ID: 902916713

View in Genome Browser
Species Human (GRCh38)
Location 1:19644172-19644194
Sequence CGCGCGCGGCCTCTCCCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902916713_902916718 1 Left 902916713 1:19644172-19644194 CCCGGAGGGAGAGGCCGCGCGCG 0: 1
1: 1
2: 1
3: 23
4: 210
Right 902916718 1:19644196-19644218 CCGCCCGCTCTTTCTGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902916713 Original CRISPR CGCGCGCGGCCTCTCCCTCC GGG (reversed) Intronic