ID: 902911024

View in Genome Browser
Species Human (GRCh38)
Location 1:19597248-19597270
Sequence ACCTCCCGCCGGGGCCCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 191}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902911024_902911034 -8 Left 902911024 1:19597248-19597270 CCGCCCGGGCCCCGGCGGGAGGT 0: 1
1: 0
2: 1
3: 20
4: 191
Right 902911034 1:19597263-19597285 CGGGAGGTCACTCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 99
902911024_902911039 24 Left 902911024 1:19597248-19597270 CCGCCCGGGCCCCGGCGGGAGGT 0: 1
1: 0
2: 1
3: 20
4: 191
Right 902911039 1:19597295-19597317 GAGGAGCCGGAGCAGCAGCCCGG 0: 1
1: 0
2: 5
3: 59
4: 576
902911024_902911033 -9 Left 902911024 1:19597248-19597270 CCGCCCGGGCCCCGGCGGGAGGT 0: 1
1: 0
2: 1
3: 20
4: 191
Right 902911033 1:19597262-19597284 GCGGGAGGTCACTCGGGCGGCGG 0: 1
1: 0
2: 0
3: 10
4: 125
902911024_902911042 30 Left 902911024 1:19597248-19597270 CCGCCCGGGCCCCGGCGGGAGGT 0: 1
1: 0
2: 1
3: 20
4: 191
Right 902911042 1:19597301-19597323 CCGGAGCAGCAGCCCGGGTGCGG 0: 1
1: 0
2: 3
3: 30
4: 275
902911024_902911035 5 Left 902911024 1:19597248-19597270 CCGCCCGGGCCCCGGCGGGAGGT 0: 1
1: 0
2: 1
3: 20
4: 191
Right 902911035 1:19597276-19597298 GGGCGGCGGGCACAGACCCGAGG 0: 1
1: 0
2: 0
3: 24
4: 271
902911024_902911036 11 Left 902911024 1:19597248-19597270 CCGCCCGGGCCCCGGCGGGAGGT 0: 1
1: 0
2: 1
3: 20
4: 191
Right 902911036 1:19597282-19597304 CGGGCACAGACCCGAGGAGCCGG 0: 1
1: 0
2: 2
3: 22
4: 203
902911024_902911040 25 Left 902911024 1:19597248-19597270 CCGCCCGGGCCCCGGCGGGAGGT 0: 1
1: 0
2: 1
3: 20
4: 191
Right 902911040 1:19597296-19597318 AGGAGCCGGAGCAGCAGCCCGGG 0: 1
1: 0
2: 5
3: 71
4: 619

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902911024 Original CRISPR ACCTCCCGCCGGGGCCCGGG CGG (reversed) Intronic