ID: 902916713 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:19644172-19644194 |
| Sequence | CGCGCGCGGCCTCTCCCTCC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 236 | |||
| Summary | {0: 1, 1: 1, 2: 1, 3: 23, 4: 210} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 902916713_902916718 | 1 | Left | 902916713 | 1:19644172-19644194 | CCCGGAGGGAGAGGCCGCGCGCG | 0: 1 1: 1 2: 1 3: 23 4: 210 |
||
| Right | 902916718 | 1:19644196-19644218 | CCGCCCGCTCTTTCTGCGCGCGG | 0: 1 1: 0 2: 0 3: 2 4: 50 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 902916713 | Original CRISPR | CGCGCGCGGCCTCTCCCTCC GGG (reversed) | Intronic | ||