ID: 902919120

View in Genome Browser
Species Human (GRCh38)
Location 1:19656178-19656200
Sequence CAGGGTAGGCGCTCTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902919111_902919120 16 Left 902919111 1:19656139-19656161 CCTTGAAGGAAATGTGTCTTTGT 0: 1
1: 0
2: 2
3: 40
4: 348
Right 902919120 1:19656178-19656200 CAGGGTAGGCGCTCTGTGGAAGG 0: 1
1: 0
2: 1
3: 19
4: 165
902919117_902919120 -10 Left 902919117 1:19656165-19656187 CCCAGAGCTGGCACAGGGTAGGC 0: 1
1: 0
2: 0
3: 33
4: 277
Right 902919120 1:19656178-19656200 CAGGGTAGGCGCTCTGTGGAAGG 0: 1
1: 0
2: 1
3: 19
4: 165
902919115_902919120 -9 Left 902919115 1:19656164-19656186 CCCCAGAGCTGGCACAGGGTAGG 0: 1
1: 0
2: 3
3: 40
4: 336
Right 902919120 1:19656178-19656200 CAGGGTAGGCGCTCTGTGGAAGG 0: 1
1: 0
2: 1
3: 19
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902919120 Original CRISPR CAGGGTAGGCGCTCTGTGGA AGG Intronic
900462263 1:2807320-2807342 CAGGGTAGGGGCTTGGTGGATGG + Intergenic
900542391 1:3209717-3209739 CAGGGAAGGGGCTCTGTGGGGGG - Intronic
901005692 1:6170605-6170627 CAGGGAGGGCACCCTGTGGAGGG + Intronic
902414642 1:16231578-16231600 CAGGGTAGGGTCTCTGGGGCTGG + Intergenic
902919120 1:19656178-19656200 CAGGGTAGGCGCTCTGTGGAAGG + Intronic
903735865 1:25529742-25529764 CAGGGTAGGAGTCCTGTGGCAGG - Intergenic
903744875 1:25580165-25580187 CAGGGTAGGCTCCTGGTGGATGG + Intergenic
903995874 1:27305220-27305242 GAGGGCAGGGACTCTGTGGAAGG + Intronic
905881723 1:41468360-41468382 GAGGGTGAGGGCTCTGTGGACGG - Intergenic
906538238 1:46564265-46564287 CAGGATAGTCTCTCTGTGGTGGG - Intronic
908780188 1:67684242-67684264 CATAGGAGGCTCTCTGTGGAAGG + Intergenic
910044603 1:82897083-82897105 CAGGCTAGGTCCTCTGTTGAGGG - Intergenic
911104105 1:94116696-94116718 CAGGGATGCCGCTCTGGGGAGGG - Intronic
915274931 1:154781962-154781984 CAGGGAGGGCTCTCTATGGAAGG + Intronic
915460617 1:156068541-156068563 CAGGCTAGGGGCTCTATGGGTGG - Intronic
917716915 1:177747644-177747666 CACGCTAGCCCCTCTGTGGAAGG + Intergenic
919758995 1:201085221-201085243 CAGGGGAGGCGCTATGAGGATGG + Intronic
919923360 1:202179093-202179115 TAGGGTAGCCCCTCTGTGGCAGG + Intergenic
920128201 1:203710693-203710715 CAAGGTAGGTGGGCTGTGGATGG - Intronic
923373111 1:233332348-233332370 CAGGGAAGGCACTCCGAGGAAGG + Intronic
1063268844 10:4484889-4484911 GAGGGTAGTCCCTCTCTGGAAGG - Intergenic
1063934722 10:11065875-11065897 CAGGGTAGGCTTTCTCCGGAAGG + Intronic
1065133212 10:22643533-22643555 CAGGTTAGGCAATCTTTGGAGGG - Intronic
1067577970 10:47419768-47419790 CAGGGTCCGAGCTCTGTGCAGGG + Intergenic
1067577989 10:47419834-47419856 CAGGGTCCGAGCTCTGTGCAGGG + Intergenic
1068993075 10:63171265-63171287 CAGGGTCATTGCTCTGTGGAGGG + Intronic
1070549771 10:77481992-77482014 CAGGGTAGGCACTTTGTGCCAGG - Intronic
1075588818 10:123676944-123676966 CGGGGCAGGGGCACTGTGGATGG - Intronic
1076527081 10:131118668-131118690 CAGGGTTGGGGGTCAGTGGATGG - Intronic
1078865538 11:15293908-15293930 CAGGGTAGGCTTTCTCTGGAAGG - Intergenic
1080578334 11:33620654-33620676 AAGGGGAGGGGCTCTGTGGCTGG - Intronic
1081700518 11:45149661-45149683 CAGGGAAAGTGCACTGTGGAGGG - Intronic
1083417764 11:62536398-62536420 GAGGGTGGGCCCTGTGTGGATGG - Intronic
1083664595 11:64267584-64267606 CAGGGCGGGCGCTGGGTGGAGGG + Intronic
1084492580 11:69486766-69486788 CAGGGCTGGGGCTCTGTGGCAGG + Intergenic
1084751942 11:71209772-71209794 CACGGCAGGTGCTCTGTTGATGG - Intronic
1085277514 11:75309500-75309522 CAGAGTTGGAGCTCTGTGAATGG + Intronic
1087016104 11:93555825-93555847 CAGGGAAGGAGCCCTGTGCAAGG - Intergenic
1087020765 11:93600801-93600823 CAGTGTATGCCCTCTGTGGCAGG - Intergenic
1089363169 11:117904247-117904269 CAAGGGAGGCCCTCTGTGGTTGG + Intronic
1090247555 11:125227309-125227331 GAGGAAAGGCGTTCTGTGGATGG - Intronic
1090570359 11:128038226-128038248 CAGCAGAGGGGCTCTGTGGAAGG + Intergenic
1090887893 11:130895270-130895292 CTGGGTATGCCCTGTGTGGAGGG + Intronic
1091149899 11:133318494-133318516 CAGGGTGGGGGGTCAGTGGATGG - Intronic
1091582077 12:1796298-1796320 CAGGGGAGGCGCTCGGTAGGCGG - Intronic
1092000727 12:5029899-5029921 CAGGGTGGGAGGTCAGTGGATGG + Intergenic
1093218342 12:16388904-16388926 CAGTGTAGTTGCTCAGTGGAAGG - Intronic
1097166547 12:57089270-57089292 GGGGGAAGGCGCTCTGTGCATGG - Exonic
1097719143 12:63001636-63001658 CAGGGTAAGAGGTCTGGGGATGG - Intergenic
1101371703 12:104137545-104137567 CAGGGGATGCGCTCTGGGGGCGG - Intronic
1102172513 12:110852981-110853003 CATAGTAGGTGCTCTGTGGCTGG - Intronic
1102637513 12:114337011-114337033 CAGGGTTGGGGGTCAGTGGATGG - Intergenic
1102928392 12:116843881-116843903 CAGAGTAGGGGCTCTGTCAATGG - Intronic
1104953310 12:132451960-132451982 CGGGGTCTGCGCTCTGAGGAGGG + Intergenic
1105899085 13:24741267-24741289 CAGGGCAGGGGCTGTGAGGATGG + Intergenic
1107069749 13:36256946-36256968 CTGGGTAGGCACTGTGTGGCAGG + Intronic
1107149087 13:37091184-37091206 CAGGGTTGGGGCTCTGAGCAGGG + Intergenic
1107464330 13:40635776-40635798 CAGGGCAGGCCCTCAGTGGAGGG - Intronic
1111959783 13:94797729-94797751 CAGAGTGGGTGCTCTGTGAAAGG + Intergenic
1112769422 13:102779831-102779853 CAGGGTAGGGAGTCAGTGGATGG + Intergenic
1113911296 13:113842660-113842682 CAGGGCAGGCGGCCTGTGCAGGG + Intronic
1114533223 14:23408196-23408218 CACGGTGGGGGCTCTGTGGACGG + Intronic
1115557343 14:34554004-34554026 CAGGCTATGCGCTCAGTGAACGG - Intergenic
1119503119 14:75147814-75147836 GAGGGTAGGGGTTCTGTAGAGGG - Intronic
1121683776 14:95816609-95816631 CAGGGTTGGCTCCCTCTGGAAGG + Intergenic
1122114250 14:99520034-99520056 CAGGGCAGGTGCCCAGTGGAGGG - Intronic
1122694727 14:103547072-103547094 CAGGCCAGGGGCTGTGTGGAGGG + Intergenic
1122956681 14:105074582-105074604 CAGGGGAGGGTCTCTGAGGAGGG - Intergenic
1125520771 15:40346792-40346814 CAGGGTAGGTGCTCTGTTCATGG - Intergenic
1129740889 15:77989073-77989095 CAGGGAAGGCCTTCTGAGGAGGG + Intronic
1130651878 15:85766668-85766690 CACGGAAGGCACTCTGTGGGAGG - Intronic
1131119440 15:89813720-89813742 CAGGGTATGTGTTTTGTGGAGGG - Intronic
1131433722 15:92406573-92406595 TAGGGCAGGCGCTCTGTAGAAGG - Intronic
1132469170 16:92349-92371 CAGGGTGGGCTCTATGGGGAGGG + Intronic
1136031634 16:27507344-27507366 CAGAGAAGGATCTCTGTGGAAGG - Intronic
1136923039 16:34346903-34346925 CAGGGAAGGGGCTGTGAGGATGG - Intergenic
1136981534 16:35064903-35064925 CAGGGAAGGGGCTGTGAGGATGG + Intergenic
1139473975 16:67193294-67193316 AAGGGGAGGGGCTCTGAGGAGGG - Intronic
1139477410 16:67209647-67209669 CAGGGAAGGAGCACTGAGGAAGG - Intronic
1139527276 16:67524788-67524810 CAGGGTAGGGGCCGTGGGGATGG - Intronic
1139719510 16:68841230-68841252 AATGGTAGCTGCTCTGTGGAAGG + Intergenic
1141432474 16:83977567-83977589 CTGTGGAGGGGCTCTGTGGAGGG - Intronic
1141625481 16:85259088-85259110 CAGGATAGGGGCTCAGTGCAAGG + Intergenic
1143211399 17:5190892-5190914 CTGGGGACGCGCTCGGTGGATGG + Intronic
1145237448 17:21218453-21218475 CAAGATAGGCGCTGTGTGAATGG - Intergenic
1147340685 17:39751774-39751796 TAGGGTAGGGGTTCTGTGGAGGG + Intergenic
1147462309 17:40581160-40581182 CAGAGTAGGTGCTCAGTGAATGG - Intergenic
1147948285 17:44092751-44092773 CAGGGGGGCCGCTCTGGGGAGGG + Exonic
1148737782 17:49874484-49874506 CAGGGCTGCCCCTCTGTGGATGG + Intergenic
1152365593 17:79854568-79854590 CAGGGAAGGCTCACTGAGGAAGG + Intergenic
1154402614 18:14056009-14056031 CATGCTAGGCGGGCTGTGGAAGG - Intergenic
1157422048 18:47555676-47555698 CAGGGTGGGGGATGTGTGGAAGG - Intergenic
1157446669 18:47751457-47751479 CAGGGAAGGCTTTCTGGGGAGGG - Intergenic
1157554752 18:48606210-48606232 TAGGGTAGGAGCTCTGAGGAAGG - Intronic
1159629689 18:70735341-70735363 CATGGTAGGGGATGTGTGGAAGG + Intergenic
1162475411 19:10896583-10896605 GTGGGTAGGGGCGCTGTGGAGGG - Intronic
1163648525 19:18503787-18503809 CAGGGAAGGCTCCCTGAGGAGGG - Intronic
1164229871 19:23277762-23277784 CTGGGGATGCGCTCGGTGGATGG - Intergenic
1165045211 19:33099427-33099449 CAGGCTCGGAGCTCAGTGGAAGG - Intronic
1165452164 19:35890016-35890038 CAGGGCAGCCGCCATGTGGAGGG + Exonic
1165824490 19:38698097-38698119 CAGAGCAGGCACACTGTGGAGGG + Intronic
1166420553 19:42632991-42633013 CAGGGGATGCGCTGTGTGCAGGG + Intronic
1166696077 19:44852037-44852059 CAGGGTCGGGGCTGTGGGGACGG - Intronic
1166882199 19:45936403-45936425 CAGGGTGGGAGGGCTGTGGAAGG + Exonic
1167649040 19:50719611-50719633 AAGGGGGGGCGCTCTGCGGATGG - Intergenic
925288208 2:2729614-2729636 CTGGGCAGGAGCTCTGTGCAGGG + Intergenic
926301925 2:11611024-11611046 CAGGGTAGGTGCTGTGCGCAGGG + Exonic
926371649 2:12184781-12184803 CAGGGTGGGCCATGTGTGGAAGG + Intergenic
927562865 2:24085664-24085686 CAGTGTAGGGGGTCAGTGGATGG - Intronic
931038392 2:58268281-58268303 TAGGGTAGGAGATCTGAGGAAGG + Intergenic
934940810 2:98500614-98500636 CAGGGTAGGGGGTCAGTGGATGG + Intronic
938172475 2:129091421-129091443 CAGGTTGGACGCTATGTGGATGG - Intergenic
944289609 2:197990658-197990680 CATGGGAGGGACTCTGTGGAAGG - Intronic
948607214 2:239143795-239143817 CATGGTAGGTGGTCTGTGAAAGG - Intronic
1170578164 20:17680413-17680435 CAGGGTAGGGGCCATCTGGATGG - Intronic
1172020676 20:31911575-31911597 CAGGGAAGGCGCAGTGAGGAAGG + Intronic
1172049191 20:32103332-32103354 CAGGGGAAGCTCTCAGTGGAGGG + Intergenic
1173617851 20:44414424-44414446 CAGGGAGGGGGCTCTGTGCAGGG + Intronic
1175219623 20:57409434-57409456 CAGGCCAGGCGCTCTATGCACGG - Intergenic
1179477040 21:41653629-41653651 CAGGGAAGGGGCCCTGTGAATGG + Intergenic
1180208608 21:46279490-46279512 CAGAGCAGGCACTCTGTGCAAGG + Intronic
1180800213 22:18628237-18628259 CAGGGAAGGCGCTCCTGGGAGGG + Intergenic
1180851446 22:19023801-19023823 CAGGGAAGGCGCTCCTGGGAGGG + Intergenic
1181221503 22:21367029-21367051 CAGGGAAGGCGCTCCTGGGAGGG - Intergenic
1183729967 22:39612860-39612882 CACAGTAGGTGTTCTGTGGAGGG - Intronic
1184029888 22:41886339-41886361 CAGGGTGGGCTTTCTGGGGAAGG + Intronic
1184117752 22:42431934-42431956 GAGGGTGGGCGCTGTGTGGCTGG - Intronic
1184252140 22:43266858-43266880 CAGGGTATGTGCTTCGTGGAGGG - Intronic
1185127337 22:49018441-49018463 CAGGGGAGGAGGTCTGTGGAAGG + Intergenic
1185163547 22:49244071-49244093 CAGGGTTGGGTCACTGTGGATGG - Intergenic
953608462 3:44427827-44427849 CAGGGGAGGAGCTCAGTGGGTGG + Intergenic
954603517 3:51891308-51891330 CAGGGTGGGACCTCTGTGGGTGG + Intergenic
964884826 3:161469731-161469753 CATGGTAGGCACTCTGTGTTTGG + Intergenic
969214950 4:5713966-5713988 CAGGGTAGGTGCTCAGGGGAAGG - Intronic
971351000 4:25855945-25855967 AAGGGTAAGGGCTCTTTGGAAGG - Intronic
971889995 4:32507705-32507727 CAGGGTAGGCACTTGGTGGGAGG - Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
983487988 4:168353832-168353854 CAGGGTAGGGGAAATGTGGATGG + Intergenic
984367970 4:178822528-178822550 CAGGTTAGGAACTCTGTGCAGGG + Intergenic
984947127 4:184978382-184978404 CAGGGAACTCGGTCTGTGGAAGG - Intergenic
985050600 4:185987451-185987473 CAGTGAAAGCCCTCTGTGGAGGG + Intergenic
995743904 5:115383687-115383709 CAGAGTAAGCAGTCTGTGGATGG + Intergenic
995837210 5:116410759-116410781 CAAGGTAGAGGCTCTGTGGAGGG - Intronic
999693698 5:154170157-154170179 CAGAGTAAGAGCTCAGTGGATGG - Intronic
1002097430 5:176839693-176839715 GAGTGGAGGCGCTCTGGGGAGGG + Intronic
1003078797 6:3004485-3004507 CAGGCCAGGTGCCCTGTGGATGG - Exonic
1006147998 6:31970669-31970691 CAGGTTGGGGGCTGTGTGGATGG + Exonic
1012944161 6:105448314-105448336 CTGGGGAGGCTCTCTGAGGAGGG - Intergenic
1015625748 6:135180452-135180474 CAGGGTGCGCGCTCTGTGCAGGG + Intergenic
1015785980 6:136922057-136922079 CAGGGAAGACGCTCTGCGGAGGG - Intergenic
1018472931 6:164112401-164112423 CATGGGAGGGACTCTGTGGAAGG + Intergenic
1018554045 6:165032676-165032698 CAGGGTAGGGGGTCTGTGGATGG - Intergenic
1018748258 6:166779641-166779663 CAGAGCAAGTGCTCTGTGGACGG - Intronic
1019044283 6:169131290-169131312 GAGTTTAGGCACTCTGTGGAGGG + Intergenic
1019062222 6:169264791-169264813 CAGGGCAGGGGCTCTGAGGATGG + Intergenic
1019294594 7:267095-267117 CGGGGCAGGCGCTCTGGGAAGGG - Intergenic
1019345286 7:526734-526756 CAGGGGAAGCGCTCTGGGGTTGG - Intergenic
1022274673 7:28843416-28843438 CAGGGTAGAGGATCAGTGGAGGG - Intergenic
1026300001 7:69089524-69089546 CAGGGAAGGTGCTCAGAGGAAGG + Intergenic
1026799541 7:73390821-73390843 CAGAGTAGGGGCTGCGTGGAAGG + Intergenic
1026896510 7:74012960-74012982 CAAGGTAGACGCTCTGGGCAGGG - Intergenic
1029403252 7:100358232-100358254 CAGGAGAGGGGCCCTGTGGAGGG - Exonic
1029405825 7:100373586-100373608 CAGGAGAGGGGCCCTGTGGAGGG - Exonic
1032855722 7:135832184-135832206 CAGGGTTGGGGATCAGTGGATGG + Intergenic
1033621643 7:143067152-143067174 CATGGTGGGCCCTCAGTGGATGG - Intergenic
1037820637 8:22133243-22133265 CAGGTAAGGGGCTCTGGGGATGG - Intronic
1037973514 8:23192163-23192185 GTGGGTGGGCTCTCTGTGGATGG - Intronic
1040108137 8:43551629-43551651 CTGGGGATGCGCTCGGTGGATGG - Intergenic
1042789427 8:72587337-72587359 CATGGTAGGTTCTCTGTGGATGG + Intronic
1044491038 8:92815290-92815312 CAGGGTCGGCGTTGTGTGGGGGG + Intergenic
1048993234 8:139773618-139773640 CAGGGTGGGGGCTGTGGGGAAGG - Intronic
1049735392 8:144202373-144202395 AAGCGCAGGCTCTCTGTGGAGGG + Intronic
1049735460 8:144202601-144202623 AAGCGCAGGCTCTCTGTGGAGGG + Intronic
1049735518 8:144202798-144202820 AAGCGCAGGCTCTCTGTGGAGGG + Intronic
1049735788 8:144203570-144203592 AAGCGCAGGCTCTCTGTGGAGGG + Intronic
1049815643 8:144598072-144598094 CAGAGTAGGAGCTCCGTGGTGGG + Intronic
1056733191 9:89183231-89183253 CAGGGGATACTCTCTGTGGATGG - Intergenic
1056797318 9:89667716-89667738 AAAGGCAGGGGCTCTGTGGAGGG - Intergenic
1060490634 9:124081590-124081612 CATGGTAGGTGCTCTGTAAATGG - Intergenic
1060765525 9:126293005-126293027 CAGGATAGGCGATCTGAGAAGGG + Intergenic
1185618187 X:1435990-1436012 CTGGGGAGGCGCACTGGGGAGGG - Intronic
1186064641 X:5749006-5749028 CTGGGGAGGGGCTCTGAGGAAGG + Intergenic
1186123734 X:6390083-6390105 CAGGGTAGACGTACTGTGGCAGG - Intergenic
1190639029 X:52465179-52465201 CAGGGTAGATGCTCTGTGAAGGG + Intergenic
1193056631 X:77159541-77159563 CAGGGTAGTAGCCCGGTGGAAGG - Intergenic
1196412425 X:115434080-115434102 CAAGGAAGGAGCTCTGTGGTAGG + Intergenic