ID: 902918853

View in Genome Browser
Species Human (GRCh38)
Location 1:19654960-19654982
Sequence CACAGCAAGGTGCAGGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 469}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902918853_902918865 14 Left 902918853 1:19654960-19654982 CCGGCCCCCTGCACCTTGCTGTG 0: 1
1: 0
2: 6
3: 43
4: 469
Right 902918865 1:19654997-19655019 TGTGCTCCGTTCTAGGGCTCTGG 0: 1
1: 1
2: 1
3: 7
4: 97
902918853_902918866 17 Left 902918853 1:19654960-19654982 CCGGCCCCCTGCACCTTGCTGTG 0: 1
1: 0
2: 6
3: 43
4: 469
Right 902918866 1:19655000-19655022 GCTCCGTTCTAGGGCTCTGGAGG 0: 1
1: 0
2: 0
3: 1
4: 104
902918853_902918862 7 Left 902918853 1:19654960-19654982 CCGGCCCCCTGCACCTTGCTGTG 0: 1
1: 0
2: 6
3: 43
4: 469
Right 902918862 1:19654990-19655012 TGGCACCTGTGCTCCGTTCTAGG 0: 1
1: 0
2: 1
3: 7
4: 106
902918853_902918868 23 Left 902918853 1:19654960-19654982 CCGGCCCCCTGCACCTTGCTGTG 0: 1
1: 0
2: 6
3: 43
4: 469
Right 902918868 1:19655006-19655028 TTCTAGGGCTCTGGAGGCCACGG 0: 1
1: 0
2: 4
3: 28
4: 438
902918853_902918863 8 Left 902918853 1:19654960-19654982 CCGGCCCCCTGCACCTTGCTGTG 0: 1
1: 0
2: 6
3: 43
4: 469
Right 902918863 1:19654991-19655013 GGCACCTGTGCTCCGTTCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 78
902918853_902918869 24 Left 902918853 1:19654960-19654982 CCGGCCCCCTGCACCTTGCTGTG 0: 1
1: 0
2: 6
3: 43
4: 469
Right 902918869 1:19655007-19655029 TCTAGGGCTCTGGAGGCCACGGG 0: 1
1: 0
2: 2
3: 24
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902918853 Original CRISPR CACAGCAAGGTGCAGGGGGC CGG (reversed) Intronic
900641992 1:3691947-3691969 CACATCAATGTGCATGTGGCGGG + Intronic
900806573 1:4771524-4771546 CACAGGAAGGACAAGGGGGCTGG - Intronic
900839308 1:5034901-5034923 CACATCAAGGTGCTGGGAGGTGG - Intergenic
900977201 1:6025312-6025334 CTCAACACGGTGCAGGTGGCTGG + Intronic
901192391 1:7420313-7420335 CAGAGCAAGGAGCAGGGCACTGG - Intronic
902272281 1:15313308-15313330 CACACCATTGTGCTGGGGGCGGG + Intronic
902342430 1:15792781-15792803 CACGGCATGGTGGAGGTGGCTGG - Intergenic
902410890 1:16210964-16210986 GACAGCAGGGTGAAGGGAGCAGG - Intronic
902435943 1:16398168-16398190 CACAGCAAGAGGTAGAGGGCAGG - Intronic
902614956 1:17618672-17618694 CAGAGCAAGGTACAGGTGCCGGG - Intronic
902795765 1:18799660-18799682 CACAGTTAGCTCCAGGGGGCAGG - Intergenic
902849234 1:19140756-19140778 CACAGCAAGGAGCACGGCTCAGG - Intronic
902899902 1:19507693-19507715 CACAGGAAGCTGCAGGTGGGCGG - Intergenic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
903003472 1:20282864-20282886 GACAGCAGGGTGCAGGGCACAGG + Intergenic
903163201 1:21503754-21503776 CAAGGCAATGTGCTGGGGGCTGG - Intergenic
904239089 1:29132459-29132481 CACAGCAAGGCACATGGGGTAGG + Intergenic
905859697 1:41342087-41342109 CACACACAGGTGCAAGGGGCAGG - Intergenic
906100370 1:43256498-43256520 CAAACCAAGGTGCATGGAGCAGG + Intronic
906409403 1:45566852-45566874 CACCGCCTAGTGCAGGGGGCAGG - Exonic
906529595 1:46515894-46515916 CAGAGCATGGTCCAGGGGCCCGG + Intergenic
906544879 1:46613772-46613794 CGCAGCATTGTGCTGGGGGCAGG + Intronic
907167514 1:52427441-52427463 AACAACAAGTTGCAGGGGGATGG + Intronic
907313347 1:53552348-53552370 CACAGCATGGCCCAGGTGGCAGG + Intronic
912431370 1:109630131-109630153 CACAGCAGAGGGCAGGGGGAGGG - Intronic
912569954 1:110614103-110614125 CTCTGCAAGGTGCAGGGGAGGGG - Intronic
913067112 1:115266413-115266435 CACAGCGAGGAGCAGGGCTCAGG - Intergenic
913331510 1:117671861-117671883 CACAGCAAGTTACACAGGGCAGG - Intergenic
914310597 1:146462583-146462605 CAAAGAAAGATGCAGAGGGCAGG + Intergenic
914591510 1:149110558-149110580 CAAAGAAAGATGCAGAGGGCAGG - Intergenic
917127519 1:171700778-171700800 CACAGCACTGTGCTGGGTGCTGG + Exonic
919593861 1:199537823-199537845 GAGATCAAGGTGCAGGGGGTGGG + Intergenic
919887203 1:201943492-201943514 CACAGCACCGTGCTGGGGGCAGG - Intronic
920035031 1:203060133-203060155 AACAGCAAGGGGCAAGGGCCAGG - Intronic
920376835 1:205513319-205513341 CAGAGCAAGGGGCAAGGGCCAGG - Intronic
920439011 1:205966208-205966230 AGCAGCATGGTGCAGGGGGTGGG + Intergenic
920956804 1:210627086-210627108 CCCATCAAGGTGCAGAGGGAAGG - Intronic
922349590 1:224724306-224724328 CACAGCAAGGCCTATGGGGCTGG + Intronic
922440761 1:225653375-225653397 CCCAGAGGGGTGCAGGGGGCGGG - Intergenic
923107898 1:230868537-230868559 CACAGCGAGGGGCGGGGCGCGGG - Exonic
923689226 1:236176547-236176569 CACAGCCCTGTGCTGGGGGCTGG - Intronic
924021295 1:239786682-239786704 CACCGCAGGGTGCCGAGGGCAGG + Intronic
924511615 1:244732700-244732722 CAGAGCAAGGTGGAAGGGCCAGG - Intergenic
1064345854 10:14532294-14532316 CACGGGGAGGTGCTGGGGGCAGG - Intronic
1064348970 10:14559213-14559235 CACAGCCATGTCCAGAGGGCAGG + Intronic
1067087366 10:43249997-43250019 CACAGCAGGGTCCAGCGGCCAGG + Intronic
1067281580 10:44877274-44877296 CCCTGCTAGGTGCAGGGTGCTGG - Intergenic
1067294470 10:44967360-44967382 CCCAGCTAGCTGCAGAGGGCCGG + Intronic
1067348887 10:45457869-45457891 CACTGCAAGCTGGAGGCGGCTGG + Exonic
1069746364 10:70717384-70717406 CACAGCAAGGTTGTGGGGGTAGG + Intronic
1070870294 10:79745369-79745391 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1070997282 10:80796889-80796911 CACAGCAAGGTGGAAGGCGCTGG - Intergenic
1071637213 10:87267589-87267611 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1071759338 10:88583095-88583117 CACAGCAAGGTACAAGGGACCGG + Exonic
1073178210 10:101569288-101569310 CACAGGAAGGTGAAGGAGACAGG - Intergenic
1073984540 10:109193365-109193387 GACAGGCAGGTGCAGGGGCCGGG + Intergenic
1074306055 10:112279654-112279676 CACATGAAGGTGGAGGGGGAGGG - Intergenic
1074845036 10:117390312-117390334 CACACCAAGGTGGAGATGGCTGG - Intergenic
1075651118 10:124128827-124128849 CCCAGCAAGGTGCAAAGGGAAGG + Intergenic
1075802721 10:125162325-125162347 TACAGCCAGGGCCAGGGGGCCGG + Intergenic
1075835651 10:125450521-125450543 CTAGGCAAGGTGCAGGAGGCAGG - Intergenic
1076061410 10:127416895-127416917 CTCAGCAGGGTGCACGTGGCTGG + Intronic
1076278401 10:129224937-129224959 CAGAGCAAAATGCAGCGGGCGGG + Intergenic
1076383363 10:130039915-130039937 CACAGCAATGTGCAGGGTTTGGG + Intergenic
1076450724 10:130555309-130555331 CACAGGCAGGTGCACGGGGATGG + Intergenic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1076669394 10:132111363-132111385 CACAGCAAGGTCCCAGGGTCGGG + Intronic
1077333699 11:1994263-1994285 CACAGCGAGGGGCCGGGAGCTGG + Intergenic
1078057006 11:8017227-8017249 CAAGGCAGGCTGCAGGGGGCTGG + Intergenic
1079115088 11:17635532-17635554 CACAGCACGTTGCTGGGGGTGGG - Intronic
1080721659 11:34855088-34855110 CACAGCAAGATGCTTGGGCCTGG - Intronic
1081675005 11:44963510-44963532 CACAGCAGGCTGCTGGGGGAAGG + Intergenic
1083196844 11:61093317-61093339 GAGGGCAAGGGGCAGGGGGCAGG + Intergenic
1083607704 11:63988640-63988662 CACAGCAATCTGGAGGAGGCAGG - Exonic
1083699692 11:64467770-64467792 CAGAGCAAGGTGCGGGGATCGGG - Intergenic
1083745985 11:64736734-64736756 CACGGTGAGGAGCAGGGGGCAGG - Exonic
1083959604 11:66007281-66007303 CTCAGCAGGCTGCCGGGGGCAGG - Intergenic
1083960445 11:66012276-66012298 CAGAGCCAGGTGCGGCGGGCGGG + Exonic
1084366570 11:68705133-68705155 CACAGCTTTGTGCATGGGGCCGG - Intergenic
1084490888 11:69477707-69477729 CCCTGCAGGGTGCAGGGTGCTGG - Intergenic
1084555889 11:69875587-69875609 CAGAGCAGGGTGCAAGGGTCTGG - Intergenic
1084586354 11:70065044-70065066 CCCAGCCAGGTACAGGGAGCAGG + Intergenic
1084768491 11:71327471-71327493 CAGAGCAAGGTGCTGGGAGCCGG - Intergenic
1084784733 11:71435610-71435632 CACAGCAAGCTGCTGGTGTCGGG - Exonic
1085444049 11:76589087-76589109 CACAGCAGCGTGGAGAGGGCTGG + Intergenic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1086362526 11:86073694-86073716 CACAGAAAGGTGAGGGGGGAAGG - Intergenic
1087528049 11:99343126-99343148 AATAGCAAGCTGCAGGTGGCTGG + Intronic
1088794499 11:113256369-113256391 CACAGTGAGGTGCAGGTGCCTGG - Intronic
1090350136 11:126102736-126102758 CCTAGCAAGGAGCAGGAGGCAGG + Intergenic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090481736 11:127074949-127074971 CACAACAAGCTGAAGAGGGCAGG - Intergenic
1091407885 12:220470-220492 CTCAGCACGGTGATGGGGGCGGG - Intergenic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1091769653 12:3142635-3142657 AAGAGCATGGCGCAGGGGGCAGG - Intronic
1092141443 12:6186398-6186420 CACAGGACTGTGCAGGTGGCTGG - Intergenic
1092766031 12:11853821-11853843 GACAGCCAGGTGCAGGAAGCAGG + Intronic
1095252759 12:39998226-39998248 CACAGCAACCTGCAGGAGACTGG + Intronic
1096389468 12:51217706-51217728 CACAGCCCGGGCCAGGGGGCCGG + Intergenic
1096580696 12:52582933-52582955 TACAGGAAGGAGGAGGGGGCAGG - Intergenic
1100292359 12:93229863-93229885 CACAGAGTGTTGCAGGGGGCGGG + Intergenic
1100337242 12:93642744-93642766 TGCAGCAAGATGCAGGGGGCAGG - Intergenic
1101556526 12:105814965-105814987 CAAAGCAAGTTGCATGGGGTAGG - Intergenic
1102015638 12:109646121-109646143 CACTTCAAGGGGCTGGGGGCTGG + Intergenic
1102465450 12:113128182-113128204 CAAAAGGAGGTGCAGGGGGCTGG + Intronic
1102606429 12:114071228-114071250 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
1102879328 12:116472231-116472253 CAGAGCAAGCTGGAAGGGGCTGG - Intergenic
1104542199 12:129676197-129676219 CACATCAAGATGATGGGGGCAGG + Intronic
1105218909 13:18307538-18307560 CACAGCCAGGTGCTGTGGCCTGG - Intergenic
1105900171 13:24746438-24746460 CACAGCAAGGACCAGGAGGACGG - Intergenic
1108522659 13:51259671-51259693 CACAGCGAGGTGAAGGGGACGGG - Intronic
1108622219 13:52195467-52195489 CAGAGCCAGGTGCAGGGAACCGG + Intergenic
1108623096 13:52202991-52203013 CAAAGCCAGGCACAGGGGGCTGG - Intergenic
1108663628 13:52608051-52608073 CAAAGCCAGGCACAGGGGGCTGG + Intergenic
1108731984 13:53244922-53244944 CACAACAAGGTGCTGGGAGAGGG + Intergenic
1113436582 13:110296936-110296958 CAGAGCAAGGTGTAGGGGAAGGG + Intronic
1113582741 13:111440448-111440470 CAGGGGAAGCTGCAGGGGGCAGG - Intergenic
1113743370 13:112725929-112725951 CAGAGCAAGGTGCTGGGGAGGGG + Intronic
1113842848 13:113370119-113370141 CAGGGCAAGGTGCAGGCTGCAGG + Intergenic
1113895066 13:113759168-113759190 CGCGGGGAGGTGCAGGGGGCGGG + Intergenic
1114263963 14:21060312-21060334 CAGGGCAATGTGGAGGGGGCTGG - Intronic
1117940943 14:60963952-60963974 CTCAGCTAGGGGCAGAGGGCAGG - Intronic
1117964265 14:61190646-61190668 CACAGCAAGAGGCAGGGTGGTGG - Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118775003 14:68968304-68968326 CACAGCAACTTGTAGGTGGCAGG - Intronic
1119319992 14:73724925-73724947 CAGAGGAAGATGCAGGGGGAGGG - Intronic
1120847419 14:89138760-89138782 CACTAGAAGGTGGAGGGGGCTGG + Intronic
1121700807 14:95952748-95952770 CACAGCAAGGTCTGGGGGGTGGG + Intergenic
1122349220 14:101077940-101077962 CACTGCACGGTGCAGGGGAGGGG + Intergenic
1122771385 14:104099454-104099476 TACAGCCAGGGCCAGGGGGCGGG - Intronic
1122842787 14:104474647-104474669 CACAGCCAGATCCAGGGGCCAGG + Intergenic
1123015439 14:105371683-105371705 CACAGCAACCCTCAGGGGGCAGG + Intronic
1123020273 14:105394690-105394712 CACAGCATGGGGCAGGAGGTGGG - Exonic
1124087149 15:26561429-26561451 GATAGCAAGGTGTAGTGGGCAGG - Intronic
1124341864 15:28894902-28894924 CACAGGAGGGTGGCGGGGGCAGG + Intronic
1124347939 15:28934815-28934837 CACAGCAAGGTGTAGGTGGCAGG - Intronic
1125184171 15:36911642-36911664 GACAGCGAGGTTCAGAGGGCAGG - Intronic
1125613610 15:40990176-40990198 CACAGCAAGGGGCTGGGGTGGGG + Intronic
1127318029 15:57815925-57815947 CAGAGGAAGCTGCAGAGGGCAGG + Intergenic
1128094332 15:64942474-64942496 CACAGCGAGGTGCAGAGGAGAGG - Exonic
1128557712 15:68642860-68642882 CACAGCAAGGAACAGGAGGTTGG + Intronic
1128715221 15:69903082-69903104 CACCTCATGGTGCAGGGGCCTGG + Intergenic
1129254846 15:74328416-74328438 CTCAGAAAGGTGAAGGGGCCTGG + Intronic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1129689467 15:77705217-77705239 GAAAGCAAGGTCCAGGGTGCTGG - Intronic
1130052217 15:80493339-80493361 CACAGCAAGTGGCGGGGGGTGGG + Intronic
1130965345 15:88693489-88693511 CACAACAAGCAGCAAGGGGCAGG + Intergenic
1131154112 15:90064269-90064291 GACAGCAAGGTGAATGAGGCAGG - Intronic
1132042564 15:98537244-98537266 GACAGCAAGGAGCATGGGACAGG + Intergenic
1132310462 15:100853915-100853937 CATAGCAGGGAGCTGGGGGCAGG - Intergenic
1132990155 16:2788126-2788148 CAGAGCAAGATGCTGGGGTCAGG + Intergenic
1133062953 16:3187159-3187181 CACAGAAAAGTGAAGGAGGCTGG - Intergenic
1133562716 16:6964841-6964863 CACAGCAAGGAGCTGGGAGCAGG - Intronic
1134074783 16:11283014-11283036 CAGAGCATGGTGCAGGGCACTGG + Intronic
1134512432 16:14859209-14859231 AACAGGGAGGTGCAGGGAGCTGG + Intronic
1134700072 16:16257710-16257732 AACAGGGAGGTGCAGGGAGCTGG + Intronic
1134971754 16:18536950-18536972 AACAGGGAGGTGCAGGGAGCTGG - Intronic
1136060556 16:27723475-27723497 AAGCGCAAGGGGCAGGGGGCAGG - Intronic
1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG + Intronic
1136229287 16:28877418-28877440 CACAGAAAGGTGTCGGGGCCTGG - Intergenic
1136247785 16:28985307-28985329 CCCGGCAGGGAGCAGGGGGCAGG - Intronic
1136399736 16:30010885-30010907 CAGAGGCAGGTGCAGGGGGCTGG - Exonic
1141635883 16:85313548-85313570 CACAGCAAAGGGCAGGGAGGGGG - Intergenic
1141770372 16:86086068-86086090 CACAGCAAGGCGGAGGGAGCTGG + Intergenic
1142214229 16:88822896-88822918 CTCAGCATGGTGCAGGGCGCTGG + Intronic
1142359554 16:89619731-89619753 CACAGCAGGCTGCAGGGAGGGGG - Intronic
1142481162 17:219033-219055 CACAGCAGGGTGAGGAGGGCAGG - Intronic
1142631956 17:1230866-1230888 CTCAGCCAGGTGCGGAGGGCAGG - Intergenic
1142640222 17:1281089-1281111 CCCAGGAAGGGGCATGGGGCCGG + Intronic
1142744132 17:1947369-1947391 CGCTGCAGGGTGAAGGGGGCCGG - Intronic
1142980029 17:3666353-3666375 AAAAGCAAGGTGCAGAGGCCGGG + Intronic
1143614177 17:8039641-8039663 CACAGGAAGGGGTAGGGGACTGG + Intronic
1143771357 17:9171027-9171049 CGGATCAAGGTGCAGGCGGCAGG - Intronic
1144243379 17:13336174-13336196 TAGAGCAAGGTGCAGGGGTAGGG - Intergenic
1144329354 17:14210367-14210389 CACAGCAAGGAGGTGGGGACAGG - Intergenic
1144880426 17:18427901-18427923 CTCAGCAAACCGCAGGGGGCGGG + Intergenic
1145151809 17:20516486-20516508 CTCAGCAAACCGCAGGGGGCGGG - Intergenic
1145253918 17:21312327-21312349 CCCAGGAAGGTGCAGGGATCTGG - Intronic
1145322676 17:21775632-21775654 CCCAGGAAGGTGCAGGGACCTGG + Intergenic
1145819155 17:27818034-27818056 CAGAGCAAGGTGGGGGGGTCAGG - Intronic
1146263646 17:31437417-31437439 CACAGCAGGGCGCAGAGAGCCGG - Intronic
1147478984 17:40741085-40741107 CACATCAAGGTGCTGGGAGGTGG + Intergenic
1147644072 17:42023327-42023349 CACAGTAAGCTGCAGGGTTCTGG + Intronic
1147650650 17:42059954-42059976 CACACCAAGATGAAGGGAGCAGG - Intronic
1148125255 17:45233382-45233404 CACAGCCTTGTGCAGGGGGCAGG - Intronic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1148753376 17:49959102-49959124 GTCAGCAAGGGGCAGGGGACAGG - Intergenic
1148823834 17:50377723-50377745 CATAGCAAGTTGAAAGGGGCTGG - Intronic
1149090804 17:52776122-52776144 CACAGCAAAGTGCTGTGGTCAGG - Intergenic
1149812789 17:59693691-59693713 AACAAAAAGGAGCAGGGGGCAGG - Intronic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1150644747 17:66971047-66971069 AACAGCAATGTGCAGGGGAGGGG + Intronic
1151333838 17:73428427-73428449 CAAAGCCAGGTGCAGGGGTGAGG - Intronic
1151375165 17:73683528-73683550 TACAGCAAAGAGTAGGGGGCAGG - Intergenic
1151546851 17:74798564-74798586 CAGAGCAGGGTGCTGGGGGGTGG + Intronic
1151831851 17:76557444-76557466 CACAGAAAGTTCGAGGGGGCAGG - Intergenic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152078263 17:78171506-78171528 CACAGGAAGGTCCAGAGAGCTGG - Exonic
1152078313 17:78171704-78171726 CACAGCAGGGTACAGGTGGGTGG - Intronic
1152100807 17:78300877-78300899 AACAGGAAGGTGGAGGGGACAGG - Intergenic
1152223157 17:79080384-79080406 CACAGCAAGGGGCGGGGAGGTGG - Intronic
1152521845 17:80860986-80861008 CACAGCCAGGTGCAGAGCACTGG - Intronic
1152689932 17:81713354-81713376 CACAGCCAGGTTCACAGGGCAGG - Intronic
1153268449 18:3295368-3295390 CCCAGGAAGGAGCAGGGGGCTGG + Intergenic
1153699016 18:7673910-7673932 CACAGCAAGTTGCAAGGCACTGG + Intronic
1154412339 18:14148208-14148230 AACATCCATGTGCAGGGGGCAGG + Intergenic
1155012321 18:21792180-21792202 CACAGCAAGGTGGAGGAGGAAGG - Intronic
1155085705 18:22455681-22455703 CACAGCAAGGTACAGGCTGTGGG - Intergenic
1156153986 18:34280058-34280080 CAAAGCAATGTGCAGGTAGCAGG + Intergenic
1156689165 18:39685348-39685370 AACACCAAGGTCTAGGGGGCAGG + Intergenic
1159900381 18:74039490-74039512 CACAGCCAGGAGCAGGAGGAAGG - Intergenic
1160237250 18:77095705-77095727 CACATAAATGTGAAGGGGGCAGG - Intronic
1160408912 18:78661490-78661512 CACAGGAAGGTGCAGAGCCCAGG + Intergenic
1160824829 19:1074674-1074696 CACAGCATGGTGCAGGCGGTGGG + Exonic
1160849506 19:1183613-1183635 CAGAGCAAAGGGCCGGGGGCAGG + Intronic
1160930074 19:1566417-1566439 CAGAGAAAGGTGTGGGGGGCTGG - Intronic
1161352465 19:3801627-3801649 GACACCAGGCTGCAGGGGGCTGG - Exonic
1161362642 19:3859615-3859637 CACACCCAGGTGGAGGGCGCAGG + Intronic
1161408965 19:4105950-4105972 CACAGCAAGATGCGGGGGCCAGG - Intronic
1162439997 19:10686947-10686969 CACAGCAGGGAGGAGGGGGGTGG + Intronic
1162777709 19:12989965-12989987 CACAGCCATTTGCAGGGGGGTGG + Intergenic
1163091985 19:15026637-15026659 GACAGCAAGGTGAGGGTGGCAGG - Intergenic
1163368407 19:16888911-16888933 GCCAGCAAGATGCAGGGGGGGGG - Exonic
1163623184 19:18372863-18372885 CACAGCAAGGATCAGGCAGCTGG + Intergenic
1164061377 19:21678269-21678291 CACAGGATGGTGCAGGGGCCCGG + Intergenic
1164065278 19:21709443-21709465 CACAGGATGGTGCAGGGGCCTGG - Intergenic
1164675547 19:30098084-30098106 CACACCCAGCTGCAGAGGGCAGG - Intergenic
1164883796 19:31760181-31760203 CACACCAAGGACCAGGGGTCAGG - Intergenic
1165050602 19:33139193-33139215 CACCCCAAGGTGCAGCAGGCAGG + Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165831371 19:38732191-38732213 CACAGCAGGTGGCAGGTGGCAGG - Intronic
1165891534 19:39115489-39115511 CACAGGAAGTTGCAGGTTGCAGG + Intergenic
1166231782 19:41428783-41428805 GACAGCTAGGGGCTGGGGGCAGG + Intronic
1166737886 19:45096991-45097013 AACAGCAAGGAGCAGGGGTTAGG + Intronic
1166961020 19:46495778-46495800 CGCAGCCAGGTGCAGGGGGGCGG + Exonic
1167040640 19:47020899-47020921 CCCAGCAAGGAGCTGGGGGGGGG - Intronic
1167322891 19:48807283-48807305 CGCAGCATGGAGGAGGGGGCGGG - Intronic
1167342296 19:48922943-48922965 CACAGCTGGGTGCCAGGGGCAGG + Exonic
1168252875 19:55150350-55150372 CACAGCAAGGTGCAGAGACATGG - Intergenic
1168269542 19:55242049-55242071 CAGAGCAAGGTGCCACGGGCGGG + Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925142639 2:1560464-1560486 CTCAGCAAGGAGCATGTGGCAGG + Intergenic
925217410 2:2109328-2109350 CACAGGAATCTGGAGGGGGCTGG - Intronic
925288690 2:2732015-2732037 CACAGCAATGTGAAGGTGACCGG + Intergenic
925288697 2:2732073-2732095 CACAGCAACGTGAAGGTGACCGG + Intergenic
925288704 2:2732131-2732153 CACAGCAATGTGAAGGTGACCGG + Intergenic
925406175 2:3606585-3606607 CAGAGCAAGGAGCAGGGGCTGGG - Intronic
925831944 2:7904347-7904369 TACAGCAAAGTGGAGGGTGCAGG - Intergenic
926112008 2:10189508-10189530 CCCAGCAAGGGGCAGGCTGCTGG - Intronic
927010271 2:18896910-18896932 CACAGCAAGGAGCAGGGCTGAGG + Intergenic
927089644 2:19700725-19700747 CACAGGCAGGTGCAGGGGTGAGG - Intergenic
928398942 2:30964342-30964364 CACAGGGAGGTGGAGGTGGCTGG - Intronic
929396353 2:41527667-41527689 GCCAGCAAAGTGAAGGGGGCTGG - Intergenic
929558494 2:42940567-42940589 GACAACATGGTGCAGGGGACAGG - Intergenic
930025648 2:47027736-47027758 CCCAGCAGGGTGCAAGGGCCAGG + Intronic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
933750436 2:85599577-85599599 CACAGCCAGGTCCAGCGGGGCGG + Exonic
933763981 2:85694887-85694909 GAGAGCAGGGTGCAGGGGGCAGG - Intronic
936710080 2:115121692-115121714 TACAGCAACCTGGAGGGGGCTGG + Intronic
936720919 2:115252295-115252317 CACAGCAAGGTTGAAGGGACAGG - Intronic
937314686 2:120924123-120924145 CACACCAGGGTGCTGGGGGATGG + Intronic
937394171 2:121520220-121520242 CACATTAAGGTGCAGTGTGCTGG - Intronic
940418965 2:153456106-153456128 CACATGATGGGGCAGGGGGCGGG + Intergenic
941772895 2:169362669-169362691 CGCTGCAAAGTGCAGGGGGCGGG - Exonic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
946005064 2:216517917-216517939 CACAGCAAGGTGCATGTGTTAGG - Intronic
946059864 2:216932765-216932787 CACAGCTAGGAGGAGGGGTCAGG - Intergenic
946455363 2:219821134-219821156 CAAAGCAGGGTTGAGGGGGCAGG + Intergenic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
948057014 2:235016120-235016142 CACAGCAAGGGGTGGGGGGTGGG + Intronic
948122705 2:235543106-235543128 CCCAACGAGGGGCAGGGGGCGGG - Intronic
948846105 2:240683495-240683517 CACAGCCAGGAGCAGGGAGCAGG - Intergenic
948892109 2:240912532-240912554 CAGGTCAAGGTACAGGGGGCAGG + Intergenic
1169345124 20:4823234-4823256 CGGCGCAAGGTGCAGGGCGCGGG - Intronic
1170932959 20:20785430-20785452 CACAGCAAGGTGCAGTGTGGGGG + Intergenic
1171438404 20:25141515-25141537 CACTCCAGGGGGCAGGGGGCAGG + Intergenic
1171457095 20:25278286-25278308 CAGAGCAAGCTGGAGGGTGCAGG - Intronic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1172180876 20:33002754-33002776 CCCAGCAAGGGGCAGGGGCAGGG - Intronic
1172623937 20:36336847-36336869 CCCAGGAAGGAGAAGGGGGCTGG - Intronic
1172776263 20:37408942-37408964 CACAGCAAGAGGCAGGCGGGAGG - Intergenic
1172776932 20:37413413-37413435 CGCAGGAGGGTGCAGGGGGGCGG - Intergenic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1173687279 20:44932413-44932435 CACAGGAAGGTCTAGGTGGCTGG - Exonic
1173703504 20:45093680-45093702 CCCAGCAAGGGTGAGGGGGCTGG + Exonic
1174554058 20:51381508-51381530 CCCAGCAGGGTGCAGAGGGAGGG - Intergenic
1175170086 20:57074249-57074271 CACAGCAAGGTAAAGGGTCCTGG - Intergenic
1175221619 20:57420656-57420678 AGCAGCAGGGTGCTGGGGGCGGG + Intergenic
1175264507 20:57694564-57694586 CACAGATGGGTGCAGTGGGCTGG + Intronic
1175375644 20:58521849-58521871 CACAGCAAGGGGCAGGGGGATGG + Intergenic
1175715106 20:61250276-61250298 CAGAGGAGGGTGCAGAGGGCAGG - Intergenic
1175807467 20:61837861-61837883 CCCAGCAACCTGCAGTGGGCTGG - Intronic
1175894375 20:62329568-62329590 ACCAGCAGGGTGCAGGGTGCAGG + Intronic
1175942670 20:62545140-62545162 CACTGCAAGGAGCAGGGTGTTGG - Intergenic
1176082815 20:63282415-63282437 CACAGCAGGGTAGATGGGGCTGG + Intronic
1176370148 21:6057529-6057551 CACAGGCAGATCCAGGGGGCGGG - Intergenic
1176370995 21:6061355-6061377 CACAGGCAGATCCAGGGGGCAGG - Intergenic
1176860665 21:14010049-14010071 AACATCCATGTGCAGGGGGCAGG - Intergenic
1179032442 21:37732250-37732272 CACAGCAGGGTGTGTGGGGCTGG + Intronic
1179218984 21:39389811-39389833 CAGAGCAAGGTGCAGGTGCAGGG - Intronic
1179491062 21:41741855-41741877 CACCGCCAGGTGCAGCAGGCTGG + Exonic
1179548241 21:42126282-42126304 CACAGCAGGGCGTGGGGGGCCGG + Intronic
1179627290 21:42655864-42655886 CACAGCAAGGGGCAGAGGGCGGG - Intronic
1179627773 21:42658263-42658285 CCCAGCAGGGTGCAGAGGCCTGG - Intronic
1179653548 21:42830964-42830986 CACAGGAAGGTGCTGGAGCCAGG - Intergenic
1179752524 21:43477186-43477208 CACAGGCAGATCCAGGGGGCAGG + Intergenic
1179753371 21:43481012-43481034 CACAGGCAGATCCAGGGGGCGGG + Intergenic
1179885951 21:44314371-44314393 CCCAGCAAGGTCCAGACGGCAGG + Intronic
1180013240 21:45065078-45065100 CACCGCACGGTGGAGGGTGCTGG + Intergenic
1181019446 22:20091353-20091375 CACAGCCCAGTGCATGGGGCAGG - Intronic
1181164231 22:20974808-20974830 CTCAGCAAGGTACAGGGGGTGGG + Exonic
1181395153 22:22616230-22616252 CACCGAAGGGTGCAGGGAGCTGG + Intergenic
1181666881 22:24404665-24404687 AACAGCCAGGAGCAGGGGGAGGG - Intronic
1182299789 22:29331056-29331078 CGCAGCCAGGGGCAGGGTGCAGG + Intronic
1182472487 22:30557128-30557150 CACAGCATGGTGCAGGGTGCAGG + Intronic
1183064627 22:35354457-35354479 CAGAGCACGGTGCAGGGTGCTGG - Intergenic
1183297962 22:37043283-37043305 CCCAGCAAGGAGCAGCTGGCAGG - Intergenic
1183520878 22:38295408-38295430 CACAGGGAAGGGCAGGGGGCTGG + Intronic
1184246743 22:43239677-43239699 CACACCAGGATGCTGGGGGCTGG + Intronic
1184345847 22:43912206-43912228 GACAGCCAGGTGCAGCGGTCAGG - Intergenic
1184441549 22:44519718-44519740 CACATCCAGGTGCCGGGGGGAGG - Intergenic
1184535361 22:45082957-45082979 CATAGCAGGCTGCAGGGGCCAGG - Intergenic
1185092690 22:48784906-48784928 CATAGCAGGCTGCAGAGGGCAGG - Intronic
1185104283 22:48858409-48858431 CAGAGCAAGGTGCTGGTGGCAGG - Intergenic
1185243008 22:49756430-49756452 AACAGGAAGGGGCCGGGGGCTGG - Intergenic
1185271216 22:49929967-49929989 CAAAGCAAGATGCCGGGGTCTGG - Intergenic
949864832 3:8538830-8538852 CCCAGGACGGTGCAGGGTGCAGG + Intronic
950124058 3:10500885-10500907 CACCCCAAGGGGCAGTGGGCAGG + Intronic
950413851 3:12856870-12856892 CAGGGCCAGGTGCTGGGGGCGGG - Intronic
951207771 3:19942491-19942513 CAGACCAAGTTGCAGGGGGTAGG + Intronic
952326451 3:32324708-32324730 CCCAGCCAGATGCAGGGGGTTGG - Intronic
952968576 3:38636673-38636695 CAGAGCCAGGTGCAGGTGGTGGG - Intronic
953328405 3:42031966-42031988 CACAGCATGGGTTAGGGGGCGGG + Intronic
954131964 3:48565444-48565466 CACAGCATGGAGCTGGGAGCCGG + Exonic
954160367 3:48717235-48717257 GGGAGCGAGGTGCAGGGGGCGGG - Exonic
954629780 3:52041540-52041562 CACAGCTAAGTGGAGGGGTCTGG - Intergenic
954712522 3:52512226-52512248 CAGAGCAAGGGGCAGGGGCTGGG + Intronic
954894781 3:53966047-53966069 CAGAACCAGGTCCAGGGGGCTGG - Intergenic
955193018 3:56779379-56779401 CAAAGCTAGGTGCAGGGCACAGG + Intronic
955693122 3:61609202-61609224 CACAGCAAGGTATAGAGGGATGG - Intronic
955693324 3:61611302-61611324 CACAGCAAGGTTCTGAGGGATGG - Intronic
957768280 3:84655453-84655475 CACAGAAAGGTGAAGGTGGAAGG + Intergenic
960720312 3:120618883-120618905 TAGAGGAAGGTGCAGGTGGCGGG + Intergenic
961316752 3:126041972-126041994 CACAGCATGGTGCAGTTGGGAGG + Intronic
961345079 3:126259024-126259046 CACACCAAGGTGCAAGTGGGAGG - Intergenic
961365208 3:126395176-126395198 CACAGCGAGGTGCACAGGGATGG - Intronic
961487603 3:127227640-127227662 CCCTGCCAGGTGGAGGGGGCAGG + Intergenic
961657581 3:128451940-128451962 CACAGGACAGTGCAGGGAGCAGG - Intergenic
961736636 3:129005790-129005812 CACTGCATGCTGCAGGAGGCTGG - Intronic
961785192 3:129343320-129343342 GACAGCAAGGTGGTGGGGGGGGG - Intergenic
962826992 3:139107579-139107601 CAGAGCAAGGTGGAGGAGGTGGG + Intronic
962979407 3:140474201-140474223 CTCAGCAAGGTGTAGGGAGATGG - Intronic
963234991 3:142947517-142947539 CACAGCTGGGCGCAGGCGGCGGG - Intergenic
963492544 3:146019141-146019163 CTCAGCCTGGTGCAGGGAGCTGG - Intergenic
963638040 3:147824085-147824107 CACAGAAAGGAGCAGGGGAGTGG - Intergenic
963806664 3:149729344-149729366 CTCAGCTGGGGGCAGGGGGCAGG + Intronic
965661455 3:171046292-171046314 CACAGCAAGGGTAAGGGGGTAGG + Intergenic
966594986 3:181717778-181717800 CACTGCAAGGTGCAGTAGGGGGG + Intergenic
968061843 3:195731762-195731784 CACAGCCAGGTGCCAGGGGACGG + Intronic
968233556 3:197017966-197017988 CTGAGCAGGGGGCAGGGGGCAGG + Intronic
968780261 4:2575130-2575152 CACAGCAAGCTTCAGGGCGAAGG + Intronic
968951951 4:3699952-3699974 CACAGCCAGGAGCAGGCTGCAGG - Intergenic
969352066 4:6603773-6603795 TACAGCAAGTTGCAGGGGCTGGG + Intronic
972785033 4:42318725-42318747 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
974096909 4:57373865-57373887 CAGGGCAAGGTGTAGGGGGTAGG + Intergenic
975986266 4:80203299-80203321 CACAGCGAGGTGAAGGAGGGCGG - Exonic
978941382 4:114440036-114440058 AAAAGCAAGGTGCAGGGTGAGGG - Intergenic
980530446 4:134046185-134046207 CTCAGCAAGGGGAATGGGGCAGG + Intergenic
981245314 4:142530001-142530023 CATAGGAACATGCAGGGGGCAGG + Intronic
982045910 4:151445449-151445471 CCCAGCAAGGTGGAGTGGGGGGG + Intronic
985000046 4:185473423-185473445 CACACCAGGGCGCAGGGGGTTGG + Intergenic
985029396 4:185773558-185773580 CTTAGCAAGGTGCAGAGGACGGG + Intronic
985293229 4:188407299-188407321 CACAGGCAGGTGCAGGAGCCAGG - Intergenic
985423149 4:189804115-189804137 CACAGGAAGGTACATGAGGCAGG + Intergenic
985490074 5:174139-174161 CACAGCTAGGGGCAGGGGTCGGG + Intronic
985494207 5:195564-195586 CACGGCAAGGTTCTGGAGGCGGG + Intergenic
985556448 5:560930-560952 CACAGGAAGGTGCAGGACGCAGG - Intergenic
985775148 5:1837560-1837582 CCCAGGAAGTTGCAGGGGGGTGG - Intergenic
985953059 5:3237876-3237898 CACAGCATGGGGCAGGGGAGGGG + Intergenic
986162250 5:5240604-5240626 CACAGCAAGGTGTAGGTGGATGG - Intronic
987054974 5:14182864-14182886 CACGGCAAAGTGGAGGGGGGGGG - Intronic
989170304 5:38466651-38466673 CACAGCAGGGTGCAGTAGGGAGG + Intergenic
991206040 5:64051294-64051316 CTCACCAAGGTGCAGGCAGCGGG + Intergenic
992149863 5:73892342-73892364 CGCAGGCAGGTGCAGGGGGCAGG - Intronic
992157688 5:73971096-73971118 CTCTGCAAGGGGCAGGGGGTGGG + Intergenic
996798707 5:127378747-127378769 TAAAGCAGGGTGTAGGGGGCGGG - Intronic
998552442 5:143090517-143090539 TAGAGGAAGGTGCAGGTGGCGGG + Intronic
998938619 5:147256909-147256931 TACAGGAAGGTGCAGGCGGTGGG + Intronic
999403225 5:151283569-151283591 CACAGCAAGGTGGGTGGGGATGG + Intronic
999453964 5:151699366-151699388 GCCAGCAAGCTGCAGTGGGCTGG - Intergenic
999812163 5:155138010-155138032 CACAGCAAGGGAGAGGAGGCTGG + Intergenic
1000264225 5:159619469-159619491 CAGAGCAAGGACCCGGGGGCAGG - Intergenic
1000285947 5:159826303-159826325 AAAATCTAGGTGCAGGGGGCTGG - Intergenic
1001087710 5:168713218-168713240 CACAGCACGTTGGAGGGGCCGGG + Intronic
1001238634 5:170050892-170050914 CTAAGCAAGGTGCAAGGGACTGG + Intronic
1001568059 5:172713262-172713284 CCCAGCAAGGGGAAGGGGCCGGG + Intergenic
1001980755 5:176035724-176035746 CACTGCCAGAGGCAGGGGGCAGG - Intergenic
1002039266 5:176500038-176500060 CAGGGGAAGGTTCAGGGGGCAGG - Exonic
1002236705 5:177808341-177808363 CACTGCCAGAGGCAGGGGGCAGG + Intergenic
1003108676 6:3235173-3235195 AACAAGAAAGTGCAGGGGGCCGG - Intronic
1004947223 6:20629503-20629525 GACAGCAAGGTGCAGAGCACAGG - Intronic
1005030133 6:21500870-21500892 CATTGCAAAGTGCAGGGAGCTGG + Intergenic
1006171915 6:32097943-32097965 CACAGCCAGTGGAAGGGGGCAGG + Intronic
1006398492 6:33802198-33802220 CAGAGGAAGGCACAGGGGGCAGG + Intronic
1006854453 6:37123470-37123492 CCCAGCAGGGTGCAGGCGGATGG + Intergenic
1006883765 6:37362580-37362602 AAAAGAAAAGTGCAGGGGGCAGG - Intronic
1006936761 6:37724006-37724028 TACAGGGAGGTGCTGGGGGCTGG - Intergenic
1007072732 6:39048854-39048876 CAGCGCAAGGCGCAGCGGGCCGG - Exonic
1007577979 6:42938426-42938448 CACAGCGAGAGGCAGGAGGCAGG + Intronic
1007615643 6:43178464-43178486 CACAGCCAGGTCCAGGAGCCAGG + Exonic
1007778755 6:44238958-44238980 CAGTGGAAAGTGCAGGGGGCAGG - Intergenic
1009397453 6:63215834-63215856 CAGAGCAAAGTGCTGGGGGCTGG - Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1015831025 6:137369154-137369176 CACAGCAGAGGGCAGAGGGCTGG + Intergenic
1016851599 6:148624816-148624838 CACAGAAGGGTGCCAGGGGCAGG + Intergenic
1017010086 6:150057693-150057715 CACAGCCTGGCGCGGGGGGCTGG + Intergenic
1018462054 6:164007729-164007751 CCCAGCATGGTGGAGAGGGCAGG + Intergenic
1018713334 6:166513339-166513361 AACACCAAGGTGGAGGGTGCGGG + Intronic
1018930943 6:168239907-168239929 CAATGCAAGGTGGAGGGTGCGGG - Intergenic
1019024820 6:168950683-168950705 CACAGAAGGGTGCAGGGGTCTGG - Intergenic
1019093558 6:169560551-169560573 CACAGCCAGGTCCAAGGGCCAGG + Intronic
1019334591 7:476997-477019 CTCAGCAATGTCCTGGGGGCAGG - Intergenic
1019421668 7:953876-953898 AGCAGCCAGGTGCAGGGAGCCGG + Intronic
1019497581 7:1347650-1347672 CACAGCAGGGTGCAGGGCACAGG - Intergenic
1019532253 7:1509607-1509629 GACATCCAGGTGCAGGGGACTGG - Intergenic
1019712577 7:2524332-2524354 CCCTGCCAGGTGCACGGGGCGGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1023021023 7:36011820-36011842 CACTGCATGGTGCAGGGGAAGGG - Intergenic
1023352333 7:39333109-39333131 CTCAGCAAAGTGTTGGGGGCGGG - Intronic
1023841413 7:44100646-44100668 CACAGCAAGGCGCGGGGAGTGGG - Intergenic
1024243512 7:47453134-47453156 CACAGCCAGGAGCAGCTGGCAGG + Intronic
1024527866 7:50363836-50363858 GACAGCAAGGTGGAGGTGGATGG - Intronic
1025280635 7:57624468-57624490 CTCAGCAAGCTCCACGGGGCTGG + Intergenic
1025304095 7:57841039-57841061 CTCAGCAAGCTCCACGGGGCTGG - Intergenic
1026451540 7:70533778-70533800 CACAGCAACCAGCAGGGAGCTGG + Intronic
1026899892 7:74031050-74031072 CAAACCAAAGTCCAGGGGGCTGG - Intronic
1027150246 7:75728475-75728497 CACAGCCTTGTGCAGTGGGCTGG - Intronic
1030454844 7:109760460-109760482 CACAGCAATGGGCTGGGGGTGGG + Intergenic
1030678139 7:112406271-112406293 CCCAGCATGGGGCAGGGGCCAGG - Intergenic
1032079089 7:128849767-128849789 GACAGCACTGGGCAGGGGGCAGG - Intronic
1033922647 7:146413322-146413344 CACAGCAAGTTGCAAGTGGAAGG - Intronic
1034255646 7:149723281-149723303 GACAGCATGGTGGAGGGGCCGGG + Intronic
1034282040 7:149861337-149861359 CACAGCCAGGTGCAGCCGGTGGG - Exonic
1034518344 7:151599747-151599769 CACAGCAGGAGGCAAGGGGCGGG - Intronic
1034552462 7:151830306-151830328 CACAGCACAGTGCAGGTGGCGGG - Intronic
1034874131 7:154710128-154710150 GACAGCTTGGTGCAGGGAGCAGG + Intronic
1035690660 8:1557439-1557461 CACAGGATGGGGCAGAGGGCAGG + Intronic
1039048503 8:33472276-33472298 TGCAGCAGGGAGCAGGGGGCAGG + Intronic
1039248638 8:35636664-35636686 CACAGAAAAGTGCTGGGGGATGG + Intronic
1039396280 8:37227900-37227922 GAGAGGAAGGTGCAGGGGGAAGG - Intergenic
1040973622 8:53165022-53165044 CACAGCATGGTGAAGGGGAAGGG - Intergenic
1042742235 8:72062865-72062887 CACAGCCAGGTGGAGAGGGGTGG + Exonic
1042757926 8:72238122-72238144 CACAGCCAGATGGAGAGGGCTGG + Intergenic
1042877431 8:73452032-73452054 CAGAGCAAGGAGCTGGGTGCAGG + Intronic
1044632531 8:94293182-94293204 GACAGCAGGGAGCAGGGAGCAGG + Intergenic
1044761063 8:95518159-95518181 CACAGCAAGCAGCATGGGGCTGG - Intergenic
1045016765 8:98007318-98007340 CAGAGCAAGGGGCAGGGGAGGGG - Intronic
1045706270 8:104926660-104926682 TACATCAAGGAGCAGAGGGCAGG - Intronic
1047696966 8:127413433-127413455 TACAGCTAGGTGAAGGGGGCAGG - Intergenic
1048066131 8:130970586-130970608 CACACCAGGGTGGAGGGGGATGG - Intronic
1048395610 8:134011303-134011325 CACAGTCAGGTGCAGGGGGCGGG + Intergenic
1048615139 8:136065995-136066017 CACAGCAACGTGGATGGGGCTGG + Intergenic
1049163473 8:141112226-141112248 CACTGCCAGATGCAGGGGCCAGG + Intergenic
1049163968 8:141115514-141115536 CCCAGCCAGGTGCAGGGTGCAGG - Intergenic
1049191185 8:141288661-141288683 CCCAGCAAGCTGCAGTGAGCGGG + Intronic
1049280663 8:141742518-141742540 CAGAGCTGGGTGCAGTGGGCTGG + Intergenic
1049331930 8:142059228-142059250 CACACCAAACTGCAGGGTGCGGG + Intergenic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1049361139 8:142213049-142213071 GACAGGAAGGTGGAGGGGGAAGG - Intronic
1049622641 8:143605557-143605579 CACAGGGAAATGCAGGGGGCAGG - Exonic
1049676596 8:143891981-143892003 CACAGAAAGGGTCAGGGGTCAGG + Intergenic
1049688155 8:143947277-143947299 CACAGCAAAGGGCAGGGGTTGGG - Intronic
1051369220 9:16344053-16344075 CCCAGCAAAGTGCTGGGGCCAGG - Intergenic
1052855270 9:33402913-33402935 AACAGCCAGGTGGAGGGGACGGG + Intergenic
1053117048 9:35514144-35514166 GACAGCAAGTTTCATGGGGCAGG - Intronic
1055388437 9:75791146-75791168 CAAAGCATGGGGCAGGGGGATGG - Intergenic
1057315603 9:93966500-93966522 CACAGCAAGGTGGCGGCTGCAGG - Intergenic
1057873639 9:98736425-98736447 CACAGCAGTGTGACGGGGGCAGG + Exonic
1058746681 9:107998439-107998461 CACAGCATGGTGCACGGAGACGG + Intergenic
1058890036 9:109353816-109353838 CTCAGCAAGGTGGCGGGGGCTGG - Intergenic
1058954495 9:109932732-109932754 CACAGAAATGTGCTGAGGGCTGG + Intronic
1059382299 9:113935758-113935780 CACAGCACAGGGCAGGGTGCAGG - Intronic
1060202068 9:121657112-121657134 GACAGCAGGATCCAGGGGGCAGG - Intronic
1060590292 9:124812030-124812052 GGCAGCAAGGGCCAGGGGGCAGG - Exonic
1060793076 9:126498621-126498643 CCCAGAGAGGCGCAGGGGGCAGG - Intronic
1060825713 9:126686771-126686793 CACAGAAAGGTGCAGAGGCCAGG - Intronic
1060959928 9:127673185-127673207 CTCAGCAAGGTGCAGGTGGGTGG - Exonic
1060977955 9:127776517-127776539 CACAGCTGGGGGCAGGGGGAGGG - Intronic
1061055958 9:128223047-128223069 CCCAGCAAGTTGCAGTAGGCGGG - Intronic
1061250165 9:129421796-129421818 GAGAGCAAGGGGCAGGGGGTGGG + Intergenic
1061340228 9:129974298-129974320 CACAGGAAGGTGCAGTGAGCTGG - Intronic
1061374466 9:130215797-130215819 CAGGGAAAGGTGCAGAGGGCTGG + Intronic
1061852441 9:133424024-133424046 CAGAGCAGGGTCCAGGAGGCAGG + Intronic
1061886510 9:133593719-133593741 CACAGCCCGGTGCTGGGGCCAGG + Intergenic
1061958239 9:133974723-133974745 CACTGCTGGGTGCAGGGCGCAGG - Intronic
1062088540 9:134661653-134661675 CTCAGGAAGATGCAGTGGGCTGG - Intronic
1062208144 9:135348504-135348526 GTCAACAAGGTGCAGGGTGCTGG + Intergenic
1062240723 9:135536377-135536399 GACTGCAAGGAGAAGGGGGCGGG - Intergenic
1062344072 9:136106870-136106892 CAAGGGAAGGTGCCGGGGGCTGG - Intergenic
1062442822 9:136578780-136578802 CCCAGCAACGTTCAGGGGCCTGG + Intergenic
1062622326 9:137428639-137428661 CACAGAACGGTGCAGGGGAGGGG + Intronic
1062711222 9:137976150-137976172 GACAGTGAGGAGCAGGGGGCTGG + Intronic
1202791042 9_KI270719v1_random:90437-90459 CACAGAGAGGTGCACGGCGCCGG + Intergenic
1185522355 X:750434-750456 GACAGTAACGTGCAGGGGGCCGG - Intergenic
1185525009 X:771660-771682 CTCAGCAAGGGGCTGGGGCCAGG + Intergenic
1185944753 X:4362722-4362744 CACAGCCAGCTGCATGAGGCAGG - Intergenic
1186517447 X:10176529-10176551 AACAGGAAGGAGCAAGGGGCAGG + Intronic
1186877518 X:13830928-13830950 CACTGCAAGGGAAAGGGGGCAGG + Intronic
1189275328 X:39781176-39781198 CATAGGAAGGTGCTGGGGTCAGG + Intergenic
1189340292 X:40199974-40199996 CGGAAGAAGGTGCAGGGGGCCGG - Intergenic
1191057210 X:56254392-56254414 CACAGCAGAGTCCGGGGGGCGGG + Intronic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192538157 X:71946184-71946206 CACAGACAGGAGCAGGAGGCAGG + Intergenic
1196616169 X:117769304-117769326 CACAGCGGGGGGCAGGGGGGGGG - Intergenic
1198447895 X:136736915-136736937 CACAGCAATCTGCAGGGTGAGGG + Intronic
1199977858 X:152904875-152904897 CACGACCAGGTGCAGGGGCCAGG + Intergenic
1200307757 X:155045719-155045741 CACAGAAAAGGGAAGGGGGCTGG + Intronic
1200377255 X:155796252-155796274 CTCAGAAAGGGGGAGGGGGCAGG - Intergenic