGAGGGAAGG - Intergenic
907963629 1:59307827-59307849 AGGGAGAAGGGAAAGGGAGCTGG - Intronic
909503221 1:76358598-76358620 GTGGAGGAGGCAAATGTGGATGG - Intronic
909583828 1:77266903-77266925 ATGAAGAAGGCAGAGAAGGATGG + Intergenic
910163294 1:84297551-84297573 AAGGAGAAGGAAAAGGCAGATGG - Intergenic
910211693 1:84800251-84800273 ATGGAGCAGAGGAAGGGGGAAGG + Intergenic
910601753 1:89040172-89040194 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
910666808 1:89734467-89734489 ATGCAGAAGGAAGAGAGGGAGGG + Intronic
911058561 1:93728579-93728601 ATGGGGAAGCCAAAAAGGGATGG + Intronic
911244415 1:95501030-95501052 ATGGAGAGGGTAAAGGAGAAAGG - Intergenic
911517618 1:98886633-98886655 AGGTAGAAGGCACAGGGAGAAGG + Intergenic
911542614 1:99176144-99176166 AGGAAGATGGAAAAGGGGGATGG + Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912672143 1:111640145-111640167 AAGAAGTAGGCAAAGGTGGAGGG - Intronic
912913742 1:113790170-113790192 ATGGAGAAGGGAAAGGTTGGAGG + Intronic
913260791 1:116996271-116996293 ATGGAGGAGGCAAAGAAGCATGG - Intergenic
913305403 1:117425109-117425131 GAGGAGAAGGGAAAGGGGGAAGG + Intronic
913368278 1:118067451-118067473 ATGGAGAAGGGAAAGAGGGAGGG - Intronic
914350781 1:146838023-146838045 ATGGACCAGGCAATGGGGAATGG - Intergenic
914811308 1:151030397-151030419 AAGGCAAAGGCAAAGGGGGGCGG - Intronic
914914043 1:151807384-151807406 ATGGGAAAGGAAAAGGGTGAGGG + Exonic
914923516 1:151863932-151863954 CTGGAGAAGGCAGAGGAGGAAGG - Intergenic
914925509 1:151882999-151883021 AAGGTGAAGGGAAAGGGGAAGGG + Intronic
915307681 1:154990034-154990056 AAGGACAAGGAAAAGGGAGAAGG + Intronic
915357771 1:155266453-155266475 AGGGAGAAAGGAAAAGGGGAGGG + Intronic
915365266 1:155311595-155311617 ATGGGGAAGGAAACTGGGGAGGG + Intronic
915393123 1:155562313-155562335 GAGGAGAAGGGAAAGGTGGAAGG + Exonic
915409278 1:155688219-155688241 GAGGAGAAGGGAAAGGTGGAGGG + Exonic
915571787 1:156748877-156748899 AAAGAGAAGGTACAGGGGGAAGG + Intronic
915737515 1:158094385-158094407 ATGAAGGTGGGAAAGGGGGAAGG + Exonic
916273305 1:162967352-162967374 TTGGAGAAAGCAGAGAGGGAAGG + Intergenic
916470518 1:165118447-165118469 GAGGAGAAAGCAAAGGGGAAGGG + Intergenic
917216246 1:172681055-172681077 GCAGAGAAGGCAATGGGGGATGG - Intergenic
917499288 1:175571547-175571569 ATGGAGTAGGCAAAATGGAAGGG - Intronic
918110333 1:181450119-181450141 AGAGAGAGAGCAAAGGGGGAAGG + Intronic
918319272 1:183349424-183349446 ATGCTGAAGGCAAAGGAAGAGGG + Intronic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
919016767 1:192048510-192048532 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919016770 1:192048516-192048538 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
919016798 1:192048676-192048698 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
920330234 1:205202083-205202105 AGGGAGAAGGGGAAGGGAGAGGG + Intronic
920330237 1:205202089-205202111 AAGGGGAAGGGAGAGGGGGAAGG + Intronic
920496814 1:206460862-206460884 AGGAAGTAGGGAAAGGGGGACGG - Intronic
920541478 1:206781693-206781715 AGGGAGAAGGGAAAGGGAGTGGG + Intergenic
920579799 1:207095896-207095918 TGGCAGAAGGCAAAGGGGGAGGG - Intronic
920634486 1:207686191-207686213 AAGGAGAAGGAAAGGAGGGAAGG - Intronic
921308605 1:213821190-213821212 ATGGAAAAGGCACAGGGAGCAGG - Intergenic
921320551 1:213934347-213934369 CTGGAAACGGAAAAGGGGGATGG + Intergenic
921887521 1:220321621-220321643 ATGGAGGAGGAAGAGGAGGAAGG + Intergenic
921942159 1:220853518-220853540 ATGGGAAAGGGAAAGGAGGAAGG - Intergenic
922033308 1:221825124-221825146 TTGGAGAAGGCACAGGTGCAAGG + Intergenic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922722749 1:227906876-227906898 AAGCAGAAGGGAAAGGGAGAGGG - Intergenic
922883069 1:228997163-228997185 ATGGGGTAGGGAAAGGGGAATGG + Intergenic
922975391 1:229779624-229779646 ATGGTGGAGCCAAAGGTGGAAGG - Intergenic
923072431 1:230577877-230577899 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
923210483 1:231799824-231799846 AAAGAGAAGGGAAAGAGGGAGGG - Intronic
923235776 1:232031428-232031450 AAGGAGAAGGGAAAAGGGAAAGG + Intronic
923378672 1:233392642-233392664 AAGGAAAAGGAAAAGGGGAAGGG - Intergenic
923486693 1:234439332-234439354 ATAGACAGGGGAAAGGGGGAAGG + Intronic
923589043 1:235302215-235302237 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
923739754 1:236644526-236644548 ATGGAGAGGGCAAAGGTAGGAGG - Intergenic
924004058 1:239587426-239587448 CAGGGGAAGGCAAAGCGGGAGGG - Intronic
924062030 1:240185029-240185051 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062045 1:240185086-240185108 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062053 1:240185115-240185137 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924184695 1:241475906-241475928 GTGGAGAAAGTAAAGGGAGATGG - Intergenic
924481176 1:244435656-244435678 ATGGAGGAGGAAGAGGAGGATGG - Intronic
924929380 1:248714166-248714188 CTGCATATGGCAAAGGGGGAAGG - Intergenic
1062767175 10:74702-74724 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1062818514 10:517183-517205 ATGGAGAAGGGAAAAGGAGAAGG - Intronic
1062863615 10:830301-830323 ATGGAGGGGGAAAAGGGGAACGG - Intronic
1062913932 10:1233150-1233172 ATGGAGAGGACAGAGGGGCAGGG + Intronic
1062966034 10:1608526-1608548 ATGGAGGAAGGAAAGTGGGAAGG + Intronic
1063075602 10:2713318-2713340 ATGGAGAATGCAATGGGCGGGGG + Intergenic
1063207576 10:3849122-3849144 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1063257005 10:4339563-4339585 ACGGAGGAGGGAAAGTGGGAGGG - Intergenic
1063511141 10:6646720-6646742 AGGGGGGAGGCAAAGAGGGAGGG - Intergenic
1063811279 10:9711252-9711274 ATGGACAGGGAAAAGGGGGATGG + Intergenic
1063866946 10:10374912-10374934 ATGGAGATGGAAAAGCAGGAAGG + Intergenic
1064628527 10:17285729-17285751 AGAGAGAAGGGAAAGGGGGAGGG + Intergenic
1064753497 10:18555140-18555162 ATGGAGAATGGAATGGAGGATGG + Intronic
1064754187 10:18559828-18559850 ATGGAGAAAGGAATGGGGAATGG + Intronic
1064755981 10:18572229-18572251 ATGGACAATGCAATGGGGAAGGG - Intronic
1064756085 10:18572814-18572836 ATGGAGAATGGAATGGAGGATGG - Intronic
1064797501 10:19029748-19029770 AAAGAGAACGGAAAGGGGGAAGG - Intergenic
1064810103 10:19187313-19187335 AAGGAAAGGGCAATGGGGGAAGG + Intronic
1064850290 10:19701777-19701799 AAGAAGGAGGAAAAGGGGGAGGG - Intronic
1065171588 10:23035684-23035706 GTTGACAAGGCAGAGGGGGAAGG - Intronic
1065203078 10:23331698-23331720 AGGGGGAAGGGAAAAGGGGAAGG + Intronic
1065334572 10:24643465-24643487 ATGGAGAAGGCTAAAGGGAATGG - Intronic
1066203993 10:33169670-33169692 GTGCAGAAGGAAAAAGGGGAAGG + Intergenic
1066334611 10:34463142-34463164 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1066686465 10:37986457-37986479 GAGAAGGAGGCAAAGGGGGAGGG - Intergenic
1067395299 10:45910497-45910519 ATGAAAAAGACAAAGGTGGAAGG - Intergenic
1067787514 10:49261274-49261296 ATGGAGAAGGAAAATTGGCAGGG - Intergenic
1067812937 10:49444445-49444467 CTGGAGGAGGCAAAAGGAGATGG + Intergenic
1067863621 10:49879621-49879643 ATGAAAAAGACAAAGGTGGAAGG - Intronic
1068656556 10:59581954-59581976 ATGGTGAGGGCAAGGGGAGAAGG + Intergenic
1068753110 10:60619165-60619187 ATGGGGAAGGAAAAGAGGGTAGG - Intronic
1068830661 10:61491198-61491220 AAGGAGAAGGGAAGGGAGGAAGG + Intergenic
1068852899 10:61764683-61764705 GTGGAGGAGGCAAGGAGGGATGG - Intronic
1069415473 10:68196785-68196807 GAGGAGGAGGCAAAGGGAGAGGG - Intronic
1069431974 10:68345260-68345282 ATGCAAGAGGCAAAGGGAGAGGG + Exonic
1069890855 10:71651768-71651790 ATGGAACAGGCAAGGGGGTATGG - Intronic
1070050103 10:72880463-72880485 ACGTAGAAGGCAAAGCGGGGGGG + Intronic
1070199140 10:74186249-74186271 AGGGAGAAGGGAAAGGGGAAAGG - Intronic
1070360144 10:75680355-75680377 AAGAAGAAGGAAAGGGGGGATGG + Intronic
1070412737 10:76158260-76158282 AAGAAGGAGGCAAAGGGGGTAGG - Intronic
1070531333 10:77339848-77339870 AGGTAGAAAGAAAAGGGGGAAGG - Intronic
1070721343 10:78759405-78759427 GGGGAGAAGGGAAAGGGGAAGGG + Intergenic
1070755356 10:78988709-78988731 ATGAAAAGAGCAAAGGGGGAGGG + Intergenic
1071309992 10:84334099-84334121 AGGGAGGAGGCAGAGGGGTAGGG + Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071418542 10:85464337-85464359 AAGGAGAAGGAAGAGTGGGAAGG + Intergenic
1071448051 10:85767618-85767640 AGGGAGATGGAAAAGGGGCAAGG + Intronic
1071689175 10:87797428-87797450 CTACAGATGGCAAAGGGGGAAGG - Intronic
1071849027 10:89549915-89549937 AGGGAGAAAGGAAAGAGGGAAGG - Intronic
1071897237 10:90080961-90080983 CTTCAGATGGCAAAGGGGGAAGG - Intergenic
1071952273 10:90717372-90717394 ATGAAGAAGGAAAAGGAGCATGG + Intergenic
1072475062 10:95751935-95751957 GGAGAGAAGGCAAAGGGTGAAGG + Intronic
1072782340 10:98259349-98259371 AGGGAGGAGGCAAAGGGGTGTGG - Intronic
1073056221 10:100704432-100704454 ATGGAGAGGGCAGAGGGGCCAGG - Intergenic
1073243455 10:102073243-102073265 ATGGAGAAGGGAAAGGGCCCTGG + Intergenic
1073314642 10:102570616-102570638 ATCGAGAAGAGGAAGGGGGAAGG - Intronic
1073476242 10:103755980-103756002 AGGGAGGAGGCAAATGTGGAGGG - Intronic
1073592120 10:104767605-104767627 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1073592123 10:104767611-104767633 AGGGGGAAGGAAAAGGGGAAGGG - Intronic
1073592141 10:104767654-104767676 GTGGAGAAGGGGAAGGGGAACGG - Intronic
1073823445 10:107291782-107291804 GTGGAGAGGGAAAAGTGGGAAGG - Intergenic
1074180743 10:111060371-111060393 ATAGAGAAGGAAAAGGGTGAGGG - Intergenic
1074400711 10:113139278-113139300 GTGGAGAAGGAAAAGGGAAAAGG - Intronic
1074460441 10:113631924-113631946 TGGGAGAAGACAAAGGGGAAAGG - Exonic
1074581816 10:114726423-114726445 TGGTATAAGGCAAAGGGGGAAGG + Intergenic
1074645963 10:115452835-115452857 AGGGAGAAAGAAAAGGGGAAGGG - Intronic
1074690864 10:116002992-116003014 ATGGATAAGGCAATAGGGGTTGG + Intergenic
1074967512 10:118504472-118504494 AGGAAGCAGGGAAAGGGGGAAGG + Intergenic
1075065590 10:119287119-119287141 ATGGAGAAGGCAGGGAGGGAAGG + Intronic
1075065674 10:119287410-119287432 AGGGAGAAGGTAAGGAGGGAGGG + Intronic
1075181961 10:120219508-120219530 AGGAAGAAGGGAAAGGGTGAGGG + Intergenic
1075284506 10:121171845-121171867 AGGGAGAAGGGGAAGGGGAAAGG + Intergenic
1075329646 10:121564216-121564238 AGGGAGAAGTCAAAGGGAAAAGG + Intronic
1075571262 10:123548006-123548028 TAGGAGATGACAAAGGGGGAGGG - Intergenic
1075585430 10:123653782-123653804 ATGGGGAAGGGGAAGGGAGAAGG + Intergenic
1075617697 10:123903546-123903568 CTGGAGATGGCAAAGGTGGCGGG - Intronic
1075918705 10:126191590-126191612 ATGGAGAAGACTAAGGTGGGGGG + Intronic
1076039497 10:127232040-127232062 ATGGAGAAGGCAGAAAAGGAGGG + Intronic
1076099073 10:127759367-127759389 AAGGAAGAGGCAAGGGGGGAAGG - Intergenic
1076182657 10:128422597-128422619 AAGAAGATGACAAAGGGGGATGG + Intergenic
1076257787 10:129042270-129042292 ATGGAGTAGGGAAGGGTGGATGG - Intergenic
1076304859 10:129458825-129458847 AGGGAGGAGGGAATGGGGGAAGG - Intergenic
1076666820 10:132097929-132097951 ATGGGAAAGGGAAAGGGGAAGGG - Intergenic
1076856020 10:133115987-133116009 ATGGGGAGGGAAAAGAGGGAGGG - Intronic
1077195734 11:1279072-1279094 ATGGGGAAGGGACAGGAGGAGGG + Intronic
1077249472 11:1554622-1554644 AGGGACAAGGGGAAGGGGGAAGG + Exonic
1077272310 11:1687004-1687026 AGGGAGGAGGCAAAGAAGGAGGG - Intergenic
1077372768 11:2191242-2191264 AGGGAGAAAGCAAAGGAGGAAGG + Intergenic
1077640621 11:3878188-3878210 GGGGAGAAGGGAAAGGAGGAGGG + Intronic
1077644559 11:3912098-3912120 AGGGAGAAGGGAAAGGAGAAGGG - Intronic
1077806591 11:5596547-5596569 ATGGGGGAGGGGAAGGGGGAAGG - Intronic
1077896829 11:6459158-6459180 ATGGTGCAGGCAGAGGGGGAAGG + Intronic
1078086072 11:8233671-8233693 ATGGGGAAGGCAGAGCAGGAGGG - Intronic
1078549824 11:12272337-12272359 ATGGAAGAGGCAGAAGGGGAGGG - Intergenic
1078587079 11:12601143-12601165 GGGGAGAAGGCAGAGGGGCAAGG - Intergenic
1078612937 11:12837701-12837723 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1079092276 11:17489406-17489428 ATGGACTAGGTAAAGGGGAAAGG - Intergenic
1079115052 11:17635292-17635314 ATGGGGTGGGCAAAGGGAGAAGG + Intronic
1079134646 11:17769503-17769525 AAGGAGAAAGGAAAGGAGGAAGG + Intronic
1079150712 11:17896677-17896699 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1079206155 11:18416723-18416745 ACGGAGAAGGGAAAGGGGGAAGG - Intronic
1079259733 11:18866905-18866927 ATGGAGAAGGAAGAGGGGAAGGG - Intergenic
1079759634 11:24312378-24312400 ATGGAGAAAACTAAAGGGGATGG - Intergenic
1080260945 11:30349332-30349354 AGGAAGAAAGCAAAGGAGGATGG - Intergenic
1080314840 11:30936975-30936997 TTGGGGAAGGCAACAGGGGAGGG - Intronic
1080384367 11:31802534-31802556 AAGGAGAGGGGAAAGTGGGAAGG + Intronic
1080397883 11:31906608-31906630 AAAGAGAAGGGAGAGGGGGAAGG + Intronic
1080405141 11:31972024-31972046 GGGGAGACGGGAAAGGGGGAGGG + Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080603219 11:33841337-33841359 AAGGAAAAGGGAAAGGAGGAGGG - Intergenic
1080708255 11:34720019-34720041 ATGGAGAAGAGCAAGAGGGAAGG + Intergenic
1081155472 11:39684415-39684437 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1081555526 11:44157447-44157469 AAGGAGAGGGAAAAGTGGGAAGG - Intronic
1081604262 11:44517564-44517586 ATGGAGGAGGGAGAGGAGGAAGG + Intergenic
1081625340 11:44652071-44652093 CGGGAGAGGGGAAAGGGGGATGG - Intergenic
1081864610 11:46352645-46352667 AAGGAGGAGGCAGAGGGGGCAGG - Intronic
1082061532 11:47865204-47865226 ATGGAGAAGGGAACAGGGTAAGG - Intergenic
1082132437 11:48506528-48506550 AGGGAGAAGGGAAGGGGGAAGGG - Intergenic
1082196797 11:49316251-49316273 AAGGAGAAGGGGAAGGGGTAAGG + Intergenic
1082735887 11:56855063-56855085 AGGGAGAAGGGAAAGGAGGGAGG + Intergenic
1082778904 11:57270994-57271016 ATGGACAAGGAACATGGGGAGGG - Intergenic
1082811540 11:57481983-57482005 AAGGAAAATGCAAAGGGGGAAGG + Intergenic
1083413896 11:62512902-62512924 AGGAAGAAGGCAAGGGAGGAAGG + Intronic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1083659041 11:64243719-64243741 ATGGAGAAGGGTAATGGAGATGG - Intronic
1084014304 11:66369573-66369595 AGGGGGAAGGCAGCGGGGGAAGG - Intronic
1084797918 11:71520463-71520485 CTGGAGAAGACAGAGTGGGATGG + Intronic
1085127048 11:74008924-74008946 AAGGAGAAGGGAGAGGGAGAGGG + Intronic
1085296932 11:75436615-75436637 ACGAACCAGGCAAAGGGGGATGG + Intronic
1085372247 11:76020055-76020077 AAGGAGAGGGAAAAGTGGGAAGG - Intronic
1085754213 11:79190814-79190836 AGGGAGAAGGGAGAGGGAGAGGG - Intronic
1085857166 11:80188334-80188356 CTGGAGAAGGAAAAGGGGCAGGG - Intergenic
1086311504 11:85540490-85540512 ATGGGGAGGCCAGAGGGGGATGG - Intronic
1086518678 11:87645883-87645905 AGGGAGAAGGGAAGGGGGAAAGG - Intergenic
1086595336 11:88564060-88564082 ATGGATAAGAAAAAGGGGCAGGG - Intronic
1086659027 11:89391934-89391956 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1086956266 11:92937246-92937268 TTGGAGAAAGCAAGGGAGGAGGG + Intergenic
1087611345 11:100437577-100437599 AAAGAGAAAGGAAAGGGGGAAGG + Intergenic
1088047613 11:105472788-105472810 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1088076725 11:105858638-105858660 AGGGAGGAGGGAAATGGGGATGG - Intronic
1088086796 11:105990761-105990783 ATGGAAAAGGCAAAGCAGGGTGG + Intergenic
1088297288 11:108313603-108313625 ATGAAGAAGGCAAAAGTGAAAGG - Intronic
1088462048 11:110092862-110092884 GAGGAGAAGGAAAAGAGGGAAGG + Intergenic
1088584944 11:111353920-111353942 AGGGAGAAGGGAAGGAGGGAAGG + Exonic
1088584963 11:111353977-111353999 AGGGAGAAGGGAAGGAGGGAAGG + Exonic
1088970998 11:114774710-114774732 ATGGGGAAGGAAAAAGGGAAAGG - Intergenic
1089050810 11:115544229-115544251 ATGCTGAAGGCAAAGGGAGTGGG - Intergenic
1089219919 11:116862174-116862196 TTGGAGAAAGCAAAGAGTGAGGG + Intronic
1089476934 11:118771611-118771633 AGGGAGAAGGCAAAGGAGGAAGG + Intronic
1089641145 11:119848021-119848043 AAGGGGAGGGCAGAGGGGGAGGG - Intergenic
1089744943 11:120610060-120610082 CAGGAGAAGGCAGATGGGGAGGG - Intronic
1089746996 11:120624440-120624462 AAGGAGGAGGCCAAAGGGGATGG - Intronic
1089868877 11:121655373-121655395 AGGAAGGAGGTAAAGGGGGAGGG - Intergenic
1090062706 11:123477646-123477668 AGAGAGAAGGGAAAGGGGAAGGG - Intergenic
1090077434 11:123588092-123588114 AGGCAGAAGGCAGAGTGGGACGG - Intronic
1090118585 11:124000749-124000771 AGGGGGAAGGAAAAGGGGAAAGG + Intergenic
1090143232 11:124289004-124289026 ATTCAGAAGGCTAAGGTGGAAGG - Intergenic
1090198680 11:124839092-124839114 AGGGAGAAGGAATAGGGGGCAGG - Intergenic
1090236550 11:125152450-125152472 ACAGAGAAGGCAAAGCTGGATGG + Intergenic
1090249572 11:125241989-125242011 ATGGTGAAGGTGGAGGGGGATGG + Intronic
1090748635 11:129727218-129727240 ATGGAGAAGGAATCGGAGGAAGG + Intergenic
1090799549 11:130161711-130161733 ATGAAAATGGCAGAGGGGGAAGG - Intronic
1091119311 11:133043446-133043468 ATGAAGAAGGCAGAAAGGGAAGG - Intronic
1091135642 11:133186537-133186559 ATGGAGAGGGGTAAGGGAGAAGG + Intronic
1091365456 11:135016177-135016199 ATGGAGAAGGCTGAGGGTGCTGG - Intergenic
1091365479 11:135016263-135016285 ATGGAGAAGGCTGAGGGTGCTGG - Intergenic
1091493564 12:952951-952973 AGGGGGAAGGGAAAAGGGGAAGG + Intronic
1091703302 12:2678013-2678035 TTGGAAAAGGCAAAGGGGTGAGG - Intronic
1092119749 12:6035582-6035604 ATGGCCAAGGAAAAGGGAGAAGG + Intronic
1092334292 12:7614991-7615013 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1093459228 12:19393277-19393299 AAGGGGAAGGGGAAGGGGGAAGG + Intergenic
1094382308 12:29856099-29856121 ATGGAGAGGGCGAAGGGGGGCGG + Intergenic
1094477377 12:30851713-30851735 GTGTACAAGGCAAAGGGGCAGGG - Intergenic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1095929111 12:47608012-47608034 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1096002278 12:48139933-48139955 AGGGAGAAGGAAAAGGGGAGAGG - Intronic
1096128596 12:49138897-49138919 AGGCAGAAAGCAAAGGGAGAGGG - Intergenic
1096665173 12:53159771-53159793 AGGGAGAGGGGAAAGGGGCAGGG - Intronic
1096711101 12:53456809-53456831 ATGCAGAAGGGAGAGAGGGAGGG - Intronic
1097161071 12:57047139-57047161 CTAGAGAAGGGAAAGGAGGAAGG + Intronic
1097176565 12:57146865-57146887 GTGGACAAGGAACAGGGGGAGGG - Intronic
1097225932 12:57476802-57476824 GTGGAGCAGGAAAAGGGGGGAGG + Intronic
1097285076 12:57870903-57870925 AGGGAGAAGGAAAGGGGGAAGGG - Intergenic
1097290826 12:57913653-57913675 ATGGGGAACTGAAAGGGGGATGG - Intergenic
1097908811 12:64947685-64947707 ATGGAGAAGGGAAAGGCTGAAGG - Intergenic
1098032516 12:66269022-66269044 ATGAAGAAGGTAGAGGGGGAAGG - Intergenic
1098425277 12:70357654-70357676 CTGGGGAAGGCAGAAGGGGATGG + Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099616432 12:84941522-84941544 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1099805122 12:87508659-87508681 ATTAAGAAGACAAAGGGGGCCGG - Intergenic
1100378870 12:94043337-94043359 ATGGTGAAGGCAGAGGAGCAAGG + Intergenic
1100436113 12:94573016-94573038 ATGGAGATGTCAAAGAGGCATGG - Intronic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100570928 12:95842360-95842382 AGGGAGACGGGAAAGGGAGAGGG + Intergenic
1100580908 12:95939627-95939649 ACAGAGAAGGCAGTGGGGGAAGG + Intronic
1100779397 12:98008009-98008031 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101569047 12:105936438-105936460 CTGGATAAAGCAAAGGTGGAAGG + Intergenic
1101746718 12:107547210-107547232 AAGGAGAAGGGGGAGGGGGAGGG + Intronic
1101861882 12:108489146-108489168 AAGGAGAAGGGAAAGAGGGAAGG + Intergenic
1101925699 12:108969658-108969680 AGGGAGAAGGGACAGAGGGAGGG - Intronic
1102166744 12:110812994-110813016 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1102166747 12:110813000-110813022 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1102223095 12:111208034-111208056 AAGGAGAAGGGGAAGTGGGAGGG + Intronic
1102232355 12:111272307-111272329 ATGGAGGAGGGAGAGGAGGAGGG - Intronic
1102258630 12:111430182-111430204 ATGGGGAAGGCGGAGGGGGTTGG + Intronic
1102517210 12:113457716-113457738 ATGGAGGAGGAAAGGGAGGAGGG + Intergenic
1102625633 12:114233259-114233281 AGGGAGAAGGGGAAGGGGAAGGG - Intergenic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1102753880 12:115320991-115321013 GTGGGGAAGGCAAAGGTGGGAGG + Intergenic
1103139115 12:118533454-118533476 ATGGAGAAGGGAAGGTGGAAAGG + Intergenic
1103371572 12:120423323-120423345 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1103371575 12:120423329-120423351 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1103592589 12:122002863-122002885 AAGGAGAGGGAAAAGGGGAATGG - Intronic
1104103089 12:125634151-125634173 AAGGCGAAGGAAGAGGGGGAAGG - Intronic
1104499293 12:129269371-129269393 AAGGAGAAGGCAAAGGGGAAGGG - Intronic
1104559651 12:129832257-129832279 AAGGAGAGGAAAAAGGGGGAGGG + Intronic
1104573298 12:129944334-129944356 ATGGAAAAGGCTAATCGGGAGGG - Intergenic
1104657203 12:130582126-130582148 ATGGAGACAGCAGAGGAGGAGGG - Intronic
1104855687 12:131901533-131901555 AATGAGAAAGCAGAGGGGGAGGG - Intronic
1104892498 12:132147335-132147357 CTGGAGAAGTCCAAGTGGGAAGG + Exonic
1106679966 13:31999463-31999485 AGGGAGACGGGAGAGGGGGAGGG - Intergenic
1106771511 13:32965278-32965300 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1106771514 13:32965284-32965306 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1106927277 13:34626192-34626214 AGGGAGAAGGGAAAGGAGGGAGG + Intergenic
1107158134 13:37193685-37193707 ATGGAAAAGGGCATGGGGGATGG + Intergenic
1107210923 13:37852885-37852907 AAGGAGAAGGAAGAGTGGGAAGG + Intronic
1107552152 13:41487325-41487347 ATGGAGAGGGAAGAGTGGGAAGG - Intergenic
1107761196 13:43681091-43681113 GAGGAGAAGGGAAAGGGGCAGGG - Intronic
1107795451 13:44046897-44046919 AAGGAGAAGGGGAAGGGGAAAGG - Intergenic
1107795460 13:44046921-44046943 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1107795463 13:44046927-44046949 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1107819910 13:44277181-44277203 AAGGGGAAGGGAAAGAGGGAGGG + Intergenic
1108304119 13:49113638-49113660 ATGAGGAATGTAAAGGGGGAAGG - Intronic
1108427621 13:50319657-50319679 GAGGAAAAGTCAAAGGGGGATGG + Intronic
1108589617 13:51901639-51901661 ATGGAGTGGGCACTGGGGGAGGG - Intergenic
1109181577 13:59220072-59220094 AGGGAGGAGGAAAAGGGGGAAGG + Intergenic
1109846620 13:68000665-68000687 ATGGTGAAAGTTAAGGGGGAAGG - Intergenic
1109881694 13:68486825-68486847 ATGGTGAAGGAAAATGGTGAAGG - Intergenic
1110515795 13:76411308-76411330 ATGGAAAAGGGAAAGGAGTAGGG + Intergenic
1110896187 13:80755283-80755305 AGGGAGGAGGGAAAGTGGGAAGG - Intergenic
1111084136 13:83351810-83351832 AGGGAGAAAGGAAGGGGGGAAGG + Intergenic
1111256330 13:85673987-85674009 GTGGAGAAGGGAGAGAGGGATGG + Intergenic
1111815766 13:93150451-93150473 CTAGAGAAGGCAAAGGGGCAGGG + Intergenic
1112015171 13:95325564-95325586 AGGGGAAAGGGAAAGGGGGAAGG + Intergenic
1112426943 13:99311262-99311284 GTAGAGAATGCAGAGGGGGAAGG + Intronic
1113086261 13:106572313-106572335 TTGGAGAAGGGAATGGAGGAAGG - Intergenic
1113175382 13:107557749-107557771 ATGGAGAATGCATATGGAGATGG - Intronic
1113441550 13:110333022-110333044 CTGGAGAGGGCAGAGGGTGAAGG + Intronic
1114179177 14:20350929-20350951 AGGGAGAAGGGAAAGGTGAAAGG - Intronic
1114460358 14:22882694-22882716 GTGGAGAAGGAAAAGGTGGCAGG + Intergenic
1115053064 14:29088720-29088742 GTGGAGAGGGGAAATGGGGATGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115529359 14:34312796-34312818 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1115529362 14:34312802-34312824 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
1116402567 14:44526578-44526600 ATGGAGAAAGCTAAGTGAGAGGG - Intergenic
1117409510 14:55438557-55438579 ATGGGGAAGGGGAAGGGGAAGGG - Intronic
1117422640 14:55562101-55562123 ATTGAGTAGGCTAAGGAGGAAGG + Intronic
1117487997 14:56217811-56217833 ATGGAGCAGGCAGAAGGGAAAGG - Intronic
1117730800 14:58719991-58720013 ATGGAGAAGGCAAAAATGGAAGG + Intergenic
1118333469 14:64832396-64832418 ACAGAGCAGGCAAAGGAGGAAGG - Intronic
1118451563 14:65907127-65907149 AGGGCGAAGGAAAAGAGGGAAGG + Intergenic
1119235407 14:73015320-73015342 AGGGGGAAGGAAAGGGGGGAAGG + Intronic
1119646125 14:76349811-76349833 ATAGAGAAGGGAAAAAGGGAAGG + Intronic
1119857462 14:77911273-77911295 ATGGAGAAGGTAGAGGGGCAAGG - Intronic
1120281453 14:82443663-82443685 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1120281456 14:82443669-82443691 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1120988539 14:90354976-90354998 ATGGGGAGGGGAAAGGAGGAGGG + Intergenic
1121161277 14:91743706-91743728 ATGCAGAAGGCAGAAGGGCAAGG - Intronic
1121347390 14:93146170-93146192 ATTGAGAAGGCTAAGGGGCCAGG + Intergenic
1121496454 14:94394832-94394854 AAGGAGAATGGAAAGAGGGACGG - Intergenic
1121593270 14:95137180-95137202 AAGGAGAAGGAAAAGGGGAAGGG + Intronic
1121593330 14:95137382-95137404 AAGGAAAAGGTAAAGGGGAAAGG + Intronic
1121593363 14:95137488-95137510 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1121593371 14:95137512-95137534 AAGGAAAAGGGAAAGGGGAAAGG + Intronic
1121593385 14:95137555-95137577 ATGGAGAAGGGGAAGGGAAAGGG + Intronic
1121593388 14:95137561-95137583 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1121916746 14:97842437-97842459 AGGGAGGAGGCAAAGAAGGAAGG + Intergenic
1122593348 14:102871229-102871251 ATGGAGAAGGGGGAGGGTGAAGG - Intronic
1124173094 15:27395049-27395071 AAGGAGAGGGCAGAGGGGAAAGG - Intronic
1124693945 15:31847868-31847890 GGAGAGAAAGCAAAGGGGGAAGG + Intronic
1124716151 15:32064243-32064265 AAGGGGAAGGGAAAGGGGCACGG - Intronic
1124919440 15:34011603-34011625 ATGGAAAAAGCAGAGGGGAAGGG + Intronic
1125068922 15:35528531-35528553 ATGGGGAATGCCAAGGGGAAAGG - Intronic
1125421210 15:39506547-39506569 ATGGAGGAGTCACAGGGGCATGG + Intergenic
1126180507 15:45780820-45780842 AGGCAGAAGCCAAAGGGGGCAGG - Intergenic
1126183838 15:45811383-45811405 AAGGAGAAGGAAGAGTGGGAAGG + Intergenic
1126192966 15:45898233-45898255 ACTGAGAAGGCAATGGGAGAGGG + Intergenic
1126341210 15:47642899-47642921 ATGGAGAAGGAAATGCGGGAAGG + Intronic
1126859102 15:52866862-52866884 GTGGAGAAGGCAAAGGTCGATGG - Intergenic
1127070229 15:55281719-55281741 AGGGAGAAGGGAAGGGGGAATGG + Intronic
1127189999 15:56519182-56519204 AAGGAGAAAGGAAAGGGGAAAGG + Intergenic
1127370467 15:58334086-58334108 AAGGAGAGGGCAAAAGGTGATGG + Intronic
1127412880 15:58726921-58726943 AAGGAGAAGACGAAGGGGAAGGG + Intronic
1127560581 15:60132515-60132537 AGGGAGAAGGAAAGGAGGGAGGG + Intergenic
1127560601 15:60132584-60132606 AGGGAGAAGGAAAGGAGGGAGGG + Intergenic
1127691117 15:61398660-61398682 AGGGAGAGGGGAAAGGTGGAGGG + Intergenic
1127775769 15:62263374-62263396 AGGGAGAAGGCTAAGGGAAAAGG + Intergenic
1127906526 15:63380253-63380275 AAGGAGGAGGGAAAGGGAGAGGG + Intronic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1128056865 15:64706200-64706222 TTGCAGAAGGCACAGTGGGAGGG - Intergenic
1128240284 15:66096791-66096813 TTGGAGAAGGCACAGGTGGTAGG - Intronic
1128316778 15:66664979-66665001 ATTCAGAAGGCAGAGGTGGAAGG - Intronic
1128375965 15:67076241-67076263 ATAGAGAAGGTGATGGGGGAGGG - Intronic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1128858608 15:71044676-71044698 CTGGAGAAGGTAAGGTGGGAGGG + Intronic
1129044968 15:72725948-72725970 AGGGGGAAGGGAAAGGAGGAAGG - Intronic
1129145885 15:73646811-73646833 ATGGAGGAGGGGGAGGGGGAGGG + Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129160730 15:73746300-73746322 GAGGAGAAGGCAAAGGGAAAAGG + Intronic
1131318013 15:91357813-91357835 ATGGAGAAAGCAAAGTGAAAGGG + Intergenic
1131426913 15:92353271-92353293 TGGCAGAAGGCAAAGGGGAAAGG - Intergenic
1131455962 15:92582812-92582834 ATGGGGGAGGGAAAGGGAGAGGG + Intergenic
1131541738 15:93280406-93280428 ACGGAGGAGGCGAAGGGGGAGGG + Intergenic
1131683143 15:94744895-94744917 AAGGAGAAGGGAAAGGAGGGAGG + Intergenic
1131807836 15:96141492-96141514 ATGGCTGAGACAAAGGGGGAAGG + Intergenic
1132075851 15:98819054-98819076 GTGGAGAAGGCAGATGGGGCAGG + Intronic
1132716496 16:1292667-1292689 AAGGAGAGGGGAGAGGGGGAGGG - Intergenic
1133392753 16:5422766-5422788 ATGGAGAGGGAGAAGGGAGAGGG + Intergenic
1133485462 16:6214862-6214884 AGGGAGAAGGCGAGGGGAGAAGG + Intronic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1133816313 16:9200010-9200032 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1134075878 16:11290918-11290940 ATGGAGAAGGCTTGGGAGGAGGG + Intronic
1134108319 16:11499316-11499338 AGGGAGAGGGGAGAGGGGGAAGG + Intronic
1134352619 16:13451929-13451951 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1134681786 16:16131542-16131564 AAGGAGAAGGCAGTGCGGGAGGG + Intronic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134800174 16:17077002-17077024 GTGGAGAAGGTAAAGGGGGAAGG - Intergenic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1135379057 16:21978510-21978532 ATGGAAAAGGCAGGTGGGGAAGG - Intronic
1135610738 16:23864875-23864897 AGGGAGAGGGCATAGGGGAAGGG - Intronic
1135671852 16:24382261-24382283 GTGGAGAAGGAGGAGGGGGAGGG - Intergenic
1135694936 16:24577398-24577420 ATGAAGCAGGCAAAGGAGGAAGG - Intergenic
1135775372 16:25253382-25253404 CTGGGGAAGGGAAAGGGGGTAGG - Intronic
1135957186 16:26965715-26965737 ATGGAGAGGGCACAGAGTGAGGG - Intergenic
1135987453 16:27194453-27194475 GAGGAGAAGGCCAAAGGGGAAGG + Intergenic
1136044442 16:27604039-27604061 ATGGAGAATAGAAAGTGGGAAGG - Intronic
1136361895 16:29785905-29785927 ATGGAGAAGAGAATGGGGGCTGG - Intergenic
1136427457 16:30178594-30178616 ATGGAGAAGGCGGAGGGGGTAGG + Intergenic
1137946244 16:52735572-52735594 ATAGAGAAGCCAAGAGGGGATGG - Intergenic
1138019547 16:53465843-53465865 ATGGAGGAGGCAGAGGTGGTGGG + Intronic
1138202576 16:55101056-55101078 AGGGAAAAGGAAAGGGGGGAAGG + Intergenic
1138579411 16:57930558-57930580 AAGGAGGAGGGGAAGGGGGAGGG + Intronic
1138705610 16:58912172-58912194 TGGCAGAAGGCAAAGGGGGAGGG - Intergenic
1138761283 16:59547668-59547690 AAGAAGAAAGTAAAGGGGGAGGG - Intergenic
1138877306 16:60967698-60967720 TGGAAGAAGGCAAAGGGGAATGG - Intergenic
1139060952 16:63250714-63250736 AAGGAGGAGGGAAAGGGAGAGGG + Intergenic
1139144499 16:64307625-64307647 AGAGAGAAGGAAAAGGAGGAAGG + Intergenic
1139268241 16:65659430-65659452 ATGGAGAAGGTGCAGAGGGATGG + Intergenic
1139388154 16:66587741-66587763 GTGGAGAAGGCAAAGGCTGAGGG + Intronic
1139459640 16:67111276-67111298 ATGGAGAGGGTGAAGGGAGAAGG - Intronic
1139983255 16:70877521-70877543 ATGGACCAGGCAATGGGGAATGG + Intronic
1140041810 16:71413125-71413147 ATGCAGAAGGCAGTGGAGGAGGG + Intergenic
1141219932 16:82059991-82060013 ATGCTGAGGGCAAAGGAGGAGGG + Intronic
1141668729 16:85480406-85480428 CTGGAGCAGGCAGAGGGGGGTGG - Intergenic
1141803878 16:86329820-86329842 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1142145584 16:88491614-88491636 ACGGAGAAGGCCCTGGGGGATGG + Intronic
1142145697 16:88492096-88492118 AGGGAGAAGGCGAGGAGGGATGG - Intronic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142222498 16:88862429-88862451 AGGAAGAAGGCAAAGGGGAAGGG - Exonic
1142243291 16:88956810-88956832 CTGGAGAAGGCACAGAGGGAGGG - Intronic
1142557501 17:789899-789921 GGGGAGAAGGGAAAGGGGAAAGG - Intronic
1143186787 17:5014829-5014851 ATGGAGAAGGTAATGGCTGAGGG + Exonic
1143432550 17:6897883-6897905 AGGGTGAAGGCAAAAAGGGATGG + Intronic
1143459265 17:7090393-7090415 ATTGAGAAGGCTAAGGTGGGAGG + Intergenic
1143695185 17:8609345-8609367 ATCGAGAAGGAAAGGGAGGAAGG + Intronic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1144300508 17:13919329-13919351 AGTGAGAAGGGGAAGGGGGAAGG - Intergenic
1144620700 17:16816679-16816701 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1144884942 17:18451468-18451490 CAGGAGAAGGAAAAAGGGGAGGG - Intergenic
1145111408 17:20165239-20165261 ATGGAAACGGCACAGGGGGTGGG - Intronic
1145147279 17:20492909-20492931 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1146123732 17:30216277-30216299 AAGGAGAAGGGAGCGGGGGAGGG + Intronic
1146441937 17:32904704-32904726 CTGTAGATGGCAAAGGGGCAAGG + Intergenic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146916753 17:36682886-36682908 AAGGAGAAGGCACAAGGGGAGGG - Intergenic
1147881567 17:43657561-43657583 AAGGAGATGGCAAAGGAGGAAGG + Intronic
1148738769 17:49880372-49880394 AGGGAGAAGGTTAAGGGGCAAGG - Intergenic
1148874087 17:50676252-50676274 TTGGAGAAGGCAGAGGGCGCTGG - Intronic
1149433015 17:56609561-56609583 ATGGAAAAGGCCAAGGTGGGTGG - Intergenic
1149717288 17:58804505-58804527 ATGGAGATAGGGAAGGGGGATGG + Intronic
1150574091 17:66414370-66414392 TGGCAGAAGGCAAAGCGGGAGGG - Intronic
1150822215 17:68444865-68444887 AAGGAGAAGGAAGAGAGGGAGGG - Intronic
1151078494 17:71301515-71301537 AGGGAGAAAAGAAAGGGGGAAGG - Intergenic
1151458232 17:74239328-74239350 ATGGAGGAGGCACGTGGGGAGGG + Intronic
1151470003 17:74312066-74312088 AAGGAGAAGGGTAAGGCGGAGGG + Exonic
1151664590 17:75538247-75538269 ATGGAGGAGGGAACGGGGGGTGG + Intronic
1151724787 17:75877681-75877703 ATGGAGATGGGAAGGGAGGAAGG - Intronic
1151745900 17:76011669-76011691 CTGGAGAAGGCAGAGGGAGAGGG + Intronic
1151958482 17:77392626-77392648 CTTGGGAAGGCAGAGGGGGAGGG + Intronic
1152026337 17:77811835-77811857 GCGGAGGAGGCAAAAGGGGATGG + Intergenic
1152070285 17:78130872-78130894 AGGGAGAATGCAGAGGGTGAGGG + Intronic
1152099457 17:78292520-78292542 ATGGAGAGGGCAGATGAGGAGGG - Intergenic
1152128227 17:78460148-78460170 CTGAATAAGGTAAAGGGGGAGGG - Exonic
1152369511 17:79877694-79877716 AAGGAGAACGCAGAGGTGGATGG - Intergenic
1152376498 17:79921351-79921373 ATTGAGAAGGCACTGGGGCAAGG - Intergenic
1152468899 17:80480136-80480158 GTAGAGAAGGCAAAGGGGGCAGG + Intergenic
1152609221 17:81307449-81307471 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1152609255 17:81307532-81307554 AAGGGGAAGGGGAAGGGGGACGG - Intergenic
1152948448 17:83211567-83211589 ATGAAGAAAGGAGAGGGGGATGG + Intergenic
1152948456 17:83211592-83211614 AGGGAGAAAGGAGAGGGGGATGG + Intergenic
1153597943 18:6747922-6747944 ATGGGGTAAGCAGAGGGGGAAGG + Intronic
1153943021 18:9993534-9993556 AGTGAGAAGGAAACGGGGGAAGG - Intergenic
1154295895 18:13147411-13147433 AGCAAGAAGGCAAAGGGGGGTGG - Intergenic
1155237487 18:23835287-23835309 GTGGAGATGGCTAAGGGGGCAGG + Intronic
1155678753 18:28463477-28463499 TGGCAGAAGGCAAAGGAGGAGGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155904201 18:31429608-31429630 AGTGAAAAGGCAAAGGAGGAAGG + Intergenic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156369994 18:36464725-36464747 CAGGAGGAGGCAAAGGGGGAGGG + Intronic
1156421547 18:36959582-36959604 GAGGAGAAAGGAAAGGGGGAGGG - Intronic
1156721123 18:40071125-40071147 TAGAGGAAGGCAAAGGGGGAGGG - Intergenic
1157210052 18:45734629-45734651 ATTCAGAAGGCTGAGGGGGAAGG + Intronic
1157237603 18:45979182-45979204 AAGGAGAAGGGAGAGGGAGAGGG - Intergenic
1157241182 18:46010811-46010833 CTGGACAAGGCAATAGGGGAAGG - Intronic
1157487202 18:48096526-48096548 AGGGAGATGGCAAAGAGAGAGGG + Intronic
1157556156 18:48614044-48614066 AAGGAAAAGGAAAAGAGGGAAGG - Intronic
1157619223 18:49006447-49006469 ATGGAGATGGTAAGGGTGGAGGG - Intergenic
1157678821 18:49587895-49587917 ATACAGGAGGCAAAGGCGGAAGG - Intronic
1157844138 18:50986840-50986862 ATGGACAAAGCAAAGGAGCATGG + Exonic
1157884190 18:51350575-51350597 AGGGAGAAGGGAAGGGGGAAGGG - Intergenic
1157923329 18:51736550-51736572 ATGGAGGATGCAAAGAGGTAGGG + Intergenic
1158491123 18:57910639-57910661 CTGGAGAAGGCAGCGGGGAAAGG + Intergenic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159402322 18:67954471-67954493 TTGGAGAAGACAAAAGGGGATGG + Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1160421862 18:78753526-78753548 ATGGAGGAGGGCAAGGGGTAGGG - Intergenic
1160535527 18:79589557-79589579 AGGGAGAAGGGAGATGGGGAAGG + Intergenic
1160676619 19:394575-394597 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676758 19:395194-395216 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676783 19:395294-395316 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676808 19:395394-395416 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676843 19:395529-395551 ATGGAGAAGGGTGATGGGGAAGG + Intergenic
1160695196 19:480499-480521 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695369 19:481421-481443 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1161254463 19:3299672-3299694 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1161415799 19:4145666-4145688 AGGGAAAAGGCCAAGGAGGAGGG + Intergenic
1161642850 19:5435245-5435267 CTGGAGTAGGCAGTGGGGGAAGG + Intergenic
1161816514 19:6502639-6502661 AGGGTGGAGGCTAAGGGGGAGGG - Intronic
1161821493 19:6533433-6533455 ATGGAGAGGGGAAGGGGGAAGGG - Intronic
1161847308 19:6719119-6719141 AGGGAGAAGACAGAAGGGGAGGG + Intronic
1162514401 19:11139251-11139273 ATGGAGGAGACCAAGGGGGATGG - Intronic
1162686187 19:12386485-12386507 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1162686192 19:12386497-12386519 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1162876788 19:13626603-13626625 AGGGGGAAGGGAAAGGGGAAGGG + Intergenic
1162893756 19:13752220-13752242 AGGGGGAGGGGAAAGGGGGAAGG - Intronic
1163113038 19:15172995-15173017 AAGAAGAAGGAAGAGGGGGAGGG - Intronic
1163316046 19:16541493-16541515 AGGGAGACGGCAAAGGGGGCTGG + Intronic
1163322571 19:16583212-16583234 AGGGAGAATCCAAAGGAGGAGGG - Intronic
1163411775 19:17159353-17159375 AGGGAGAAGGAAAAGGGAGATGG - Intronic
1164964799 19:32473513-32473535 ATTTAGCAGGCAAAGGGAGAAGG - Intronic
1165194850 19:34093880-34093902 TGGCAGAAGGCAAAGGGGGATGG + Intergenic
1165327588 19:35123218-35123240 AGGGAGAGGGCAAATGGGGGCGG + Intronic
1165618924 19:37227692-37227714 GTGTATAAGGCAAAGGGGCAGGG + Intronic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166034965 19:40161432-40161454 AAGGGGAAGGGAAAGGGAGAGGG + Intergenic
1166548578 19:43649659-43649681 AAGGAGAAGGGAAAGAAGGAAGG + Intronic
1166625628 19:44352025-44352047 ATGGAAAAGGCAATGGGGTTGGG + Intronic
1166652133 19:44582654-44582676 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1166674944 19:44734651-44734673 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1166674947 19:44734657-44734679 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1167036048 19:46995561-46995583 CTGGTGATGGCAAAGGTGGATGG - Intronic
1167483863 19:49748692-49748714 ATCCAGGAGGGAAAGGGGGATGG + Intronic
1167702104 19:51054950-51054972 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1167702107 19:51054956-51054978 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1167854422 19:52226289-52226311 GTGGAGAAGTAAATGGGGGAGGG - Exonic
1168058357 19:53876371-53876393 ATGGATACGGGAATGGGGGAAGG - Exonic
1168075846 19:53980621-53980643 CTGGAAAAGCCAAAGGGGGAGGG + Intronic
1168144752 19:54414761-54414783 ATGGCGAATGCCAAGGGGCAGGG + Intergenic
1168251574 19:55145314-55145336 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1168251598 19:55145381-55145403 AGGGAGGAGGGAAAGGGGGAGGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
924998752 2:386954-386976 AGGGAGAAGGCAGAGGGGAGAGG - Intergenic
925441034 2:3885466-3885488 ATGAAGAAGTGAAAGGAGGAAGG - Intergenic
925847273 2:8045234-8045256 ATGGAGAGGGCAGAGGTGGGTGG - Intergenic
925927599 2:8681696-8681718 ATGGGGGAGGGGAAGGGGGAGGG - Intronic
926048112 2:9724977-9724999 CTGGAGAAGGCAAAGTGGAAAGG - Intergenic
926137436 2:10346778-10346800 ATGGAGAAGGAAGGGGAGGAAGG - Intronic
926631545 2:15141144-15141166 AAAGAGAAGGGAAAAGGGGATGG - Intergenic
927280837 2:21305024-21305046 AAGGAGAAGGGAAGTGGGGAAGG + Intergenic
927287480 2:21371607-21371629 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
927503768 2:23599954-23599976 CTGCAGAATGAAAAGGGGGATGG - Intronic
927866174 2:26589147-26589169 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
927866177 2:26589153-26589175 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
928619182 2:33071539-33071561 TTGGAGCAGGAACAGGGGGAAGG + Intronic
928726488 2:34179771-34179793 ATGTTGAAGGGAAAGGGGAAAGG - Intergenic
928752353 2:34485714-34485736 CTGGAGTAGGAAAAGTGGGATGG - Intergenic
928780350 2:34810347-34810369 ATGGAGAAAGAAAAGGAGTATGG - Intergenic
928933133 2:36645907-36645929 CTGGAGAAGTGAAAGGGAGAAGG + Intronic
929061436 2:37928708-37928730 CTTGAGAAGGCAAAGGAGGTGGG - Intronic
929290059 2:40180309-40180331 TTAGAGAAGGCACAGGAGGATGG + Intronic
929377597 2:41308430-41308452 ATGCTGAACGCAAAGAGGGAAGG + Intergenic
929481218 2:42310293-42310315 AAGGGGAAGGGAAAGGGGAATGG - Intronic
929615727 2:43305886-43305908 AAGGAGAAAGAAAAGGGGAAAGG - Intronic
930083988 2:47480017-47480039 AGGGAGAAGGGAGAAGGGGAGGG - Intronic
930084011 2:47480097-47480119 AGGGGGAAGGGAAAGGGGAAGGG - Intronic
930435583 2:51337379-51337401 ATGGAGAAGGAAAAGAGAAAGGG + Intergenic
930539999 2:52693480-52693502 AGGGAGGAGGGAAAGGAGGAAGG + Intergenic
931061824 2:58537939-58537961 ATGGATTAGATAAAGGGGGATGG - Intergenic
931240811 2:60450750-60450772 ATGGAAAAGCCACAGGGGAAAGG + Intergenic
931512848 2:63019776-63019798 GAGGAGAAGGGAAAGGGGGAGGG + Intronic
931826301 2:66004196-66004218 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
931890949 2:66671401-66671423 ATGGGGGAGGCAGAGGGGAAGGG + Intergenic
931942965 2:67273279-67273301 GTGGAGAAGGAAGTGGGGGAAGG - Intergenic
932143873 2:69302166-69302188 ATGAAGAAGGAAAAGGGAAAAGG - Intergenic
932336658 2:70935672-70935694 AGGGAGAAGGGAAGAGGGGAGGG - Intergenic
932921648 2:75921541-75921563 CTGGGGAAGGGAAAAGGGGAGGG + Intergenic
933060311 2:77728023-77728045 ATGGTGGAGGCCATGGGGGAGGG + Intergenic
933190393 2:79327795-79327817 ATGCAGAAGGGGCAGGGGGATGG + Intronic
933387907 2:81634652-81634674 AAGGAGAAGGAAAAGTGGGAAGG + Intergenic
933441103 2:82315394-82315416 GAGGAGAAGGAAGAGGGGGAGGG - Intergenic
933475625 2:82786453-82786475 ATGGAGAAAGAGAAGGGGGGCGG + Intergenic
933916132 2:86995670-86995692 GTGGAGATGGCAAAGTGGCATGG + Intronic
934006861 2:87774232-87774254 GTGGAGATGGCAAAGTGGCATGG - Intronic
934016499 2:87891338-87891360 CTGCAGATGGCAAAGGGAGAAGG - Intergenic
934070197 2:88376854-88376876 AGGGAGCAGGCAAAGAAGGATGG - Intergenic
934532928 2:95106826-95106848 GTGGAGAGAGCAAAGGGTGAAGG - Intronic
935770507 2:106415154-106415176 GTGGAGATGGCAAAGTGGCATGG - Intronic
935909580 2:107880782-107880804 GTGGAGATGGCAAAGTGGCATGG + Intronic
935967697 2:108497639-108497661 GTGGAGATGGCAAAGTGGCATGG + Intronic
936061950 2:109300650-109300672 ATGGAGAAGGAAGAGGAAGATGG - Intronic
936131360 2:109845909-109845931 GTGGAGATGGCAAAGTGGCATGG + Intronic
936158375 2:110064637-110064659 AGGGAGACGGGAGAGGGGGAGGG + Intergenic
936186286 2:110306689-110306711 AGGGAGACGGGAGAGGGGGAGGG - Intergenic
936213337 2:110525576-110525598 GTGGAGATGGCAAAGTGGCATGG - Intronic
936422476 2:112380130-112380152 GTGGAGATGGCAAAGTGGCATGG - Intronic
936524369 2:113232911-113232933 ATGGGGCAGGCAAGGGGTGAGGG - Intronic
936592566 2:113818032-113818054 GTGGAGCAAGCAAAGGGAGAGGG - Intergenic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
936919519 2:117673431-117673453 AAGGAGCAGGCAACAGGGGAAGG + Intergenic
936927130 2:117748877-117748899 ATGGAGAAGCCAAATAGAGATGG + Intergenic
937102635 2:119283394-119283416 GGGGAGAAGGCAAAGCAGGAAGG - Intergenic
937130902 2:119512328-119512350 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
937130905 2:119512334-119512356 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
937157680 2:119732550-119732572 ATGGAGCAGTCAGAGCGGGAAGG + Intergenic
937232391 2:120405779-120405801 TTGGAGATGGCAAAGGATGAGGG - Intergenic
937320732 2:120959220-120959242 GTGGAGAAGGCACAGCGGGTGGG - Intronic
937483099 2:122283199-122283221 AGGAAGAAGAAAAAGGGGGAGGG - Intergenic
937550156 2:123077971-123077993 ATTGAGTAGGCAAAGGAGAAGGG + Intergenic
938043410 2:128095377-128095399 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
938043420 2:128095401-128095423 AAGGGGAAGGTAAAGGGGAAGGG - Intronic
938571621 2:132566937-132566959 AGGAAGAAGGCAAATGGAGAAGG - Intronic
938743954 2:134259603-134259625 AGGCAGCAGGCAAAGTGGGATGG - Intronic
938823072 2:134978052-134978074 CTGGAGAAGGGAAGGGAGGAAGG - Intronic
938843782 2:135187541-135187563 ATGGAGCTGGGAAAAGGGGATGG - Intronic
939462302 2:142512882-142512904 ATGGAGAAGGAAGAAGGGTAGGG + Intergenic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
939481528 2:142753989-142754011 ATGGAGAAGGGAAAGGTGTGAGG + Intergenic
939835429 2:147124478-147124500 AGAGAGAGAGCAAAGGGGGAAGG - Intergenic
940315115 2:152320246-152320268 AAGGAGAAGGAAAAGTGGGAAGG - Intergenic
940444821 2:153765089-153765111 GTGCAGAAGGGAAAGTGGGATGG + Intergenic
941023098 2:160430946-160430968 CTGGAGGAGGGAAAGGGGGATGG - Intronic
941024940 2:160448295-160448317 AGGGAGACGGGAGAGGGGGAGGG - Intronic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
941038253 2:160590654-160590676 AGGGAGGAGGGGAAGGGGGAGGG - Intergenic
941108317 2:161388530-161388552 TTGCAGAAGGCAAAAGAGGAAGG - Intronic
941232646 2:162930641-162930663 ATGGTAAAGGCAAAGCGGGCAGG - Intergenic
941234027 2:162946635-162946657 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
941866774 2:170343563-170343585 ATGGGGAAGGAACAGTGGGAAGG + Intronic
941940228 2:171028875-171028897 ATGAAGAAGGCAAAAAAGGATGG + Intronic
942165731 2:173238998-173239020 ATGGAGGATGCAAATGTGGATGG - Intronic
942248852 2:174031133-174031155 ATGGGAGAGGGAAAGGGGGAAGG - Intergenic
942487859 2:176458086-176458108 ATGAATGGGGCAAAGGGGGAAGG + Intergenic
942572536 2:177328428-177328450 ATGGAGAAGGTAATTGGAGATGG + Intronic
942894754 2:181038965-181038987 ATTGAGAAGGCAAAATGGTATGG + Intronic
943921535 2:193713263-193713285 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
944329130 2:198445062-198445084 GGGGAGAAGGGAAAGGGGAAAGG - Intronic
944368511 2:198953859-198953881 ATGGAGAGGGTAAAGGAAGATGG - Intergenic
944925138 2:204456493-204456515 AGGGAGAAGGGAAAGGGAGATGG + Intergenic
945051095 2:205825008-205825030 AGGGGGAAGGGAAAGGGAGAGGG + Intergenic
945576892 2:211542410-211542432 ACGGGGAAAGCAGAGGGGGATGG - Intronic
946109626 2:217403189-217403211 GAGGAGAAGGGAGAGGGGGAGGG + Intronic
946212210 2:218156326-218156348 ATCTAGAAGGTAAATGGGGAGGG - Intergenic
946399418 2:219460798-219460820 ACGGAGAAGGCCCTGGGGGAGGG - Intronic
946399578 2:219461328-219461350 GCTGAGAAGGGAAAGGGGGAGGG + Intronic
946759886 2:222982998-222983020 ATGGAGACGGGAAGTGGGGAAGG - Intergenic
946857670 2:223968899-223968921 GAGGAGGAGGAAAAGGGGGATGG - Intergenic
947287477 2:228532597-228532619 CTGCAGATGGCAAAGGGAGAAGG - Intergenic
947624825 2:231612913-231612935 AGGGAGAAGGGAAGGGGGGACGG + Intergenic
947783639 2:232794134-232794156 CTTAAGAAGGAAAAGGGGGATGG - Intronic
947946247 2:234105383-234105405 CTGGAGAAGGTAAAGGAGGCAGG + Intergenic
948293854 2:236846793-236846815 AAGAAGAAGGCAAAGGGGTGAGG + Intergenic
948295682 2:236858557-236858579 TTGGTGAAGACAAAAGGGGAGGG + Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948358223 2:237397506-237397528 AGGGAGGAGGCAAGGTGGGAAGG + Intronic
948493407 2:238329028-238329050 AAGGAGAAGGCCAAGGAGAATGG + Exonic
948539004 2:238672376-238672398 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558565 2:238835263-238835285 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
948558568 2:238835269-238835291 AGGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558591 2:238835344-238835366 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
948558594 2:238835350-238835372 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948742728 2:240058120-240058142 GAGGAGAAGGCAGTGGGGGAGGG + Intergenic
949029774 2:241788058-241788080 CTGGAGATGGCAAAGGGGGAAGG - Intronic
1168760085 20:344627-344649 CTGTAGAAGGCGAAGGGGAAGGG - Intergenic
1168824768 20:802657-802679 CTGAAGACGGCAAAGGGGGAAGG - Intergenic
1169004706 20:2196892-2196914 ATGGAGAAGGGCATGGAGGAGGG + Intergenic
1169024156 20:2353370-2353392 ACAGAGAAGAGAAAGGGGGAGGG - Intergenic
1169178644 20:3542606-3542628 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1169233780 20:3912133-3912155 TTGGAGAAGGGAAAGGGAGGAGG + Intronic
1169340457 20:4792634-4792656 GTGGAGAAGACAAAGGGGAGGGG + Intronic
1169585984 20:7086048-7086070 ATGGAGGAGGAAAAGAAGGAAGG - Intergenic
1169801870 20:9518801-9518823 ATCCAGAAGGCAGAGGGGGTGGG + Intronic
1169894789 20:10491414-10491436 ATGGAGAAGACAAAGGAGCAAGG - Intronic
1170075226 20:12411454-12411476 AAACAGAAGGCAAAGGGGGAGGG - Intergenic
1170096324 20:12649622-12649644 ATGAAGAAAGGAAAGGAGGAGGG + Intergenic
1170116160 20:12862413-12862435 CTGTAGCAGGCAAAGGTGGAAGG - Intergenic
1170572600 20:17640960-17640982 ATGGAGAAGGCAGGGAGGCAGGG + Intronic
1170579238 20:17685244-17685266 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1170579241 20:17685250-17685272 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1170647296 20:18208919-18208941 ATGGAGGAAGGAATGGGGGAAGG + Intergenic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1170902166 20:20474717-20474739 ATGGAGAAGACTGAGAGGGAGGG + Intronic
1170976252 20:21167400-21167422 ATGGTGAAGGTATAAGGGGAGGG - Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172486069 20:35298485-35298507 GAGGAGAGGGCTAAGGGGGAAGG - Intergenic
1173000859 20:39104648-39104670 ATCGAGATGGAAAATGGGGAAGG + Intergenic
1173384609 20:42575875-42575897 ATGGAGGAGGCAGGCGGGGAGGG - Intronic
1173484587 20:43431068-43431090 ATGGGGAAGGCAGAGAGGGCAGG + Intergenic
1173615357 20:44399969-44399991 ATGTAGAAGGCAGAGAGTGAGGG - Intronic
1173718186 20:45229851-45229873 GTGGAGGAGGCAAAGGGGGACGG - Intergenic
1173865489 20:46309743-46309765 ATGGAGATGGAAATTGGGGAAGG - Intergenic
1174004305 20:47398255-47398277 AAGGAGAAGGGAAAGGAAGAGGG + Intergenic
1174180233 20:48669838-48669860 ATGGAGAAGGCAAAGTGGGGTGG + Intronic
1174188457 20:48723271-48723293 CTGGAGAAGCCAGAGGGGGTGGG + Intronic
1174379788 20:50149260-50149282 AGGGGGAAGGGAAAGGTGGAGGG - Intronic
1174602068 20:51732789-51732811 ATGGAGGAAGCAAAGAGGGAGGG + Intronic
1174831796 20:53820331-53820353 AAGGAGAGGGAAAAGTGGGAAGG - Intergenic
1175328855 20:58148894-58148916 TTGAAGAATGCAAAGGGGGCCGG - Intergenic
1175432911 20:58919548-58919570 ATTTAGAAGGCAAAGGTGGTAGG + Intergenic
1175502759 20:59461956-59461978 AGGGAGATGGCAAAGGAGAAGGG - Intergenic
1175717695 20:61266344-61266366 CTGGAGAAGGCAGAGGAGAAAGG + Intronic
1175739798 20:61412653-61412675 GTGGAGAAGGCAGAGCTGGAAGG - Intronic
1175921336 20:62451808-62451830 ATGGAGAAGAGAGAGGGAGAGGG + Intergenic
1176050849 20:63118940-63118962 ATGGAGAAGGCAGGAGGGGGCGG - Intergenic
1176657310 21:9598776-9598798 ATGGAGTAGAGAAAGAGGGAAGG + Intergenic
1176965091 21:15204120-15204142 ATAGAGAAGGCAATGCGTGAAGG + Intergenic
1177114869 21:17073355-17073377 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1177212900 21:18091873-18091895 AAGGGGAAGGAAAAGTGGGAAGG + Intronic
1178748273 21:35274762-35274784 ATTGAGAAGGGATAGGGTGAGGG - Intronic
1179579484 21:42331893-42331915 ATGGAGAAGTGATAAGGGGAAGG + Intergenic
1180657704 22:17437200-17437222 ATTTAGGAGGCCAAGGGGGAAGG - Intronic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181459688 22:23078710-23078732 AGGAAGAAGGCCAAGGGTGAGGG + Intronic
1181741234 22:24923481-24923503 ATGGAGAAGGAAGAGGAGAAAGG - Intronic
1181813630 22:25420857-25420879 AAGGAGGAGGCGGAGGGGGAGGG + Intergenic
1181880972 22:25979792-25979814 ATGGAGAAGGGGAAGGGAAAGGG - Intronic
1182408347 22:30158566-30158588 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1182886410 22:33777672-33777694 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1183136529 22:35894530-35894552 TTGGAGAAGGCAAGTGGGGCAGG - Intronic
1183153157 22:36053736-36053758 AGGGAGAAGGGAAAGGAGAAGGG - Intergenic
1183153172 22:36053779-36053801 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183153185 22:36053810-36053832 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183194324 22:36343036-36343058 CTGGAGAGGGCACAGGTGGAGGG - Intronic
1183266193 22:36827327-36827349 AAGGAGGAAGGAAAGGGGGAGGG - Intergenic
1183593390 22:38794788-38794810 ACGGAGAAGGAAAAGGGGAAAGG + Intergenic
1183732750 22:39627848-39627870 ATGGGGAAGGAAGAGAGGGAAGG + Intronic
1183796296 22:40121206-40121228 AGGGAGGAGGGAAAGGAGGAAGG - Intronic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184328970 22:43813565-43813587 ATAAAGAAGGCAAATGGGGAGGG - Intergenic
1184554231 22:45224732-45224754 ATCAAGCAGGCAAAGGTGGACGG + Intronic
1184946049 22:47804925-47804947 ATGGAGAAAGAAAAGGGGCAGGG - Intergenic
1185229812 22:49673560-49673582 AGGGGGAAGGGGAAGGGGGAGGG + Intergenic
1185229842 22:49673620-49673642 AGGGAGAGGGGGAAGGGGGAGGG + Intergenic
1185273319 22:49938439-49938461 ATGGAGAAGGCGGATGGGGCAGG + Intergenic
949155931 3:827267-827289 ATGGAGAGGAAAAAGTGGGAAGG + Intergenic
949366267 3:3284995-3285017 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
950012148 3:9731452-9731474 AGGGAGGAGGCAGAGGGGGAGGG + Intergenic
950060657 3:10069479-10069501 AGGGAGACGGGAGAGGGGGAGGG - Intronic
950080195 3:10216460-10216482 AAGAGGAAGGCAAAGGAGGAGGG + Intronic
950352761 3:12373289-12373311 AGGGAGAAGGGCAGGGGGGAAGG + Intronic
950365853 3:12483687-12483709 AAGCAGGAGGCAAAGGAGGATGG - Intergenic
950461074 3:13122498-13122520 ATGAAGAAGGCAGGGAGGGAGGG + Intergenic
950635518 3:14311685-14311707 AGGGAGAGGGGAAAGAGGGAGGG - Intergenic
951719112 3:25679568-25679590 AGGGCGAGGGGAAAGGGGGAGGG + Intergenic
951719119 3:25679581-25679603 AGGGGGAGGGGAAAGGGGGAGGG + Intergenic
951719128 3:25679600-25679622 AGGGCGAGGGGAAAGGGGGAGGG + Intergenic
951719145 3:25679638-25679660 AGGGCGAGGGGAAAGGGGGAGGG + Intergenic
951719154 3:25679657-25679679 AGGGCGAGGGGAAAGGGGGAGGG + Intergenic
952046488 3:29327486-29327508 AAGGAGGAGGAAAAGGAGGAAGG - Intronic
952247781 3:31614408-31614430 ATGGACAAGGAAACTGGGGAGGG - Intronic
952769095 3:36981251-36981273 ATTGGGAAGCCAAAGTGGGAGGG - Intergenic
952868715 3:37877784-37877806 TGGCAGAAGGCAAAGAGGGACGG + Intronic
952987484 3:38799076-38799098 ATTAAGAAGGCAAAAGGGGCTGG - Intergenic
953171886 3:40514361-40514383 ATGTACAAGGCAAAGGGGCAGGG - Intronic
953194343 3:40718192-40718214 ATGGGGAGGGCAAAGGGGAGAGG + Intergenic
953331060 3:42053388-42053410 CGGGGGATGGCAAAGGGGGAGGG + Intronic
953374658 3:42418601-42418623 AGGGAGAAGGAAAGGGGGAAAGG + Intergenic
953420523 3:42750248-42750270 CTGGAGAAGGAAGATGGGGAAGG - Intronic
953706789 3:45237322-45237344 CGGGAGAAGGGAAAGGGGCATGG - Intergenic
953860766 3:46542386-46542408 ACAGAGAAGGCTAAGGTGGAAGG + Intronic
953965279 3:47300081-47300103 ATGGAGAAGGGAAAGAGGACAGG - Intronic
954403864 3:50334250-50334272 AGGAAAAAGGTAAAGGGGGAGGG + Intronic
954411818 3:50374251-50374273 AGGGGGAAGGAAAAGGGGAAAGG + Intronic
954416582 3:50396216-50396238 ATGGAGGAGGCAGAGGGGCCAGG - Intronic
954505459 3:51067525-51067547 AGGGAGAAGGGAAGTGGGGAGGG - Intronic
954633931 3:52061347-52061369 TTGGAGAAGGCAAAGGGAAGAGG + Intergenic
954764199 3:52898951-52898973 ATGGAGCAGGGAAAAGGGAATGG - Intergenic
954859876 3:53678706-53678728 ATGGAGAATGTGAAGAGGGAAGG + Intronic
955150686 3:56363869-56363891 AAGGGAAAGGGAAAGGGGGAGGG + Intronic
955687333 3:61561161-61561183 CTGGCGAGGGGAAAGGGGGAGGG - Intergenic
955908904 3:63839444-63839466 ATGGAGAAGGCAGATTGGTAAGG - Intronic
956075138 3:65496989-65497011 ATTGAGAAGGCTGAGGGGAAAGG + Intronic
956392732 3:68790936-68790958 AAGGATAAGGCAAACGTGGATGG + Intronic
956804390 3:72794728-72794750 ATGGAGAAGGGAAAAAGGCATGG - Intronic
957038083 3:75313341-75313363 ATGATGAAGGCAGATGGGGAAGG - Intergenic
957310599 3:78513486-78513508 ATGGGGTAGGGAAAGGGGGAGGG + Intergenic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957867978 3:86049689-86049711 TAGCAGAAGGCAAAGGGGGAAGG + Intronic
958867652 3:99519655-99519677 AAGGGGAAGGCAGAGGAGGAGGG + Intergenic
959208347 3:103342512-103342534 AGAGAGAAGGAAAAAGGGGAGGG - Intergenic
959240909 3:103792500-103792522 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
960048832 3:113221874-113221896 TGGGAGTAGGCAAGGGGGGAAGG - Intronic
960139734 3:114140404-114140426 ATGAAGAAGGCAAAGCTAGAGGG - Intronic
960227733 3:115186488-115186510 CTGAAGATGACAAAGGGGGAAGG - Intergenic
960589222 3:119349474-119349496 ACGGAGAATGCAAAGGCAGAAGG + Intronic
960815604 3:121668770-121668792 ACGGAGGAGGAAAAGGGGGTTGG - Intronic
960972665 3:123150700-123150722 CTGGAGAAGGAAGAGGGGGCGGG - Intronic
961040316 3:123673813-123673835 ATGGAGTTTGCAAAGGTGGATGG - Intronic
961345354 3:126260357-126260379 GGGGAGAAGGAAGAGGGGGAGGG - Intergenic
961703085 3:128762259-128762281 ATGAAAAAGGCTAAGGAGGAGGG + Intronic
962246398 3:133797929-133797951 AGGGAGAAGGGGAAGGGTGAAGG + Intronic
962344608 3:134610096-134610118 GTGGAGAAGACCAAGCGGGAGGG - Intronic
962537510 3:136343235-136343257 GTAGAGAAGGCAGAGGGTGATGG - Intronic
963060433 3:141220866-141220888 AAGAGGATGGCAAAGGGGGAAGG - Intergenic
963325458 3:143857517-143857539 ATAGAGAAGGTAAAGAGGGTGGG - Intergenic
963332174 3:143926903-143926925 ATGGAGAAAGCAGACAGGGAAGG + Intergenic
964457731 3:156886373-156886395 ATGGAGTGGGCATATGGGGAGGG - Intronic
964484776 3:157175989-157176011 ATAGAGGAAGCAAAGGGGCAGGG - Intergenic
964611692 3:158622206-158622228 CTGCAGATGGCAAAGGGGGAAGG + Intergenic
964692779 3:159470928-159470950 CTGGAAAAGGCAAAGGTAGAGGG + Intronic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966266225 3:178047721-178047743 AAGGAGAAAGGAAAGGAGGAAGG + Intergenic
966299982 3:178467837-178467859 ATGGAAAAGAGAAAGGGGGCAGG + Intronic
966437396 3:179904207-179904229 ATGGAGAAAGCAATGCTGGAGGG - Intronic
966470466 3:180283284-180283306 ATAGAGATGGGAATGGGGGATGG - Intergenic
966711799 3:182980111-182980133 ATGGAGCCGGCAGAGGGGCAGGG + Intronic
966819198 3:183911503-183911525 AGAGAGAAGGCAGAGGGGCAAGG - Intergenic
967100865 3:186214918-186214940 ATGTAGAAGGCAAACAGGGAAGG + Intronic
967118794 3:186364519-186364541 ATGTGGAAGGCAAAGAGGGATGG + Intergenic
967129424 3:186457064-186457086 ATGGAGAAGCCACATGGAGAGGG + Intergenic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967739447 3:192988996-192989018 CTGGAGAAGGAAAAAGGGCATGG - Intergenic
967886504 3:194337045-194337067 ATGGGGAAGGGCAAGGGCGAGGG + Intergenic
968135629 3:196217639-196217661 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
968294286 3:197561887-197561909 CTGCAGATGGCAAAGGGGGAAGG - Intronic
968549859 4:1216640-1216662 GTGGAGACGGCAAAGGGGGCAGG + Intronic
968617234 4:1583111-1583133 TGGGAGATGGCAAAGGGAGATGG + Intergenic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
968829522 4:2925664-2925686 AGGGAGAAGGCAGGGAGGGAGGG + Intronic
968857509 4:3138155-3138177 AAGGGGAAGGGAAAAGGGGAAGG - Intronic
969089832 4:4685422-4685444 AGGGAGAGGGCAAAGGAGGATGG + Intergenic
969163381 4:5281099-5281121 AGAGAGAGGGCAAAGGGGGAAGG + Intronic
969397674 4:6933272-6933294 AAGGGGAAGGGGAAGGGGGAGGG - Intronic
969502825 4:7563990-7564012 ATGTGGAAAGCAAAGGAGGAAGG - Intronic
969727217 4:8927675-8927697 CTGCAGATGGCAAAGGGGGAAGG - Intergenic
969954804 4:10877995-10878017 AAGGAGGAGGAAAAGGAGGAAGG - Intergenic
970218840 4:13786497-13786519 ATGAAGAAGGAAAAAAGGGAGGG - Intergenic
970326591 4:14931308-14931330 ATGGAGAAGGAAATGGGGGGTGG - Intergenic
970338751 4:15082489-15082511 GAGGAGAAGGCAAAGGAGAAAGG + Intergenic
970645303 4:18113844-18113866 AAGGGGAAGGGAAAGGGGAAGGG + Intergenic
970768080 4:19575609-19575631 ATTGAAAAGGGAAAAGGGGAAGG + Intergenic
970867245 4:20773288-20773310 TAGGAGAAGGCAAAGGAGGGTGG - Intronic
971160419 4:24128059-24128081 ATGGAGGATGCTAAGGGGAATGG - Intergenic
971305117 4:25473295-25473317 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
971305120 4:25473301-25473323 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
971636645 4:29068717-29068739 AGGGAGAAGGGGAAAGGGGAGGG - Intergenic
971642517 4:29153899-29153921 AAGGAGGGAGCAAAGGGGGAGGG + Intergenic
971688575 4:29803461-29803483 AGAGAGAATGCAAAGAGGGAAGG + Intergenic
971748383 4:30613950-30613972 ATGGATAAGGCAAAAGGCCAGGG - Intergenic
972430092 4:38972759-38972781 ATGCAGGAGGCAAATGGTGAAGG - Intronic
972557967 4:40199427-40199449 ATGGACAAGGCACAGGGGTTGGG + Intronic
972977365 4:44652989-44653011 ATGGAGAGTGCAAAGGGGAGAGG + Intronic
973263175 4:48185791-48185813 AGGGAGATGGGAGAGGGGGAGGG - Intronic
973263187 4:48185816-48185838 AGGGAGATGGGAGAGGGGGAGGG - Intronic
973606533 4:52592868-52592890 AGGAAGAGAGCAAAGGGGGAGGG - Exonic
973966670 4:56170088-56170110 ATGGAGGAGGAAGAGGAGGAAGG - Intergenic
974214935 4:58832949-58832971 AAGGGGAAGGCGAAGGGGAAGGG - Intergenic
974214948 4:58832979-58833001 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
974214953 4:58832991-58833013 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974592546 4:63972577-63972599 ATGAAGAAAGCAAAGGTGGCTGG - Intergenic
974753777 4:66176796-66176818 AAGGAGAAGGGAAAGGGAGAGGG + Intergenic
975191370 4:71466867-71466889 AGCCAGAAGGCAAAGGGGCATGG - Intronic
975360210 4:73460925-73460947 AAGGAGGAGGGGAAGGGGGAGGG - Intergenic
975362362 4:73485704-73485726 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
975442019 4:74421779-74421801 AAGGAGAAGGAAAAGAGGAAGGG + Intergenic
975749129 4:77504997-77505019 AAGGAGAAGGCCAGAGGGGAAGG + Intergenic
975757006 4:77580830-77580852 AGGGAGAGGGGAAAGGAGGAGGG - Intronic
976096419 4:81513081-81513103 AAGAGGAAGGGAAAGGGGGAGGG - Intronic
976098240 4:81532376-81532398 ATGGAGGAGGCAGAGGTGGGAGG - Intronic
976589472 4:86834833-86834855 TGGTAGAAGGCAAAGGGGAAGGG + Intronic
976779563 4:88743938-88743960 AAGGAGAAGACAAAATGGGATGG + Intronic
976913741 4:90343371-90343393 ATGGTGGAGGCCAAGGTGGATGG + Intronic
976982126 4:91244186-91244208 AAGGGGAAGGAAAAGTGGGAAGG + Intronic
977627145 4:99199906-99199928 TGGTAGAAGGCAAAGTGGGAGGG + Intergenic
977728070 4:100320798-100320820 AAGGAGAAGGGAAGGGAGGAAGG - Intergenic
978644683 4:110915857-110915879 ATGGAGCAGGGTAAGGGAGATGG + Intergenic
978802412 4:112767989-112768011 AAGGAGAAAACAAAGGGAGAAGG + Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979367020 4:119837429-119837451 AAGGAGAAGGGGATGGGGGAGGG + Intergenic
980019328 4:127689733-127689755 AAGGGGAAAGGAAAGGGGGAGGG + Intronic
980113636 4:128658694-128658716 AGGGAGAAGGAAAAGGGGAAGGG + Intergenic
981120131 4:141040025-141040047 ATGGAGAAGGAAAAAGGAGCGGG - Intronic
981143616 4:141300141-141300163 ATGGACAAGGCAGAGGGGAAAGG + Intergenic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
981438126 4:144750128-144750150 TTGGGGAAGGGAGAGGGGGAAGG + Intergenic
981936476 4:150245509-150245531 ATGGGGTAGGGGAAGGGGGAGGG - Intronic
981950707 4:150403549-150403571 AAGGAGAAGGGAAAGGAGAAGGG - Intronic
981954597 4:150454724-150454746 AGGGAGAAGGCTGAGGGGGAAGG - Intronic
982305192 4:153923294-153923316 CTGGAATAGGCAAAGAGGGATGG - Intergenic
982397563 4:154928506-154928528 ATGGAGAAGGAAATGAGGGAAGG + Intergenic
982729835 4:158944237-158944259 GAGGGGAAGGCAAAGAGGGATGG - Intronic
983014438 4:162594274-162594296 ATGGAGAAGGCCAGGTGTGATGG + Intergenic
983059737 4:163144230-163144252 GTGGGGAAGGCAAAGGGAGGTGG + Intronic
983170623 4:164531719-164531741 ATGAAGAAGGCAAAAGAGAAAGG - Intergenic
983611794 4:169654238-169654260 AGGAAGAAGGGAAAGGAGGAGGG - Intronic
984070309 4:175103264-175103286 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
984475658 4:180231143-180231165 ATTCAGAAGGCAAAGGAGAAGGG + Intergenic
984725159 4:183013444-183013466 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
984911236 4:184676393-184676415 AGGGAGAAGGGAAGGGGGAAGGG - Intronic
984911248 4:184676424-184676446 AGGGAGAAGGGAAGGGGGAAGGG - Intronic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
985136132 4:186787915-186787937 AAGGACAAGCCAAAGGCGGATGG - Intergenic
985531065 5:434103-434125 CTGGAGTAGGCACTGGGGGACGG - Exonic
985690136 5:1304316-1304338 AAGGAGAAGGAGAAGGGAGAAGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986435845 5:7730038-7730060 ATGGAGACTCCAAAGGGGGAAGG - Intronic
986514548 5:8547515-8547537 ATGGAGGAAGCACATGGGGAAGG + Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986723453 5:10577098-10577120 AAGGGGAAGGGAAAGGGGAAGGG - Intronic
986741207 5:10707028-10707050 ATGGAGAAGTCAGAGGGGACTGG + Intronic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987769935 5:22288933-22288955 ATGAAGAAGGCTAAGGCGAAAGG + Intronic
988458549 5:31411048-31411070 AAGGAGAAGGTAAATGGGCATGG - Intronic
988630497 5:32925834-32925856 GTGGAGAATGCAAAGATGGAGGG + Intergenic
988796089 5:34655153-34655175 AGGGAGGAAGGAAAGGGGGATGG + Intergenic
988832654 5:35002925-35002947 ATGGAGCAGGGAAACTGGGAAGG + Intronic
988942435 5:36159741-36159763 GTGGAGAAGACAGAGGTGGAAGG - Intronic
989214363 5:38888599-38888621 ATGGAGAAAGAAAAGAGGGAAGG - Intronic
989345477 5:40424773-40424795 GTGGAGAAGGGAAAGAGAGAGGG - Intergenic
990774269 5:59287335-59287357 AAGGAGAAGGAAGAGTGGGAAGG + Intronic
991036402 5:62131940-62131962 AGGGAGCAGGAGAAGGGGGATGG - Intergenic
991100665 5:62789055-62789077 ATGAAGAAGTCAAAGGAGGTAGG + Intergenic
991217612 5:64173628-64173650 AGGGAAAAGGGAAAGGGGAAAGG - Intronic
991646662 5:68807949-68807971 AAGGGGAAGGGAAAAGGGGAAGG + Intergenic
992740809 5:79771612-79771634 AAGGAGAAGGGATGGGGGGATGG + Intronic
993346923 5:86795719-86795741 AAGGAGAAAACAAAGGAGGAAGG + Intergenic
993410896 5:87572248-87572270 ATGGCGAAGGCACAGATGGAAGG - Intergenic
993503275 5:88684912-88684934 AGAGAGAAGTAAAAGGGGGATGG + Intergenic
993622390 5:90184029-90184051 AGGAGGAAGGCAAAGGGGCAAGG + Intergenic
993630607 5:90281822-90281844 ATGAAGAAGGCACATGGGGGTGG - Intergenic
993926611 5:93873447-93873469 AAGGAAAAGGAAAAGGGGAAAGG + Intronic
994198860 5:96949926-96949948 ATGGAAAAGGAAAGGAGGGAGGG - Intronic
994450568 5:99936406-99936428 ATGGAGAAGGTAAACCAGGATGG + Intergenic
995402959 5:111762098-111762120 ATGGGAAAGGAAAAGAGGGAAGG + Intronic
995424582 5:112005910-112005932 ATGGAGAGAGAAAAGAGGGAAGG + Intergenic
995614598 5:113946820-113946842 ATTGAGAAGCCAAAGGAGAAAGG - Intergenic
995756677 5:115512705-115512727 ACGTAGAAGGCAAAGTGGGCGGG + Intergenic
995882448 5:116858269-116858291 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
996366334 5:122705187-122705209 AAGAAGAAAACAAAGGGGGATGG - Intergenic
996367776 5:122721206-122721228 ATGGAGAAGGAAAGGAAGGAAGG + Intergenic
996792888 5:127312164-127312186 GGAGAGAAGGCAAAGAGGGATGG + Intronic
997050523 5:130374344-130374366 ATGGAGTCAGCAAAGGGAGATGG - Intergenic
997313365 5:132909871-132909893 AAGGGGAAGGTAAAGAGGGAAGG + Intronic
997386810 5:133480141-133480163 ATGCAGTAGGCAGATGGGGAGGG + Intronic
997465699 5:134086695-134086717 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
997671046 5:135672226-135672248 ATGGAGAATGTAAAGGGAGAGGG + Intergenic
998042597 5:138961898-138961920 TTGGAGAAGCTAAAAGGGGAAGG - Intronic
998288869 5:140892897-140892919 AGGGTGAAGGAAAAGGAGGATGG - Intronic
998893264 5:146769191-146769213 ATCGAGAAGGGCAAGGGAGAAGG - Intronic
999751713 5:154632358-154632380 AGGGAGAAGGGAAAGAAGGAAGG - Intergenic
999829440 5:155304758-155304780 TTGCAGAAGGCTAAGGGGCAGGG - Intergenic
1000148641 5:158478237-158478259 GTGGAGGAGGCACAAGGGGATGG + Intergenic
1000201428 5:159014801-159014823 ATGGAGGAAGGAAAGGGGCAGGG - Intronic
1000828766 5:166077898-166077920 ATGCAGGAGGCAAAGAGAGAGGG + Intergenic
1001115809 5:168938594-168938616 AAGGATAAGGCAGAAGGGGAAGG - Intronic
1001120723 5:168977857-168977879 ATGGAAAAGGTGAAGAGGGAGGG + Intronic
1001276524 5:170355327-170355349 AAGGAGAAAGCAAAGGGGTTAGG + Intronic
1001964466 5:175900699-175900721 ATCGAGAGGGCGAAGGGGCATGG - Intergenic
1002430724 5:179202418-179202440 ATGGAGAAGGAAGAAGGGTAGGG - Intronic
1002605670 5:180381457-180381479 CTGGGAAAGGCAAAGGGGCAGGG - Intergenic
1002703559 5:181144571-181144593 CTGCAGAAGGCAAAGGGGGTAGG - Intergenic
1002742615 5:181444722-181444744 ATGAAGAAAGGAGAGGGGGATGG + Intergenic
1002742623 5:181444747-181444769 AGGGAGAAAGGAGAGGGGGATGG + Intergenic
1003004701 6:2369963-2369985 GTGGAGGAGGCAGAGGGGGCAGG - Intergenic
1003183222 6:3809594-3809616 ACTCAGAAGGCAGAGGGGGAAGG - Intergenic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1004131175 6:12921531-12921553 AGGGAGGAGGGAAAGGAGGAAGG + Intronic
1004138783 6:12994631-12994653 ATGGAGGAGGAAAAGGGGAATGG + Intronic
1004562183 6:16761236-16761258 GGGGAGAAGGGAATGGGGGAGGG + Intronic
1004603518 6:17173429-17173451 AGGGAGAAGGGGAAGGGGCAGGG + Intergenic
1004629499 6:17407845-17407867 ATGAAGAAGCAAAAGGGGGCTGG + Intronic
1004643654 6:17539334-17539356 CTGGAGGAGGCAGAGGAGGAGGG - Exonic
1004751297 6:18565444-18565466 ATGGAGGAAGAAAAGGAGGAAGG - Intergenic
1004924237 6:20402990-20403012 ATGGAGAAGGGGGTGGGGGAGGG + Intronic
1005502245 6:26439092-26439114 GTTGGGAAGGAAAAGGGGGAGGG + Intergenic
1005819879 6:29588951-29588973 GTGAAGAAGGCAGAGGGGCAGGG - Exonic
1005914902 6:30343389-30343411 AGGGAAATGGCAAAGGGTGAGGG - Exonic
1005998372 6:30946120-30946142 ATGGAGCAGGCAGGGGGGTAGGG + Intronic
1006215270 6:32436724-32436746 GTGCAGAAGGAAAAGGGGGTAGG + Intergenic
1006373777 6:33660495-33660517 AGGGAGAAGGCATTGGGGCAGGG - Intronic
1006562976 6:34929777-34929799 AAGGAAAAGGGGAAGGGGGAGGG - Intronic
1006567766 6:34974211-34974233 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1006709679 6:36056949-36056971 ATGGAGAAGGTAAAAGGAAATGG + Intronic
1006761285 6:36463881-36463903 ATTGAGAGGGAAAAAGGGGAAGG + Intronic
1006805104 6:36783005-36783027 GTGGAGAAGGCGAAAGGAGATGG + Intronic
1006947805 6:37797062-37797084 AGGGAGAAGGCAAAAGGGTTTGG - Intergenic
1007116183 6:39344985-39345007 ATGGAAAAGGGGATGGGGGAGGG - Intronic
1007377464 6:41466632-41466654 AGGATGAAGGAAAAGGGGGAAGG + Intergenic
1007591029 6:43021085-43021107 AGGGGATAGGCAAAGGGGGAGGG - Exonic
1008111245 6:47497356-47497378 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1008234740 6:49030532-49030554 ATGCAGAAGGGACAGGAGGAAGG + Intergenic
1008482684 6:52002689-52002711 AAGGAGAAGACAAGGAGGGAAGG + Intronic
1009567306 6:65325205-65325227 ATGAAGAAGGGAGAGGAGGAGGG - Intronic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1010108761 6:72199585-72199607 CTGGAGAGGGCAGAGGTGGAGGG + Intronic
1010434249 6:75811791-75811813 AAGGAAAAGAGAAAGGGGGAGGG + Intronic
1010507244 6:76675615-76675637 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1010514236 6:76753596-76753618 AGGGAGAAGGAAGAGTGGGAAGG + Intergenic
1010780407 6:79939630-79939652 ATTGAGAAGGCTGAGGGAGAAGG - Intronic
1010815890 6:80357497-80357519 ATAGAGAAGGCAAAGAAGGGTGG + Intergenic
1010908006 6:81516842-81516864 ATAGAGAAGGAAAAGGAGAATGG + Intronic
1012334962 6:98044182-98044204 ATGAAAAAGAGAAAGGGGGAGGG + Intergenic
1013251871 6:108342279-108342301 ACGGAGAAGGCATCAGGGGAGGG + Intronic
1013348381 6:109284195-109284217 GAGGAGAATGCAAAGGGAGATGG + Intergenic
1014294200 6:119598407-119598429 AAGGAGAAGGAGAAGGGGAATGG + Intergenic
1014573157 6:123036619-123036641 AAGGTGAAGGGAAAAGGGGATGG - Intronic
1014684380 6:124477738-124477760 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1015113392 6:129619346-129619368 AGGGGGAGGGAAAAGGGGGAGGG + Intronic
1015113398 6:129619359-129619381 AGGGGGAGGGAAAAGGGGGAGGG + Intronic
1015113404 6:129619371-129619393 AAGGGGGAGGGAAAGGGGGAGGG + Intronic
1015113410 6:129619383-129619405 AAGGGGGAGGGAAAGGGGGAGGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015408743 6:132867726-132867748 AGGCAGAAGGCAAAGTGGAAGGG + Intergenic
1015672715 6:135708520-135708542 ATGGGGCAGGGAGAGGGGGATGG + Intergenic
1015997885 6:139013621-139013643 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1016029640 6:139324014-139324036 ATGGCGATGACAATGGGGGAGGG - Intergenic
1016430296 6:143977092-143977114 ATGGAGAAGGCTAAGTGTGTTGG - Intronic
1016546433 6:145229289-145229311 GAGAAGAAGGCAAAGGGGAAGGG - Intergenic
1016595730 6:145797680-145797702 AGGGAGAAGGGAAAGGGAGAGGG + Exonic
1016632362 6:146248106-146248128 AGGGAGGAAGCAAAGGAGGAAGG - Intronic
1016998633 6:149979236-149979258 AGGGAGAAGGGAGAGGAGGATGG - Intergenic
1016999757 6:149988574-149988596 AGGGAGAAGGGAGAGGAGGATGG + Intergenic
1017006859 6:150033700-150033722 AGGGAGAAGGGAGAGGAGGATGG - Intergenic
1017300556 6:152852723-152852745 ATGGAGAAGGGAAGAAGGGAGGG - Intergenic
1017339565 6:153305195-153305217 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1017339568 6:153305201-153305223 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017339582 6:153305249-153305271 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017665256 6:156713746-156713768 GAGGAGGAGGCAAAGGAGGAGGG + Intergenic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018724050 6:166597042-166597064 ATGGAGAAAGGACACGGGGAGGG + Intronic
1019159077 6:170057617-170057639 AGGGGGAAGGGAAAGGGGGAGGG - Intergenic
1019159101 6:170057664-170057686 AGGGGGAAGGGAAAGGGGGAGGG - Intergenic
1019247750 6:170720461-170720483 ATGAAGAAAGGAGAGGGGGATGG + Intergenic
1019247758 6:170720486-170720508 AGGGAGAAAGGAGAGGGGGATGG + Intergenic
1020258554 7:6516920-6516942 GTGTACAAGGCAAAGGGGCAGGG - Intronic
1020496677 7:8861661-8861683 ATGGAGAATGCAAGGAGGCAGGG + Intergenic
1020976739 7:15015746-15015768 AAGGAGAATGTCAAGGGGGAGGG + Intergenic
1021642111 7:22748212-22748234 ATGGAGAAATAAAAGGTGGATGG + Intergenic
1021939906 7:25669088-25669110 AGGAAGGAGGCAAAGGGGGTTGG - Intergenic
1022090872 7:27107629-27107651 GTGGAGAAGGTAAAGGGTGCAGG + Exonic
1022274416 7:28841799-28841821 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1022274426 7:28841823-28841845 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1022357055 7:29625792-29625814 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1022806686 7:33829579-33829601 ATGGAGAAGGAAAAAGGAGAAGG - Intergenic
1023158536 7:37275662-37275684 ATTGAGAAGGCACAGGCAGAAGG - Intronic
1023250706 7:38257626-38257648 ATGGAGAAGACAATGGGGCTGGG + Intergenic
1023911138 7:44557668-44557690 AAGGGGAAGGGAAAGGGGAAGGG + Intergenic
1024161907 7:46684707-46684729 ATGGAGAAGAGAAAGAGGAAAGG - Intronic
1024298335 7:47864095-47864117 CTGGAGAAGGCAAGGTGGGCAGG + Intronic
1024737683 7:52323360-52323382 AGGGAGAAGGGAAAGGGGAAGGG - Intergenic
1024737698 7:52323400-52323422 AGGGAGAAGGGAAAGGGGAAGGG - Intergenic
1024737707 7:52323424-52323446 ATGGGGAAGGGAAGGGGGAAGGG - Intergenic
1025108988 7:56196896-56196918 GAGGGGAAGGGAAAGGGGGAGGG - Intergenic
1025229503 7:57192126-57192148 ATGGAGAAGGGAATGTGGGTGGG - Intergenic
1026078891 7:67199575-67199597 ATGCTGAAGGCAAATGTGGAAGG - Intronic
1026241727 7:68581429-68581451 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1026284893 7:68954632-68954654 ATGGAGAGGGGAAAGAGAGAGGG + Intergenic
1026355486 7:69553564-69553586 CTGGAGAAGGGAAGTGGGGAAGG - Intergenic
1026360787 7:69599464-69599486 GAGGAGAAAGAAAAGGGGGAAGG - Exonic
1026697929 7:72612368-72612390 ATGCTGAAGGCAAATGTGGAAGG + Intronic
1027298912 7:76809394-76809416 ATGGACATGACAAAGAGGGAGGG + Intergenic
1027564948 7:79780072-79780094 GTGGAGTAGGGGAAGGGGGAAGG - Intergenic
1027978296 7:85186138-85186160 TGGGAGAAGGGAAAGGGGCAAGG - Intronic
1028308025 7:89290649-89290671 AAGGAGAGGTAAAAGGGGGAAGG + Intronic
1028428779 7:90722183-90722205 AGGGAAAAGGGAAAGGGGAAAGG - Intronic
1028975139 7:96904418-96904440 CTGGAGAAAGCAAAGGGAGAAGG + Intergenic
1029361119 7:100089214-100089236 CTGGAGATGGCAGTGGGGGACGG - Intronic
1029548292 7:101222784-101222806 ATGGAGGAGGAAGCGGGGGATGG + Intronic
1029575549 7:101401146-101401168 CTGGAGAAGGCATAGGGGTAAGG + Intronic
1029826206 7:103197634-103197656 ATGGAGCAGGCAGAGGAGGCAGG + Intergenic
1030216655 7:107050144-107050166 AGTCAGAAGGGAAAGGGGGAGGG + Intronic
1030301306 7:107977113-107977135 ATGGAGAAGGAAGGGAGGGAGGG - Intronic
1030606070 7:111640429-111640451 ATGGAGTAAGCATAGAGGGAGGG - Intergenic
1031425772 7:121603815-121603837 ATAAAGAAGGCTAAGGGGGATGG - Intergenic
1031428930 7:121641842-121641864 ATGGAGAAGAGAATGGGAGAAGG - Intergenic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1031799461 7:126223912-126223934 ATGGTGCAGGCAGATGGGGAGGG - Intergenic
1031865992 7:127039630-127039652 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1031955402 7:127937470-127937492 GAGGAGAAGGGACAGGGGGAGGG - Intronic
1031994727 7:128222427-128222449 GTGGAGGAGGCATCGGGGGATGG + Intergenic
1032003549 7:128282316-128282338 ATAGAGAAGGGAGAGAGGGAGGG + Intergenic
1032179694 7:129664118-129664140 GTGGAGACGGGAAAGGGGGAGGG + Intronic
1032464157 7:132133408-132133430 ATGCAGGAGGCATAGAGGGAAGG + Intronic
1032506663 7:132440374-132440396 CTGGAGAAGGCAGACGGGGCTGG - Intronic
1032582767 7:133118413-133118435 ATGGAGAAGCCCATGTGGGAAGG + Intergenic
1032595127 7:133232364-133232386 CAGGAAAAGGCAAAGGGGCAGGG - Intergenic
1032816980 7:135485696-135485718 ATGGAGAAGGGAAGGGGGAAGGG + Intronic
1033034006 7:137854088-137854110 ATGAAGAAGGAAAAGGGCAAAGG - Intergenic
1033039467 7:137905069-137905091 AGGGAGGGGGCAAAGAGGGAAGG - Intronic
1033088770 7:138366164-138366186 ATGGAGAAGGAAGTGGGGAAAGG - Intergenic
1033215093 7:139487651-139487673 AAGGGGAAGACAAAGGGGAAGGG + Intergenic
1033804324 7:144937416-144937438 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1033804342 7:144937470-144937492 AAGGAGAAGGGAAAGGAGAAAGG - Intergenic
1033804365 7:144937531-144937553 AGGGGGAAGGGGAAGGGGGAAGG - Intergenic
1034354418 7:150441860-150441882 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1034417017 7:150970607-150970629 CTAGAGAAGGGAAAGGTGGAGGG + Intronic
1034500335 7:151446707-151446729 ATGGAGAAGGAAGTGGGGAAGGG - Intergenic
1034817297 7:154183591-154183613 ATGGAGGAAGGAAAGGAGGAGGG - Intronic
1034873087 7:154700983-154701005 ATGGTGATGGCAAGGGTGGAGGG - Intronic
1035100185 7:156389826-156389848 AGGAAGAAGGCTGAGGGGGAGGG - Intergenic
1035500345 8:87328-87350 AGGGAGAAAGGAGAGGGGGATGG - Intergenic
1035500378 8:87450-87472 AGGGAGAAAGGAGAGGGGGATGG - Intergenic
1035500386 8:87475-87497 ATGAAGAAAGGAGAGGGGGATGG - Intergenic
1035797858 8:2375931-2375953 ATAGAGAGGTCAGAGGGGGATGG + Intergenic
1035856958 8:2985966-2985988 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1036221400 8:6923912-6923934 AGGGACAAGGCAAAGAGAGAGGG + Intergenic
1036295213 8:7529236-7529258 AAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1036327357 8:7791782-7791804 AAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1036483146 8:9154873-9154895 AGGGAGACGGGAGAGGGGGAGGG + Intronic
1036661897 8:10714374-10714396 AGGGAGAAAGGAAAAGGGGAGGG - Intergenic
1036698932 8:10998442-10998464 ATGGAGAAGGGAGAGTGAGAAGG - Intronic
1036718041 8:11144894-11144916 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1037008113 8:13806869-13806891 AGGGAGAAAGCAAAGGAGGGAGG - Intergenic
1037308509 8:17530310-17530332 AGGGAGAGGGCAAGGGGGCAAGG + Intronic
1038197913 8:25385010-25385032 GTGGAGCAGGTAAAGGGGGTAGG + Intronic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1038497412 8:28013361-28013383 ATGGGGAAGAGAGAGGGGGAGGG + Intergenic
1038547928 8:28440345-28440367 ATGGAGGAGGCCGAGGTGGAAGG - Intronic
1038598519 8:28913424-28913446 ATGGTGAAGGCGAGGTGGGAGGG - Intronic
1038675104 8:29616162-29616184 AAGGGGAAGGGAAAGGGGAAGGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039557046 8:38484067-38484089 ATAAGGAAGGCAAAGGGGGCAGG - Intergenic
1039920658 8:41892151-41892173 ATGGAGGGGGGAAAGTGGGATGG - Intronic
1041000602 8:53446669-53446691 ATGGAGTAGGGGGAGGGGGAGGG + Intergenic
1041067045 8:54092093-54092115 AAGGAGAAGGAAGAGGGGGAGGG + Intronic
1041248710 8:55914068-55914090 ATGGAGAATGGAGAGGTGGAGGG + Intronic
1041284832 8:56249545-56249567 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1041300639 8:56407776-56407798 GAGGAGGAGGCAGAGGGGGAAGG + Intergenic
1041632504 8:60103936-60103958 ATGGAAGAGGCAAGGCGGGATGG - Intergenic
1041746166 8:61211386-61211408 GAGGAGGAGGTAAAGGGGGAAGG - Intronic
1042274758 8:66992703-66992725 ATAGAGAAGGCAATGGGTTACGG - Intronic
1042382439 8:68133092-68133114 TGGGAGAAGGCAGAAGGGGAAGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043938288 8:86167979-86168001 AAGGGGAAGGGGAAGGGGGAGGG + Intergenic
1043958717 8:86390700-86390722 AGGGAGACGGGAGAGGGGGAGGG + Intronic
1044492367 8:92834608-92834630 GTGGAGAAGGGACAGGTGGAGGG - Intergenic
1044806195 8:96010717-96010739 ATGGGGAAGGCAACTGGGCAGGG + Intergenic
1045487110 8:102640383-102640405 AGGGAGAAAGGAAAGAGGGAAGG + Intergenic
1045944988 8:107785425-107785447 ATAGACAAGGCAAAGAGAGAGGG + Intergenic
1045984148 8:108228530-108228552 AGAGAGAAGGCATAGGGGGTCGG - Intronic
1046015606 8:108601138-108601160 AAGGAGGAGGGAGAGGGGGAGGG + Intergenic
1046522505 8:115343447-115343469 TTGCAGAAGGAAAATGGGGAAGG - Intergenic
1046592217 8:116220464-116220486 AAGAAGAAGGGAAAGAGGGAAGG - Intergenic
1046698590 8:117373669-117373691 GAGGAGAAGAGAAAGGGGGAGGG + Intergenic
1047303632 8:123635849-123635871 ATGGGGAATGCATATGGGGAAGG - Intergenic
1047474473 8:125213550-125213572 AGGGGGAGGGGAAAGGGGGAGGG - Intronic
1047521632 8:125599488-125599510 AGGTGGAAGGCCAAGGGGGAAGG - Intergenic
1047523724 8:125615286-125615308 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1047701395 8:127452702-127452724 AAGGGGAAGGGAGAGGGGGAAGG + Intergenic
1047778993 8:128096691-128096713 ATGAACAAGGCAAAGGGGCCTGG - Intergenic
1047802349 8:128323112-128323134 ATGGCCAGGGCAAAGGGGCAGGG + Intergenic
1047927832 8:129698318-129698340 ATGGAGGAGGCAAGGGGAGAAGG + Intergenic
1047996553 8:130342191-130342213 ATGAAGAAGGCAAATTGGCAAGG + Intronic
1048285189 8:133136104-133136126 ATGCTGGAGGCAAATGGGGAAGG + Intergenic
1048547304 8:135399023-135399045 ATGGAGAAGGCAACAGGAAAGGG - Intergenic
1048900710 8:139034836-139034858 ATGGAGCAGGCCATGGGAGAGGG - Intergenic
1049116746 8:140695277-140695299 CTGGAAGAGGCAAAGTGGGAAGG - Intronic
1049280842 8:141743387-141743409 CTGGAGAAGGGTAATGGGGAAGG + Intergenic
1049280863 8:141743490-141743512 CTGGAGAAGGCTGATGGGGAAGG + Intergenic
1049679342 8:143910711-143910733 AAGGAGCTGGCAAAGGGGGCTGG - Intergenic
1050358550 9:4805396-4805418 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1050490862 9:6186557-6186579 AGGGAGAAGGTGAAGGGGAAGGG + Intergenic
1050904302 9:10984816-10984838 GTGTGGAAGGCAAATGGGGATGG - Intergenic
1051552956 9:18350485-18350507 ATTGAGAAGGGAAAGGAGCAAGG + Intergenic
1051850379 9:21499961-21499983 ATTAAGAAGGCAAAGGGCAAAGG - Intergenic
1051886572 9:21899396-21899418 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1052018938 9:23502924-23502946 ATAGAGAGAGCAAAGGGGAAGGG + Intergenic
1052141092 9:24984929-24984951 ATGGAGAAGGGAAAGGAGAAAGG + Intergenic
1052149115 9:25090811-25090833 GTGGTTAAAGCAAAGGGGGAGGG + Intergenic
1052352661 9:27473314-27473336 CTGAGGGAGGCAAAGGGGGAGGG + Intronic
1052475676 9:28956582-28956604 AGGGAGGAAGGAAAGGGGGAGGG - Intergenic
1052976789 9:34417051-34417073 AAGGAGAAGGGGAAGGGGAAAGG - Intronic
1053079170 9:35160353-35160375 ATGCAGATGGCAAAGGGTGAAGG + Intergenic
1053244781 9:36525787-36525809 ATTGAAAAGGAAAAGGGGGGCGG + Intergenic
1053293593 9:36898102-36898124 ATGGAGGATGGAAAGAGGGAAGG + Intronic
1053330892 9:37206287-37206309 AGGGAGAGGGGGAAGGGGGAAGG - Intronic
1053587189 9:39471439-39471461 ATGAAGAAGGCAAAGTGATATGG + Intergenic
1054579116 9:66893794-66893816 ATGAAGAAGGCAAAGTGATATGG - Intronic
1054879914 9:70134323-70134345 ATGGAGAAGGAAGTGGGGGATGG - Intronic
1056547796 9:87627480-87627502 AGGGAGCAAGCAAAGGGGGTGGG - Intronic
1056587907 9:87940219-87940241 ATGGAGAAGGGAAAGAGAAATGG + Intergenic
1056608960 9:88112726-88112748 ATGGAGAAGGGAAAGAGAAATGG - Intergenic
1056667202 9:88590231-88590253 AGAGAGTAGGCAAAGAGGGACGG - Intergenic
1056999510 9:91494464-91494486 ATGGAAAAGTCAAAAGGAGAGGG - Intergenic
1057094736 9:92295453-92295475 AGAGAGAGGGGAAAGGGGGAAGG + Intergenic
1057374187 9:94503689-94503711 ATAGGCAAGGAAAAGGGGGAGGG - Intergenic
1057467751 9:95331108-95331130 CTGCAGACAGCAAAGGGGGAAGG + Intergenic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1057840964 9:98485286-98485308 ATGGGGTAGGAAAATGGGGAGGG + Intronic
1058007498 9:99933654-99933676 ATGTAGAAGGCCATGTGGGATGG - Intronic
1058566609 9:106292365-106292387 AGGGAGGAAGCAAAGGAGGAAGG - Intergenic
1058696595 9:107564275-107564297 ATGAAAAAGGAAAAGAGGGAAGG + Intergenic
1058721924 9:107772287-107772309 AGAGAGAGAGCAAAGGGGGAAGG + Intergenic
1058817559 9:108699030-108699052 AAGGGGAAGGCAAAGGGGAAGGG + Intergenic
1058817564 9:108699042-108699064 AAGGGGAAGGGAAAGGGGGATGG + Intergenic
1058936878 9:109777990-109778012 ATGGAGAAGGAAAAGGGCCTGGG - Intronic
1059254209 9:112913971-112913993 AGGGAGAAGGAAAAGGGAGGAGG - Intergenic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1059819058 9:117951427-117951449 CTGGAGGAGACAAAGGGGGAGGG - Intergenic
1061267027 9:129512159-129512181 TTGGAGGAGGCACAGGAGGAGGG + Intergenic
1061283523 9:129610212-129610234 AGGGGGAGGGGAAAGGGGGAGGG + Intronic
1061500355 9:130998198-130998220 ATGGGGAGCCCAAAGGGGGAAGG - Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062564527 9:137158269-137158291 AGGGAGAAGGAGCAGGGGGAAGG + Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062707518 9:137953624-137953646 TTGGAGGAGGCACCGGGGGAGGG + Intronic
1203608521 Un_KI270748v1:75941-75963 ATGAAGAAAGGAGAGGGGGATGG + Intergenic
1203608529 Un_KI270748v1:75966-75988 AGGGAGAAAGGAGAGGGGGATGG + Intergenic
1203635032 Un_KI270750v1:102351-102373 ATGGAGTAGAGAAAGAGGGAAGG + Intergenic
1185726550 X:2426482-2426504 ATGAAGAAAGGAAAGAGGGAGGG - Intronic
1185978548 X:4749396-4749418 AAGGAAAAGGCAAAATGGGAGGG - Intergenic
1186471165 X:9823094-9823116 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471169 X:9823113-9823135 AGGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471172 X:9823126-9823148 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1187101921 X:16201964-16201986 AAGGAGAAGGCAGAGGAGAATGG + Intergenic
1187576195 X:20559078-20559100 AAGGAGAAGGGAAGGGGGAAAGG - Intergenic
1187843793 X:23515444-23515466 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188206993 X:27372472-27372494 AGGGAGAAGGAAAAGGGGTGTGG - Intergenic
1188242033 X:27804616-27804638 ATGGAGAAGCCAAACGGGAGAGG - Intergenic
1189117022 X:38353386-38353408 GTGGGGAAGGGAAAGGGGAAGGG + Intronic
1189233975 X:39473736-39473758 TTGGAGATGGAAAAGGGGGAGGG + Intergenic
1189551096 X:42094599-42094621 CTGCAGATGGCAAACGGGGAAGG + Intergenic
1189684398 X:43548814-43548836 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1189684401 X:43548820-43548842 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1190171006 X:48111633-48111655 ATGGAGAAGGAGCAGGGGCAGGG + Intergenic
1190298192 X:49040744-49040766 GTGGGGAAGGGAAAGGGGGATGG - Intronic
1190561953 X:51694986-51695008 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1190712219 X:53079194-53079216 ATAAAGAAGGGAAAGGGGGATGG - Exonic
1191019442 X:55843427-55843449 ATGGAGAAGGGCATGGGGAAAGG - Intergenic
1191671331 X:63751315-63751337 AGAGAGAAGGCAGAGGAGGAAGG + Intronic
1191714699 X:64186227-64186249 AGGGAGAGGGGAAAGAGGGAGGG + Exonic
1191740108 X:64427310-64427332 CTGCAGATGGCAAATGGGGAAGG - Intergenic
1191851121 X:65587221-65587243 AAGGGGAAGGGAAAGGGGGCGGG + Intergenic
1191881697 X:65849030-65849052 ATGGACAAGGCAAGTGGGGATGG - Intergenic
1192181960 X:68921812-68921834 ATGTAGCAGGCAAGGGGGAATGG - Intergenic
1192351384 X:70359673-70359695 AGGAAGAAGGCAAAGGTGAAGGG + Intronic
1192448953 X:71230885-71230907 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1192448960 X:71230903-71230925 AAGGGGAAGGAAGAGGGGGAAGG + Intergenic
1192899884 X:75485576-75485598 TTGGGAAAGGCAAAGGAGGATGG + Intronic
1193145900 X:78075208-78075230 AAAGAGAATGAAAAGGGGGAAGG + Intronic
1193974319 X:88098723-88098745 CTGAAGATGGCAAAGGGAGAAGG + Intergenic
1194054146 X:89110078-89110100 ATGGAGGAGCCAAAGGGAGATGG + Intergenic
1194327038 X:92532669-92532691 AAGGAGAAGGCAAAGCAAGATGG + Intronic
1194905798 X:99575250-99575272 CTGAAGATGGCAAAGGGGGAAGG + Intergenic
1195234928 X:102887846-102887868 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1195318451 X:103701148-103701170 AGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1195569759 X:106385139-106385161 TTGGAGAAGACAAAAAGGGAGGG - Intergenic
1195701962 X:107712411-107712433 ATGGAGCTGGGAAAGGGTGATGG + Intergenic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1195973955 X:110505124-110505146 AAGGAAAAGGAAAAGGGGGAAGG - Intergenic
1195973962 X:110505149-110505171 AAGGAGAAGGGAAAGGGAAAGGG - Intergenic
1196772719 X:119310858-119310880 CTGCAGATGGCATAGGGGGAAGG - Intergenic
1197042670 X:121958336-121958358 CTCCAGATGGCAAAGGGGGAAGG - Intergenic
1197118448 X:122861828-122861850 ATGGAGAAAGCAGAGGCTGAAGG - Intergenic
1197160121 X:123313547-123313569 AGTGAGAAGGAAAAGGGGGAAGG - Intronic
1197165272 X:123370245-123370267 AGGGAGAAGGAAAAGTAGGATGG - Intronic
1197187730 X:123607004-123607026 ATTGAGAAGCCAAAGGGTGGTGG + Intronic
1197767504 X:130068729-130068751 ATGGAGGAGGCTTAGGAGGATGG + Intronic
1197823651 X:130566303-130566325 ATGGTGAAGGCAGAGGAGCAAGG - Intergenic
1198788241 X:140314154-140314176 AAGGAGAAGGTAGAGTGGGAAGG + Intergenic
1198846513 X:140918130-140918152 CTGGAGCTGGGAAAGGGGGAAGG + Intergenic
1199127987 X:144147202-144147224 CTGCAGATGGCAAAGGGAGAAGG + Intergenic
1199166268 X:144679203-144679225 CTGAAGATGGCGAAGGGGGAAGG - Intergenic
1199372921 X:147072782-147072804 ATGGAGAAGGAATATGGGGAAGG + Intergenic
1199411447 X:147528553-147528575 GGGGAGAAGGGAGAGGGGGAGGG - Intergenic
1199586785 X:149423354-149423376 ATGGTGCAGGCAAGTGGGGAGGG + Intergenic
1199730139 X:150623637-150623659 CTGAAGAAGGCAGAGGGGGATGG + Intronic
1199862742 X:151816441-151816463 TTGGAGAAGGAATAGGTGGAAGG + Intergenic
1200379711 X:155822203-155822225 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200379719 X:155822227-155822249 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200635756 Y:5651876-5651898 AAGGAGAAGGCAAAGCAAGATGG + Intronic
1201484248 Y:14475359-14475381 AAGGAGTCAGCAAAGGGGGATGG + Intergenic
1201540285 Y:15098940-15098962 AAGGAGTCAGCAAAGGGGGATGG + Intergenic