ID: 902897046

View in Genome Browser
Species Human (GRCh38)
Location 1:19485896-19485918
Sequence GATGCGGAAGGCACCGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902897036_902897046 -1 Left 902897036 1:19485874-19485896 CCCCACAGTCCCCGCGGGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 902897046 1:19485896-19485918 GATGCGGAAGGCACCGCGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 99
902897038_902897046 -2 Left 902897038 1:19485875-19485897 CCCACAGTCCCCGCGGGCGGGGA 0: 1
1: 0
2: 0
3: 6
4: 87
Right 902897046 1:19485896-19485918 GATGCGGAAGGCACCGCGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 99
902897041_902897046 -10 Left 902897041 1:19485883-19485905 CCCCGCGGGCGGGGATGCGGAAG 0: 1
1: 0
2: 0
3: 10
4: 80
Right 902897046 1:19485896-19485918 GATGCGGAAGGCACCGCGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 99
902897039_902897046 -3 Left 902897039 1:19485876-19485898 CCACAGTCCCCGCGGGCGGGGAT 0: 1
1: 0
2: 0
3: 6
4: 78
Right 902897046 1:19485896-19485918 GATGCGGAAGGCACCGCGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 99
902897032_902897046 4 Left 902897032 1:19485869-19485891 CCGCACCCCACAGTCCCCGCGGG 0: 1
1: 0
2: 3
3: 53
4: 298
Right 902897046 1:19485896-19485918 GATGCGGAAGGCACCGCGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902897046 Original CRISPR GATGCGGAAGGCACCGCGGC TGG Intergenic
900463347 1:2811675-2811697 GCTGCTGAAGGCAGCCCGGCCGG + Intergenic
901177776 1:7317160-7317182 GATGGGGAAGGGACCACAGCAGG + Intronic
902897046 1:19485896-19485918 GATGCGGAAGGCACCGCGGCTGG + Intergenic
904426042 1:30423784-30423806 GATGAGGAAGGCAGTGGGGCTGG + Intergenic
908325889 1:63023243-63023265 GATGCAGAAGGAGCAGCGGCTGG - Intergenic
912787873 1:112621527-112621549 CAGGCGTAAGCCACCGCGGCCGG + Intronic
919944160 1:202307660-202307682 GATGGGGATGGGACCGAGGCAGG - Intronic
922237007 1:223729607-223729629 GATGGGGAAGGCACAGGGGCTGG + Intronic
1065731511 10:28713548-28713570 CATGCGTAAGCCACCGCGCCTGG - Intergenic
1071695266 10:87863448-87863470 GAGGCGGACGGGACCGCGCCGGG - Exonic
1075501524 10:122979529-122979551 CAGGCGCAAGCCACCGCGGCTGG - Intronic
1077185922 11:1235322-1235344 GATGCGGAAGGTCCCGTGGGTGG - Exonic
1077236660 11:1485129-1485151 GATGAGGAAGCCACCTTGGCTGG - Intronic
1083854615 11:65386617-65386639 GACGCGGAAGCCACGGCGGGAGG - Exonic
1084208631 11:67610743-67610765 GGTGCGGAGGGGACCGAGGCAGG - Intronic
1088868927 11:113875335-113875357 GCTGCGGAGGGCGCCCCGGCCGG - Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1094042342 12:26131419-26131441 GAGGCAGAAGGCACAGCTGCAGG - Intronic
1099874667 12:88390247-88390269 GATCCTGAAGGCACCACAGCTGG - Intergenic
1101252318 12:102948467-102948489 GAAGCGAAAGGCTCCGGGGCTGG + Intronic
1106175876 13:27330802-27330824 CAGGCGTAAGCCACCGCGGCAGG + Intergenic
1106735810 13:32586824-32586846 GGTGGGGAGGGCCCCGCGGCCGG + Intronic
1113288972 13:108884660-108884682 GATGAGAAAGGCACCGAGGCAGG + Intronic
1113288988 13:108884756-108884778 GATGAGAAAGGCACTGAGGCGGG + Intronic
1113289037 13:108885091-108885113 GATGAGAAAGGCACCAAGGCAGG + Intronic
1114477439 14:23006885-23006907 GATGCGGAGAGCAGAGCGGCCGG + Intronic
1115809055 14:37085826-37085848 CAGGCGTAAGCCACCGCGGCCGG - Intronic
1122582233 14:102777866-102777888 GAGGCGGGAGGCAGCCCGGCTGG - Intronic
1122593471 14:102872082-102872104 GATGCGGCAGGCTCCCAGGCAGG + Intronic
1125031369 15:35079171-35079193 GAGGCGTGAGGCACCGCGCCCGG + Intergenic
1125660841 15:41393565-41393587 CAGGCGTAAGCCACCGCGGCCGG + Intronic
1126634216 15:50765730-50765752 GATGCGGAAACCCCCGCGCCGGG + Exonic
1127595998 15:60482812-60482834 CAGGCGTGAGGCACCGCGGCCGG - Intergenic
1128622856 15:69166640-69166662 GAGGCGTAAGCCACCGCGCCTGG - Intronic
1131757553 15:95581814-95581836 TATGCGGGAGCCACCGCGCCCGG + Intergenic
1133370074 16:5240174-5240196 GCTGCGGGAGGCTCCGTGGCCGG + Intergenic
1138109888 16:54315355-54315377 GTTGCGGAAGGCACAGGGGTGGG + Intergenic
1138392897 16:56683105-56683127 GATGCAGAAGGTACAGCAGCTGG - Intronic
1142223351 16:88865832-88865854 GAAGAGGAGGGCACCGCGGCCGG - Exonic
1142338629 16:89506831-89506853 GAGGGGGAGGGCACCGCGCCCGG + Intronic
1142850421 17:2701892-2701914 GGTGCGGGAGGCACTGGGGCCGG - Exonic
1144810204 17:17994048-17994070 GGAGCGGAAGGCAGCGTGGCAGG - Intronic
1147342117 17:39759136-39759158 CAGGCGTGAGGCACCGCGGCTGG - Intergenic
1151688861 17:75667457-75667479 GAGGCGGTGGGCAGCGCGGCTGG + Exonic
1151869026 17:76824086-76824108 GATGCTGAAGGCAAGGCTGCGGG - Intergenic
1152885270 17:82845648-82845670 GCTGCGGAAGGGACCGGGGTGGG - Intronic
1153041557 18:817369-817391 GAGGCGTGAGCCACCGCGGCAGG - Intergenic
1154332967 18:13444724-13444746 CATGCGCCAGGCACCGTGGCAGG - Intronic
1157386134 18:47261146-47261168 GAGGCGGCAGGCGCCGCGGGAGG - Intergenic
1161278615 19:3433345-3433367 GATGGGGAAGGCCCCGTGGGGGG - Intronic
1163085940 19:14979770-14979792 GAGGCGGAGGGCATCGCGGAGGG - Intronic
1163508422 19:17721397-17721419 GAGGCGTAAGCCACCGCGCCCGG - Intronic
1165073128 19:33267125-33267147 GATGCTGAAGACTCCTCGGCTGG + Intergenic
925882044 2:8361001-8361023 GATGCGGAAGGCTACAAGGCTGG + Intergenic
929598168 2:43188982-43189004 CGTGAGGGAGGCACCGCGGCTGG - Intergenic
930198788 2:48533104-48533126 CAAGCGGAAGCCACCGCGCCCGG - Intronic
934860490 2:97760396-97760418 CCTGGGGAAGGCACCGCAGCCGG + Intronic
936145492 2:109978015-109978037 GATGCACAGGGCACCGTGGCAGG - Intergenic
936199194 2:110393463-110393485 GATGCACAGGGCACCGTGGCAGG + Intergenic
944337359 2:198551632-198551654 CAAGCGTAAGGCACCGCGCCCGG - Intronic
948767846 2:240232798-240232820 TGTGCGGAAGGCTCTGCGGCCGG + Intergenic
1172875064 20:38159012-38159034 GCTGCGGAAGTGACCGGGGCAGG + Intronic
1175544113 20:59767182-59767204 GATGCAGAAGGCATCTTGGCTGG - Exonic
1175731358 20:61356253-61356275 CATCTGGAAGGCACCGCAGCTGG + Intronic
1175810895 20:61856746-61856768 GGTGTGGCAGGCACCGTGGCCGG + Intronic
1177651230 21:23964301-23964323 GATGTGGAAAGCACAGTGGCAGG + Intergenic
1178914479 21:36699036-36699058 GAGGGGGGAGGGACCGCGGCGGG - Intergenic
1179583851 21:42362430-42362452 GCTGGGGACGGCACCGCGTCAGG + Exonic
1181552215 22:23646740-23646762 CAGGCGTAAGCCACCGCGGCCGG - Intergenic
1183951812 22:41356757-41356779 GAAGCGGAAGGCCCAGCCGCTGG - Exonic
1184479114 22:44736879-44736901 GAGGCGGAGGGCGCGGCGGCCGG + Exonic
951363347 3:21750935-21750957 GATGCTGAAGACACCGCGGTGGG - Exonic
958785560 3:98593424-98593446 GCTGCGGAGGGCCCCGCGCCTGG - Exonic
963891476 3:150640415-150640437 CAGGCGTAAGGCACCGCGCCTGG + Intergenic
965420868 3:168456427-168456449 GATGCTGAAGGGAACTCGGCCGG - Intergenic
968659618 4:1793655-1793677 GAGGAGGGAGGGACCGCGGCGGG + Intronic
976556973 4:86461321-86461343 GATGGGGAAGGCACAGGGTCTGG + Intronic
985896108 5:2750973-2750995 GGTGGGGAGGGCAGCGCGGCAGG - Intronic
988513306 5:31883933-31883955 CATGCGGGAGCCACCGCGCCCGG - Intronic
999208389 5:149867054-149867076 GATGCAGAGGTCACCACGGCAGG - Intronic
1000124071 5:158226489-158226511 GATGGGGAAGGCAGAGAGGCAGG + Intergenic
1007996953 6:46317740-46317762 CAGGCGTAAGGCACCGCGCCCGG + Intronic
1011931954 6:92724582-92724604 GCTGTGGAAGGCGACGCGGCAGG - Intergenic
1011990507 6:93509433-93509455 CAGGCGTAAGCCACCGCGGCCGG + Intergenic
1017446104 6:154509321-154509343 GATGAGGAAGGCAGTGGGGCTGG - Intronic
1019643584 7:2117325-2117347 GGTGCGGACGGCACAGAGGCTGG + Intronic
1019778235 7:2925030-2925052 CAGGCGTGAGGCACCGCGGCTGG + Intronic
1025954355 7:66170947-66170969 GATGCGGAAGTCACCGATGCAGG + Intergenic
1032167311 7:129555688-129555710 CAGGCGTAAGCCACCGCGGCCGG + Intergenic
1034965287 7:155387058-155387080 GAGGCGGCAGGCACAGGGGCCGG + Intronic
1037846708 8:22289426-22289448 GAGGCGTAAGCCACCGCGCCCGG + Intronic
1037917465 8:22781329-22781351 GAGGCAGCAGGCACCGGGGCTGG + Intronic
1044806194 8:96010716-96010738 GATGGGGAAGGCAACTGGGCAGG + Intergenic
1047583364 8:126241696-126241718 CAGGCGTAAGCCACCGCGGCTGG - Intergenic
1048470444 8:134699865-134699887 GATGGACAAGGCACCGGGGCAGG + Intronic
1048881846 8:138877892-138877914 GATGCGGATGCCAGCGCGGTGGG + Exonic
1049199068 8:141331104-141331126 GATGCGGAGGGCAGCAGGGCAGG + Intergenic
1049349472 8:142156616-142156638 GCAGTGGAAGGCAGCGCGGCAGG - Intergenic
1053077232 9:35143194-35143216 CAGGCGTAAGCCACCGCGGCCGG - Intergenic
1056779395 9:89538263-89538285 GATGAGGAAGGCAGTGCTGCAGG - Intergenic
1059615543 9:115947155-115947177 CAGGTGTAAGGCACCGCGGCTGG - Intergenic
1062152612 9:135029609-135029631 GATGCGGAAGGCAGGGCGGCGGG + Intergenic
1062162491 9:135087902-135087924 CAGGCGGCGGGCACCGCGGCGGG - Exonic
1062468921 9:136693754-136693776 GCTCCGGAAGGCACGGCTGCAGG - Intergenic
1062579073 9:137221686-137221708 GGGGCGGCAGGCTCCGCGGCAGG + Intergenic
1195072082 X:101291143-101291165 GCTGCGGGGTGCACCGCGGCGGG + Intronic
1197746125 X:129932857-129932879 GCTGCGGGAGGAACCGCGGCCGG - Intergenic