ID: 902917765

View in Genome Browser
Species Human (GRCh38)
Location 1:19648829-19648851
Sequence GCCTCACGGCGCCCCCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902917760_902917765 -3 Left 902917760 1:19648809-19648831 CCAAGGACACCTCCTTTAAAGCC 0: 1
1: 0
2: 2
3: 8
4: 133
Right 902917765 1:19648829-19648851 GCCTCACGGCGCCCCCATGAGGG 0: 1
1: 0
2: 0
3: 6
4: 70
902917759_902917765 3 Left 902917759 1:19648803-19648825 CCTGTGCCAAGGACACCTCCTTT 0: 1
1: 0
2: 1
3: 19
4: 242
Right 902917765 1:19648829-19648851 GCCTCACGGCGCCCCCATGAGGG 0: 1
1: 0
2: 0
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902917765 Original CRISPR GCCTCACGGCGCCCCCATGA GGG Intronic
900342944 1:2197294-2197316 CCCTCCCGGCTCCCCCATGCAGG + Intronic
902917765 1:19648829-19648851 GCCTCACGGCGCCCCCATGAGGG + Intronic
904768636 1:32869225-32869247 GCCACAGGCCGGCCCCATGAGGG + Intronic
905570830 1:39003571-39003593 GCCTCACAGTGACCCTATGAGGG + Intronic
906789572 1:48646844-48646866 TCCTCACAGCAGCCCCATGATGG - Intronic
920499302 1:206476420-206476442 GCCCCCCAGAGCCCCCATGAGGG + Intronic
922250462 1:223845439-223845461 GTCTCGCCGCGCCCCCACGACGG + Intronic
924632610 1:245754931-245754953 GCCCCACGGCACCCTCAGGAGGG + Intronic
1070794056 10:79206781-79206803 GCCTCACTGCGGCCCCGTGATGG + Intronic
1072289678 10:93952537-93952559 GCCTCACCCCACCCCCATGTCGG - Intronic
1076329373 10:129653578-129653600 GCCTCACGTGGCCTCCCTGATGG + Intronic
1077432663 11:2523672-2523694 GCATCACGGTGCCCCTGTGAAGG + Intronic
1084605656 11:70170181-70170203 GTCCCAGGGAGCCCCCATGATGG + Intronic
1096680420 12:53252106-53252128 GCCTCTGGCCGCCGCCATGATGG - Intronic
1103377895 12:120470577-120470599 CCCTCACGGCGCCCCGAGGTGGG - Intronic
1103942878 12:124510452-124510474 TCCTCACAGCGCCCCCGTGAGGG + Intronic
1108379031 13:49839405-49839427 GCCTCCCGGCCCCCCAGTGAAGG + Intergenic
1113145018 13:107198998-107199020 GCCTCATGGCACCCCTTTGAAGG - Intronic
1119162549 14:72465138-72465160 GCCTCACAGTGCCTGCATGAGGG + Intronic
1122292547 14:100687459-100687481 GACTCATGTTGCCCCCATGATGG + Intergenic
1124652211 15:31482592-31482614 ACCTCACGGCGCCCGCGAGACGG + Exonic
1131397430 15:92097719-92097741 GCCTCACGGTGCCTCCGGGAAGG - Intronic
1133324869 16:4936526-4936548 GCCTCAGGGCGCCCCCTGGACGG + Intronic
1140054820 16:71516487-71516509 GCCCCACGACGACCCCCTGACGG + Intronic
1141445462 16:84055113-84055135 GCCACACGTCCCCTCCATGAAGG - Intronic
1143139456 17:4733053-4733075 GCCACAGGGCAGCCCCATGAGGG + Exonic
1143537312 17:7549111-7549133 GCCTCACCGCCCCCCCATCCCGG - Exonic
1143849994 17:9803732-9803754 ACCTCACGGCGACCCCCTGATGG + Intronic
1143976887 17:10836880-10836902 CCCTCACGGAGTCCCCATTAAGG + Intronic
1146917389 17:36686957-36686979 GCCTCACAGCACCCACATGGAGG - Intergenic
1150730815 17:67691895-67691917 GCCTCACGGGGCCCTAATGCAGG + Intronic
1152538210 17:80962411-80962433 TCCTCCCGGAGGCCCCATGAGGG - Intronic
1154374289 18:13796478-13796500 GGCTCAGGGTGCCCCCATGAGGG + Intergenic
1160379989 18:78446951-78446973 GCCTCACGGCGACCAGGTGAAGG + Intergenic
1160919799 19:1514011-1514033 GCCCCACGGCGCCCCCTGGCGGG + Intergenic
1160921990 19:1525360-1525382 GCCACACGGCACCACCTTGAGGG - Exonic
1161057090 19:2196057-2196079 GCCTCACGGCGATCCGAGGAAGG - Intronic
1161364123 19:3868617-3868639 TCCTCGTGGCGCCCCCATCAGGG + Intronic
1163158166 19:15450010-15450032 GCCCCGCCGCGCCGCCATGATGG + Intergenic
1163233170 19:16017290-16017312 TCCTCACGGCGACTCCATGGCGG + Intergenic
1166330522 19:42075792-42075814 CCCTCACGGCGTCCCCAAAATGG + Intronic
1168689688 19:58369054-58369076 GCCGCACGGCTCCCGCACGAGGG + Exonic
926144288 2:10387248-10387270 GCCTCACGGCCTCCTCAGGAAGG + Intronic
934759262 2:96844484-96844506 TCCTCACGTGGCCACCATGAGGG - Intronic
937956604 2:127425198-127425220 GCTTCTGGGCGCCCCCATCACGG + Intronic
938288998 2:130139765-130139787 GCCTCTCTGTGCCCCCGTGAGGG - Intronic
938467532 2:131533173-131533195 GCCTCTCTGTGCCCCCGTGAGGG + Intronic
939604800 2:144240830-144240852 GCCTCACTGAGCACCCAGGAGGG + Intronic
940281270 2:151992142-151992164 GCCTCACGGTTCTCCCTTGAAGG - Intronic
948640914 2:239375543-239375565 GCCTCACAGCGTCCACAGGATGG + Intronic
1170709647 20:18778792-18778814 GCCTCACAGCAACCCAATGAGGG - Intergenic
1172627800 20:36358185-36358207 GCCTCACTGTGGCCCCATGGGGG - Intronic
1172962914 20:38811176-38811198 GCCCCACGGTGGCCCCAGGAAGG + Intronic
1173565773 20:44037395-44037417 TCCTCACAGCTGCCCCATGAGGG + Intronic
1174216733 20:48921731-48921753 GCCCCACGGCGCCGCCATGTTGG - Intergenic
1174653722 20:52152402-52152424 GCCTCAGGTGGCCCCCAGGAAGG - Exonic
1175485410 20:59342499-59342521 CCCTCACGGCATCCCCAGGAGGG - Intergenic
1182095636 22:27623450-27623472 GCCTCTCCACGCCCACATGATGG - Intergenic
1182343294 22:29642106-29642128 GCCTCACGGCGTTCTAATGAGGG - Intronic
1184647930 22:45906208-45906230 GCCCCACGGAGCTCCCAGGAGGG + Intergenic
1184896488 22:47410063-47410085 GCATCAGGGCGCCCCTGTGAGGG - Intergenic
959971698 3:112416914-112416936 GTCTTACGGCCCTCCCATGACGG - Intergenic
960969619 3:123130314-123130336 ACCCCACGGCACCTCCATGAGGG + Intronic
985766042 5:1780024-1780046 GCCTCACATCGCCCTCAGGATGG - Intergenic
1000197982 5:158978232-158978254 GCCTCACAGCGGCCGCATGTCGG - Intronic
1018052513 6:160023549-160023571 GCCTTACAGCAGCCCCATGAAGG + Intronic
1026989411 7:74575118-74575140 GCCTCACGGAGCCTACATGGTGG + Intronic
1035279476 7:157768524-157768546 GCCTCACGTCATCCCCATCATGG - Intronic
1035559437 8:593696-593718 CCCTCACGGCGCTCCCCTCACGG - Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1046124071 8:109882356-109882378 GCTTCACTGCACTCCCATGAGGG + Intergenic
1049584454 8:143426423-143426445 GGCTCACGGAGCCCCCAAAATGG + Intronic
1049591302 8:143464179-143464201 GCGCCGCGGCGCCCGCATGATGG - Intronic
1057640108 9:96811493-96811515 GCAAGACGGAGCCCCCATGAGGG + Intergenic
1060787336 9:126460877-126460899 TCCTCAAGGCAACCCCATGAGGG - Intronic
1061662911 9:132142074-132142096 TCCTCACGGAGCCCTCATTAAGG - Intergenic
1185449769 X:275936-275958 GTCTCCCGGAGCCCCCAGGACGG - Intergenic