ID: 902920687

View in Genome Browser
Species Human (GRCh38)
Location 1:19664820-19664842
Sequence CGTGCGCCCCGCCTCGCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902920687_902920691 -10 Left 902920687 1:19664820-19664842 CCCACCGCGAGGCGGGGCGCACG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 902920691 1:19664833-19664855 GGGGCGCACGCTCCGCGGCGCGG 0: 1
1: 0
2: 0
3: 18
4: 121
902920687_902920692 -9 Left 902920687 1:19664820-19664842 CCCACCGCGAGGCGGGGCGCACG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 902920692 1:19664834-19664856 GGGCGCACGCTCCGCGGCGCGGG 0: 1
1: 0
2: 0
3: 12
4: 151
902920687_902920693 -8 Left 902920687 1:19664820-19664842 CCCACCGCGAGGCGGGGCGCACG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 902920693 1:19664835-19664857 GGCGCACGCTCCGCGGCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 111
902920687_902920697 17 Left 902920687 1:19664820-19664842 CCCACCGCGAGGCGGGGCGCACG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 902920697 1:19664860-19664882 CGCGCGCTCCAGGCTGCACCCGG 0: 1
1: 0
2: 0
3: 12
4: 96
902920687_902920695 7 Left 902920687 1:19664820-19664842 CCCACCGCGAGGCGGGGCGCACG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 902920695 1:19664850-19664872 GCGCGGGGACCGCGCGCTCCAGG 0: 1
1: 0
2: 2
3: 28
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902920687 Original CRISPR CGTGCGCCCCGCCTCGCGGT GGG (reversed) Intergenic
900438767 1:2643225-2643247 CCTGCGCCCCGCCCCTCGGCAGG - Intronic
902072208 1:13749570-13749592 CCCGCGACCCGCCTCGCGGTCGG - Intronic
902920687 1:19664820-19664842 CGTGCGCCCCGCCTCGCGGTGGG - Intergenic
904701809 1:32362285-32362307 CGTGGACGCCGCCTCGCGGCGGG - Exonic
908796088 1:67832926-67832948 CGTGCGCCCCGCGCCGGGTTGGG - Intronic
1069486614 10:68827782-68827804 GGCGCGCGCCGCCTCGCGGCTGG + Exonic
1069486701 10:68828118-68828140 GGCGCGCGCCGCCTCGCGGCTGG + Intronic
1079626780 11:22625699-22625721 CGTGCGCCGGGCCTTGCAGTGGG - Exonic
1084007498 11:66331121-66331143 CGTGCACACCCCCTCGTGGTTGG + Intronic
1084226230 11:67716141-67716163 CGTACTCCCCGCATCGCGGGGGG + Intergenic
1086981050 11:93197968-93197990 CATGCTCCTCGCCGCGCGGTTGG - Intergenic
1090224714 11:125063195-125063217 CTTGCGCCCGCCCTCGGGGTCGG - Intronic
1093435277 12:19129562-19129584 CGGCCGCCCCGCCGCGCGCTCGG - Intergenic
1101771982 12:107760689-107760711 CGTGCACCCCGCCACGGGTTGGG + Exonic
1117882767 14:60328117-60328139 CTGCCGCCCCGCCTCGCGGCTGG + Intergenic
1124971766 15:34495870-34495892 CGTGCACCCCGCCTCGCTCTGGG + Intergenic
1126299992 15:47184582-47184604 CGGGCGGCGGGCCTCGCGGTCGG - Intronic
1136787647 16:32945293-32945315 CCTGCCCCCCGGCTCGCTGTGGG + Intergenic
1136882131 16:33908496-33908518 CCTGCCCCCCGGCTCGCTGTGGG - Intergenic
1137738603 16:50742645-50742667 CGTACGCCCCGCGGCGCGGTCGG - Intronic
1203089878 16_KI270728v1_random:1206950-1206972 CCTGCCCCCCGGCTCGCTGTGGG + Intergenic
1146403532 17:32518954-32518976 TGTGCGCCCCGCCTCGCTGCAGG + Intronic
1147148002 17:38497413-38497435 CCTGCCCCCCGGCTCGCTGTGGG + Intronic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1151612078 17:75182773-75182795 CCTTCGCCTCGCCGCGCGGTGGG - Intergenic
1160699216 19:498020-498042 CGTGCGCAACGCCTCGCTGTCGG + Exonic
1160966640 19:1749630-1749652 CGCGCCGCCCGCCTCGCGCTCGG - Intergenic
1161153662 19:2721603-2721625 CGCGCGCCCTCCCTCGGGGTGGG + Intronic
1165453845 19:35899876-35899898 CGCGCGCCCCGCCTCGGAGCAGG - Intronic
1165774358 19:38395992-38396014 CCCGCGCCCCGCCGCGCGCTGGG + Exonic
937359298 2:121217858-121217880 AGTCCACCCCGCCTCGTGGTGGG - Exonic
946386747 2:219388188-219388210 CGTCCGCCCCGCCTCTCGCCAGG + Intronic
946386824 2:219388429-219388451 CGTCCGCCCCGCCCCTCGCTAGG + Intronic
1170573870 20:17648152-17648174 CTTGCGTCCCACCTCGGGGTGGG - Intronic
1172277305 20:33686560-33686582 CGCGCGCCCCGCCCCGCCATTGG - Intergenic
1172468506 20:35174609-35174631 CGGGCGGCCAGCCTCGAGGTAGG + Intronic
1176548374 21:8211567-8211589 CGCACGCGCCGCGTCGCGGTGGG - Intergenic
1176556266 21:8255773-8255795 CGCACGCGCCGCGTCGCGGTGGG - Intergenic
1176567305 21:8394602-8394624 CGCACGCGCCGCGTCGCGGTGGG - Intergenic
1176575205 21:8438815-8438837 CGCACGCGCCGCGTCGCGGTGGG - Intergenic
1178518181 21:33266270-33266292 TGTGCCCCGCGCCTCGCGGGTGG + Intronic
1181520839 22:23448561-23448583 CCTGGGCCCCGCCTGGCTGTGGG - Intergenic
1181520854 22:23448594-23448616 CCTGGGCCCCGCCTGGCTGTGGG - Intergenic
1181520881 22:23448660-23448682 CCTGGGCCCCGCCTGGCTGTGGG - Intergenic
1181520896 22:23448693-23448715 CCTGGGCCCCGCCTGGCTGTGGG - Intergenic
1181520971 22:23448858-23448880 CCTGGGCCCCGCCTGGCTGTAGG - Intergenic
1181521001 22:23448924-23448946 CCTGAGCCCCGCCTGGCTGTGGG - Intergenic
1183649291 22:39145085-39145107 TGTGCGCCGCGCCCTGCGGTCGG - Intronic
1203253254 22_KI270733v1_random:127870-127892 CGCACGCGCCGCGTCGCGGTGGG - Intergenic
1203261309 22_KI270733v1_random:172951-172973 CGCACGCGCCGCGTCGCGGTGGG - Intergenic
961281431 3:125767817-125767839 CGGGCGGCCCTCCTCGCCGTGGG + Intergenic
961688714 3:128653240-128653262 CGTGCGCCCTCCCTCGCTCTCGG + Intronic
968178111 3:196568797-196568819 CGCGCGCCCCGCCTCACTGAGGG - Exonic
972726009 4:41746780-41746802 GGTGCGCACCGCTTCTCGGTCGG + Intronic
983940085 4:173528957-173528979 CCTGCGCCGCTCCTTGCGGTTGG + Exonic
984992695 4:185396574-185396596 CGCGGGCCCCGCCCCGAGGTGGG + Exonic
985675519 5:1229599-1229621 CGTGGGCACCACGTCGCGGTGGG - Intronic
1003871178 6:10404466-10404488 CGCCCGCCCCGCCCCGCGGCCGG - Intronic
1008932609 6:56955417-56955439 CCTGCGCCCCGCCCCGAGGTTGG + Exonic
1018191743 6:161315029-161315051 CGTGCGCCCCGCCGCCTTGTGGG - Intergenic
1019718690 7:2555166-2555188 CGTGCGTCCAGCCTCGGGGGTGG + Intronic
1020139624 7:5605444-5605466 CGTGGACCCCGCCTCGCTCTGGG + Exonic
1020308114 7:6850267-6850289 CTTACTCCCCGCATCGCGGTGGG + Intergenic
1033657006 7:143381375-143381397 CGTGCGCGCCGCGTCTCGGGTGG - Exonic
1034335855 7:150323227-150323249 CGCACCCCCCGCCTCGCAGTTGG - Intronic
1048981283 8:139704314-139704336 CGTGCGCCCTGCGCCGCGCTGGG - Intergenic
1049406328 8:142453213-142453235 CGTGCCCCCAGCCTCCCGGACGG - Intronic
1058467653 9:105244947-105244969 CGTGCGCCGCGTCGCGCGGCGGG + Intronic
1060734578 9:126058910-126058932 CCTGCGCCCCGCCTCGCTCCCGG + Intergenic
1061824986 9:133252414-133252436 CCTGCGCCCCGCCTCCCTGGGGG - Intronic
1062596279 9:137301324-137301346 CCTGCCCGCCGCCTCGCGGGTGG - Exonic
1203469656 Un_GL000220v1:111017-111039 CGCACGCGCCGCGTCGCGGTGGG - Intergenic
1203477477 Un_GL000220v1:154989-155011 CGCACGCGCCGCGTCGCGGTGGG - Intergenic
1189398900 X:40647189-40647211 GGTGGGCCCCGCATCGCGGAGGG + Intronic
1190225171 X:48539694-48539716 CCTGCGCCCCGGCACGAGGTGGG + Exonic
1190739630 X:53280615-53280637 TGTGGGCCCCGCCTTGGGGTGGG - Intronic