ID: 902921086

View in Genome Browser
Species Human (GRCh38)
Location 1:19666239-19666261
Sequence GCTGCTGGGCTGGCACGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 346}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902921080_902921086 -10 Left 902921080 1:19666226-19666248 CCTTCCTGCCCCTGCTGCTGGGC 0: 1
1: 0
2: 10
3: 108
4: 799
Right 902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG 0: 1
1: 0
2: 5
3: 42
4: 346
902921074_902921086 14 Left 902921074 1:19666202-19666224 CCTGGAGCCTCGCCGCTCTCGCC 0: 1
1: 0
2: 1
3: 21
4: 184
Right 902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG 0: 1
1: 0
2: 5
3: 42
4: 346
902921077_902921086 -7 Left 902921077 1:19666223-19666245 CCTCCTTCCTGCCCCTGCTGCTG 0: 1
1: 2
2: 18
3: 141
4: 1214
Right 902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG 0: 1
1: 0
2: 5
3: 42
4: 346
902921071_902921086 29 Left 902921071 1:19666187-19666209 CCCTAGTCCTGGGCGCCTGGAGC 0: 1
1: 0
2: 1
3: 10
4: 174
Right 902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG 0: 1
1: 0
2: 5
3: 42
4: 346
902921072_902921086 28 Left 902921072 1:19666188-19666210 CCTAGTCCTGGGCGCCTGGAGCC 0: 1
1: 0
2: 0
3: 21
4: 285
Right 902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG 0: 1
1: 0
2: 5
3: 42
4: 346
902921075_902921086 7 Left 902921075 1:19666209-19666231 CCTCGCCGCTCTCGCCTCCTTCC 0: 1
1: 1
2: 0
3: 46
4: 486
Right 902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG 0: 1
1: 0
2: 5
3: 42
4: 346
902921076_902921086 2 Left 902921076 1:19666214-19666236 CCGCTCTCGCCTCCTTCCTGCCC 0: 1
1: 2
2: 10
3: 181
4: 1836
Right 902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG 0: 1
1: 0
2: 5
3: 42
4: 346
902921073_902921086 22 Left 902921073 1:19666194-19666216 CCTGGGCGCCTGGAGCCTCGCCG 0: 1
1: 0
2: 1
3: 24
4: 231
Right 902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG 0: 1
1: 0
2: 5
3: 42
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902921086 Original CRISPR GCTGCTGGGCTGGCACGAGC TGG Exonic
900184413 1:1326222-1326244 GCTGTAGGGCTGGCACTTGCTGG - Intronic
900240611 1:1615723-1615745 GCTGCTGGGCCAGCGGGAGCGGG - Intronic
900289251 1:1916918-1916940 GGTGGTGGGCGGGCACGGGCAGG + Intronic
900486870 1:2926809-2926831 TGTGCTGGGCTGGGCCGAGCTGG + Intergenic
900744630 1:4352737-4352759 GCAGCAGGGCTGGCAGCAGCAGG - Intergenic
901057397 1:6455086-6455108 GGCGCTGGGCTGGCCAGAGCGGG - Intronic
901899007 1:12341932-12341954 TCTACTGGGCTGGCACAAGAAGG - Intronic
902476961 1:16693393-16693415 GGCGCTGGGCTGGCCAGAGCCGG + Intergenic
902482053 1:16717194-16717216 GGTACGGGGCTGGCAGGAGCTGG - Intergenic
902548931 1:17208000-17208022 GCAGCTGGGCTGGCAGCAGGAGG + Intronic
902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG + Exonic
903222349 1:21875884-21875906 GGTGCTGGGCTGGCCGGGGCTGG + Exonic
903340998 1:22654203-22654225 GATGATGGGCTGGCACAGGCAGG + Intronic
903374555 1:22857687-22857709 GATGATGGGCTGGCAAGATCGGG + Intronic
904006148 1:27364282-27364304 GCTGATGGGCTGGTACAGGCTGG - Exonic
904294665 1:29511593-29511615 GCTGCTGATCTGGCAAGAGGTGG + Intergenic
904915340 1:33966203-33966225 GCTGGTGGGCTGGCAGAATCTGG - Intronic
905268699 1:36772471-36772493 GCAGCTGGGATGGCAGGCGCCGG - Intergenic
905361726 1:37425458-37425480 TCTCCTGAGCTGGCACAAGCTGG - Intergenic
905685046 1:39901850-39901872 GCTGCCGGGCTGCCCCGAGCCGG - Exonic
907428593 1:54397207-54397229 GCAGCTGGGCTGCAAAGAGCTGG - Intronic
907541283 1:55216856-55216878 AGTGCTGGGCTGGCAACAGCAGG - Intergenic
907831822 1:58071430-58071452 GCTGCTGGGCTGCTAAGAGAAGG + Intronic
912381448 1:109250005-109250027 GCGGCGGGGCCGGCAGGAGCCGG + Exonic
912555947 1:110516098-110516120 GCTGCTGGGAAGGGAAGAGCAGG - Intergenic
914463940 1:147909500-147909522 GCTGCTGGGGTTGGAGGAGCGGG - Intergenic
914681732 1:149943684-149943706 GCTGCCAGGCTGGCAAGAGCAGG - Exonic
915145195 1:153792714-153792736 GATGCAGGGCTGGGACGAGGAGG + Intergenic
915571583 1:156747860-156747882 GAAGCTGGGGTGGCACGAGACGG - Intronic
915677414 1:157544497-157544519 GCTGATGGGCTGGAAGGAGCTGG + Exonic
917981247 1:180271111-180271133 GCAGCTGGGCTGGCAGGGGAGGG + Intronic
919758236 1:201079364-201079386 GCTGCTGGGAGGTCAGGAGCAGG - Intronic
919826485 1:201506979-201507001 GCGGCGGGGCTGGCAAGACCGGG + Intronic
920509521 1:206540530-206540552 GCTCCTGGGCTGGCCAGATCAGG + Intronic
920692845 1:208159876-208159898 GCTGGTGGGCTGGCACTTGGGGG + Intronic
921866752 1:220094438-220094460 GCTGCTGGGCCGCCAGCAGCCGG + Exonic
922729412 1:227942074-227942096 GCTGCTGGGGTGGCCCGGGCTGG - Intronic
923251427 1:232182445-232182467 GCTGCGGGGATGACACGAGATGG - Intergenic
924624044 1:245685653-245685675 TCTGCAGGGCTGGCACGATAGGG - Exonic
924727431 1:246683532-246683554 GCTGCTGCGCTGCCATGAGCGGG + Intergenic
1063011223 10:2023514-2023536 GCTGCTGTGCTGGCCCCAGAAGG - Intergenic
1063663164 10:8047585-8047607 GCTGCTGGGCTGACCCGAGCTGG + Intergenic
1063759451 10:9056785-9056807 GCTCCTGGGCTGGCGCCTGCTGG + Intergenic
1064712963 10:18145119-18145141 TCGGCTGGGCTGGGACCAGCTGG - Intronic
1066283645 10:33942663-33942685 ACTGCAGGGCTGGCACTAACAGG - Intergenic
1067078365 10:43200684-43200706 GCTGCTGGGCCAGCACCAGGGGG + Exonic
1067562704 10:47314927-47314949 GTTGCTGGGCTGGCGCAAACTGG + Intergenic
1069990108 10:72309968-72309990 ACAGCTGTGCTGGCAGGAGCGGG - Intergenic
1070378536 10:75858146-75858168 GCTGGTGGGCTGGTACGGGGGGG - Intronic
1070720959 10:78756829-78756851 GCTGCTGCGCTGTCATGAGCAGG - Intergenic
1070748097 10:78947301-78947323 GCTGCTGGGCTGGCAGGGGAGGG - Intergenic
1071598161 10:86942809-86942831 GGCGCTCGGCTGGGACGAGCTGG - Exonic
1071666458 10:87563740-87563762 GCTGCTTGGCTGGGATCAGCTGG + Intergenic
1072517716 10:96202284-96202306 GCTGCTGGGCTGGAAACAGAGGG + Intronic
1072710713 10:97714113-97714135 GCTGCTGGGCAAGCACGAGCTGG + Exonic
1072812964 10:98477842-98477864 GCTGCTGGTCTGACAGGAGGTGG - Intronic
1074082125 10:110176298-110176320 GCTGTTTGCCTGGGACGAGCTGG + Intergenic
1074098143 10:110331631-110331653 GCTGCTGGGCTGGCACTGCTGGG - Intergenic
1075654066 10:124149795-124149817 GCTGAAGGGCTGGCAAGAGGAGG + Intergenic
1075922273 10:126223881-126223903 GATGCTGGGATGGCTCTAGCTGG - Intronic
1076057341 10:127386467-127386489 GCTGCTGATCTGGCAGGAGGTGG - Intronic
1076156114 10:128206997-128207019 GCTGCTGGCCAGGCCTGAGCAGG + Intergenic
1076680442 10:132168850-132168872 CCTGCAGGGCTGGCCCGTGCAGG - Exonic
1076997738 11:307173-307195 GCTGCTGGGCTGTGTGGAGCGGG + Intergenic
1076999579 11:315948-315970 GCTGCTGGGCCGTGGCGAGCTGG - Intergenic
1077252673 11:1567500-1567522 GCTCCTGGGCAGGGAGGAGCTGG - Intronic
1077258008 11:1597810-1597832 GCAGCTGGACTGGCAGCAGCAGG + Exonic
1077259381 11:1607702-1607724 GCAGCTGGACTGGGAGGAGCAGG + Exonic
1077259416 11:1607921-1607943 GCAGCTGGGCTTGCAGCAGCTGG + Exonic
1077262562 11:1630499-1630521 GCAGCTGGACTGGCAGCAGCAGG - Exonic
1077426926 11:2484939-2484961 GCAGCTGGGGTTGGACGAGCAGG - Intronic
1077543295 11:3157757-3157779 CCTGCTGGGCTTGCAGCAGCCGG + Intronic
1077837576 11:5938001-5938023 GCTGCTGGGATGGCGGGAACTGG - Intronic
1077902153 11:6498102-6498124 TCTGCTGGGCTGGCCCATGCAGG + Exonic
1078087855 11:8244907-8244929 GCTTCTGGGCTGGTCAGAGCAGG - Intronic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1079107039 11:17578369-17578391 CCTGCTGGGCAGGCAGCAGCTGG - Exonic
1079359276 11:19756992-19757014 GCTGCTGGGCTGGACTGAGCTGG + Intronic
1081584809 11:44376943-44376965 CCTGATGGCCTGGCAGGAGCTGG - Intergenic
1081754143 11:45532669-45532691 TCTGGTGGGCTGGCTGGAGCTGG - Intergenic
1081802748 11:45870899-45870921 GCTGCCAGCCTGGCTCGAGCTGG - Exonic
1083083777 11:60121434-60121456 GCTGCTGATCTGGCAGGAGGTGG - Intergenic
1083262405 11:61530421-61530443 GGTGTGGGGCTGGCATGAGCAGG - Intronic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083920490 11:65779598-65779620 GCTGCTGGGCTGGGCCCTGCGGG - Exonic
1084597594 11:70126240-70126262 GCAGCTGGGATGGCAGGAGAGGG - Intronic
1084703759 11:70804139-70804161 GCTGCCTGGCTGGCAGGGGCAGG - Intronic
1084798831 11:71527656-71527678 GCAGCTGGACTGGCAGCAGCAGG - Exonic
1084803979 11:71566081-71566103 GCAGCTGGACTGGCAGCAGCAGG - Exonic
1084806431 11:71582400-71582422 GCAGCTGGACTGGCAGCAGCAGG + Exonic
1084806440 11:71582475-71582497 GCAGCTGGACTGGCAGCAGCTGG + Exonic
1089966813 11:122660099-122660121 GCTGCAGGGCTGGCTCAAGCAGG + Intronic
1090102535 11:123815299-123815321 GCTGCTGGGCTGGCAGGAGATGG - Intergenic
1091550034 12:1530239-1530261 GCTGGTGGGCAGGAGCGAGCCGG + Intronic
1091606103 12:1952798-1952820 GCAGCTGAGCTGGCAGGTGCTGG + Exonic
1091643769 12:2257537-2257559 GCTGCTGATCTGACAGGAGCTGG + Intronic
1091646087 12:2273513-2273535 GCTGCTGGGTTAGGACCAGCAGG + Intronic
1096007661 12:48185293-48185315 GCCCCTGGGCTGGGAGGAGCTGG + Exonic
1096571093 12:52523796-52523818 GGGGCTGGGGTGGCACGTGCAGG - Intergenic
1100539883 12:95548327-95548349 GGCGCGGGGCTGGCACGGGCTGG - Intronic
1102457114 12:113077745-113077767 GGAGCAGGGCTGGCCCGAGCTGG - Exonic
1102848834 12:116218843-116218865 GCTGCTGGGGTGGCTCAGGCTGG - Intronic
1103725336 12:122994928-122994950 GCTGCTGGAATGGCGTGAGCAGG + Exonic
1103992703 12:124809923-124809945 GGTGCTGGGCTGGGAGGAGGGGG - Intronic
1104538491 12:129640833-129640855 GCTGCTGAGCTGACAGGAGCTGG - Intronic
1105797829 13:23873859-23873881 GCTGCTGGGAAGGCACGTCCTGG + Intronic
1106406615 13:29480226-29480248 GAGGCTGGGCTGGCAGCAGCAGG + Exonic
1107104893 13:36632492-36632514 GCTGCTGGGATGGAAGGAGATGG + Intergenic
1107834774 13:44404543-44404565 GCTGCTGGGCTGGCAGGCTCTGG - Intergenic
1109183261 13:59240029-59240051 GCTGATGGGCTGACAGAAGCTGG + Intergenic
1110746100 13:79054943-79054965 GCTGCAGGCCTGGCAACAGCAGG + Intergenic
1113289406 13:108888428-108888450 CCTGCAGGGCTGGCGCCAGCAGG + Exonic
1113554042 13:111216767-111216789 GCTCCTGTGCCGGCACGAGCAGG + Intronic
1113661370 13:112108285-112108307 GCAGGTGGGGTGGCAGGAGCTGG - Intergenic
1114267487 14:21081533-21081555 TTTGCTCGGCTGGCAGGAGCTGG + Exonic
1118042936 14:61937084-61937106 GAAGCTGGGCTGGCTGGAGCAGG + Intergenic
1118350983 14:64972305-64972327 TCGGCTGGGCTGGCGCGAGGCGG + Intronic
1119539121 14:75427649-75427671 GCTGCCTGGCGGGCACAAGCCGG + Intergenic
1119639264 14:76302495-76302517 GCTGCAGGGCTGGATGGAGCCGG + Intergenic
1121552648 14:94814022-94814044 ACTGCTGGGCTGACAGGTGCAGG + Intergenic
1122111203 14:99504045-99504067 GCAGCTGGGCTGGGCCGGGCTGG - Exonic
1122315527 14:100824174-100824196 GCTGCAGGGCTGACGCGGGCTGG + Intergenic
1122425229 14:101601845-101601867 ACTGCTGGGCTGCCAGGGGCCGG - Intergenic
1122913342 14:104844363-104844385 GCTGCCGGGCTGGAAACAGCAGG - Intergenic
1123084424 14:105711030-105711052 TGGGCTGGGCTGGGACGAGCTGG - Intergenic
1123084495 14:105711245-105711267 TGGGCTGGGCTGGGACGAGCTGG - Intergenic
1124612805 15:31220087-31220109 GCTGCTGGTCTGACAGGAGGCGG - Intergenic
1124629580 15:31328661-31328683 GCCGCTGGGCTGGCGGGGGCGGG - Intronic
1125860736 15:42997126-42997148 GCTGCTGATCTGGCAGGAGGCGG - Intronic
1128160954 15:65422698-65422720 GCTGCGGGGCTGGCTCAAGCCGG - Intronic
1129169221 15:73797734-73797756 GCTGCAGGACTGGCAGGAGCGGG + Intergenic
1129291963 15:74575148-74575170 GCTCCTGGGTTTGCACCAGCTGG - Intronic
1129524237 15:76203997-76204019 GCTGCTGGGATGGCAGCGGCGGG - Exonic
1132105414 15:99059350-99059372 GCTGCAGGGTGGGCACGGGCCGG - Intergenic
1132380939 15:101366386-101366408 GCGGAGGGGCTGGCACAAGCAGG + Intronic
1132716288 16:1291743-1291765 GCAGCTGGTCAGGCACGGGCAGG - Intergenic
1135281723 16:21158725-21158747 GCTGCTCGGCGGTCAGGAGCAGG + Exonic
1136031872 16:27509257-27509279 ACTCCTGGGCTGTCACAAGCTGG + Intronic
1138352581 16:56353819-56353841 CCTGCTGGGCTGCCCAGAGCTGG + Intronic
1138508179 16:57489420-57489442 GCTGCTGGTCTGACAGGAGGCGG + Intergenic
1139593238 16:67944527-67944549 GCTCCTGGGCTGGGCCGGGCCGG + Exonic
1139667992 16:68471712-68471734 TCTACTGGGCAGGCACGAGCTGG - Intergenic
1139917751 16:70438824-70438846 GTTGCCGGGCTGGAACGGGCCGG + Intronic
1141429392 16:83963493-83963515 GCTCCAGGGCTGGCAGGGGCTGG - Intronic
1141558913 16:84853913-84853935 GCTCCTGGGCTGTGAAGAGCAGG - Intronic
1141638980 16:85330120-85330142 CCTGCTGTGCTGGGCCGAGCAGG + Intergenic
1141804598 16:86334546-86334568 ACTCCTGGGCTGGGATGAGCAGG + Intergenic
1142057230 16:88005668-88005690 GCTGCTGGGCTCGCTGGAGATGG - Intronic
1142245763 16:88969418-88969440 GCTGCGGGGGTCGCAAGAGCGGG + Intronic
1142274135 16:89107097-89107119 GCTTCTGAGGTGGCAGGAGCAGG - Intronic
1144348695 17:14373434-14373456 GCAGCTGGGCTGGGCTGAGCAGG - Intergenic
1144800288 17:17921614-17921636 CCTGCTAGGCTGGGACAAGCTGG - Intronic
1144818580 17:18054612-18054634 GCTTCGGGGCTGGCATGAGATGG + Intronic
1144837247 17:18163130-18163152 GATCCTGGGCTGGCACGTGTAGG - Intronic
1145235309 17:21203758-21203780 GCTGCTGGGTGGTCAGGAGCTGG - Intronic
1145248498 17:21284931-21284953 GCTGGCGGGCTGGCTCGAGGCGG - Exonic
1146398867 17:32488178-32488200 TCTGCAGGGCTGGCAGGACCAGG + Exonic
1147419078 17:40313120-40313142 GCTGCTGGACAGGCTCCAGCAGG + Intronic
1147506875 17:41026901-41026923 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147506878 17:41026931-41026953 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147506892 17:41027039-41027061 GCTGCGTGGCTGGCAGCAGCTGG + Exonic
1147506895 17:41027069-41027091 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147507165 17:41030022-41030044 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147507556 17:41034597-41034619 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147507569 17:41034705-41034727 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147507572 17:41034735-41034757 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147508203 17:41041251-41041273 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147508207 17:41041281-41041303 GCAGCGTGGCTGGCAGGAGCTGG + Exonic
1147508210 17:41041311-41041333 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147524857 17:41212917-41212939 GCAGCAGGGCTGGCAGCAGCTGG - Intronic
1147524888 17:41213095-41213117 GAAGCTGGGCTGGCAGCAGCTGG - Intronic
1147528994 17:41255783-41255805 GCAGCAGGGCTGGCAGCAGCTGG - Exonic
1147530469 17:41271618-41271640 GGAGCTGGGCTGGCAGCAGCTGG - Intergenic
1147530487 17:41271723-41271745 GCAGCAGGGCTGGCAGCAGCTGG - Intergenic
1147530883 17:41275990-41276012 GGAGCTGGGCTGGCAGCAGCTGG - Exonic
1148105862 17:45118492-45118514 GCTGCAGGGGTGGCAGGAGAGGG + Exonic
1148793187 17:50184980-50185002 GGTGCTGGGCGGGCAGGAGCGGG + Exonic
1150266254 17:63834199-63834221 GCTGCAGGATGGGCACGAGCGGG - Exonic
1150765535 17:67998895-67998917 GCTCCTGGGGTGGCACCAGCTGG + Intergenic
1151724230 17:75875330-75875352 GCTGCTGGGCTGGTCCCAGCAGG - Intronic
1151973631 17:77471785-77471807 GCTGGAGGGCTGGCACGGGCTGG + Intronic
1152057487 17:78041364-78041386 TCTGCTGGGCTGGCACGGGCAGG + Intronic
1152315785 17:79579587-79579609 GCTCCGGGGCTGGCGGGAGCTGG + Intergenic
1152554484 17:81046101-81046123 GCAGCTGGGCGTGCAGGAGCCGG - Intronic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1154492791 18:14934169-14934191 GCTGCTGGGCTGGCTCCGCCAGG + Intergenic
1158378432 18:56900765-56900787 GCTGATGGGCTGGTCCAAGCTGG + Intronic
1160163358 18:76491634-76491656 GTTGCTGGGCTGCCAGGAGGAGG - Intronic
1160342339 18:78100456-78100478 TCTGCAGGGCTGGCCCGAGGGGG - Intergenic
1161042140 19:2115979-2116001 GCAGCTGGGCTGCCAGGCGCAGG + Intronic
1161058751 19:2203743-2203765 GCTGGAGGGCTGGCAGGGGCTGG - Intronic
1161625982 19:5327083-5327105 GCTGCCACGCTGGCAGGAGCTGG - Intronic
1161636565 19:5392968-5392990 GGTGCTGGTCTGGCTCGGGCAGG - Intergenic
1161961627 19:7526609-7526631 GCTGGTGGGCGGGCAGGTGCTGG + Intronic
1161961632 19:7526627-7526649 GCTGGTGGGCAGGCAGGTGCAGG + Intronic
1161961649 19:7526681-7526703 GCTGGTGGGCGGGCAGGTGCAGG + Intronic
1161988845 19:7672584-7672606 GCTGCTGGTCTGACAGGAGGTGG + Intergenic
1162030139 19:7913672-7913694 CCTGCTGGGGTGGCCAGAGCAGG + Exonic
1162397477 19:10425433-10425455 GGTGCTGGGCAGCCAGGAGCTGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163616851 19:18334270-18334292 GCTGCTGGTCTGGCAGAAGGCGG - Intergenic
1163723456 19:18909363-18909385 GCGGCAGGGCTGGCTCCAGCTGG + Intronic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1164562013 19:29299139-29299161 GCAGGTGGGCTGGCAGGAGGTGG - Intergenic
1164623499 19:29711875-29711897 GATGCTGGCCTGGCTGGAGCAGG - Intronic
1165229671 19:34379038-34379060 GCCTCTGGGCTGGGAAGAGCAGG + Intronic
1165873391 19:38989081-38989103 GCGGCTGGACTGGCATCAGCCGG + Intergenic
1166762534 19:45234203-45234225 GCTGCTGCACTGGCACAATCAGG - Exonic
1167612587 19:50514569-50514591 TCTCCTGGGCTGACGCGAGCTGG - Intronic
1168288157 19:55344658-55344680 GCAGCTGTGGTGGCAGGAGCAGG + Intronic
1168650134 19:58087297-58087319 GCAGGTGGGTGGGCACGAGCAGG - Exonic
1202710977 1_KI270714v1_random:19219-19241 GGCGCTGGGCTGGCCAGAGCCGG + Intergenic
925891442 2:8438209-8438231 GCTGCTGATCTGGCAGGAGGCGG - Intergenic
925931201 2:8709491-8709513 CCTGCTGTGCAGGCAGGAGCAGG + Intergenic
927270163 2:21198891-21198913 CCTGCTGGGCAGGGAAGAGCAGG - Intergenic
927327176 2:21818517-21818539 TCTGCTGGGCTGGGAACAGCCGG + Intergenic
927490772 2:23519461-23519483 GCTGCGGGGCTGGCCAGAGTTGG - Intronic
927683433 2:25154962-25154984 GATGCAGGGCTGGCAGGAGGTGG + Exonic
927980447 2:27371322-27371344 GCTCCTGGGGCTGCACGAGCAGG + Exonic
928199718 2:29239880-29239902 GCTGCTGGGTTGGCAGGAAGGGG - Intronic
928204225 2:29272643-29272665 TCTGCTGGGCTGGAACGAGGTGG - Intronic
929877258 2:45807053-45807075 GATTCAGGGCTGGCACGGGCTGG + Intronic
929895884 2:45960572-45960594 GCTGCTGGTCTGACAGGAGGTGG + Intronic
930046222 2:47175738-47175760 GCTGCTCTGCTGGCACCTGCAGG - Intronic
932783086 2:74575482-74575504 GCAGCTGGACTGGGATGAGCTGG - Exonic
934947787 2:98554462-98554484 GCAGGTGGACTGGCACGAGGAGG + Exonic
935901882 2:107801712-107801734 GCTGTGGGGCTGGCAGCAGCGGG - Intergenic
937062524 2:118991111-118991133 GGTACTGAGCTGGCACCAGCTGG + Intronic
937160938 2:119760190-119760212 GCTGCTGGGCAGCCGCGGGCCGG - Exonic
938392511 2:130916548-130916570 ACTGCAGGGCCGGCAGGAGCGGG + Intronic
940775181 2:157876650-157876672 GCGGCGGGGCAGGCCCGAGCTGG + Intergenic
941308239 2:163897531-163897553 TCTGCTTGGCTGGGACCAGCAGG + Intergenic
942278965 2:174342303-174342325 GCGGCTGGGCAGGCAGGAGCCGG + Intergenic
943988935 2:194660905-194660927 GCTGCTGGACTGGCATGTGCAGG - Intergenic
945157050 2:206849955-206849977 GCTGCTGACCTGGCAGGAGGTGG + Intergenic
946322174 2:218960483-218960505 GCTGCAGGGCTGGCAAGACCAGG + Exonic
947043266 2:225949012-225949034 GCTGCTTGGCTGGGATCAGCTGG + Intergenic
948778244 2:240301118-240301140 TCTCATGAGCTGGCACGAGCTGG - Intergenic
1169002597 20:2178788-2178810 ACTTCTGGGCTGGCCCGTGCAGG + Intergenic
1170324440 20:15140648-15140670 GAGGCTGGGCTGGCAATAGCTGG + Intronic
1170744035 20:19082169-19082191 GCTGCTGATCTGGCAGGAGGTGG - Intergenic
1172117697 20:32582399-32582421 GCAGCTGGGCCGGCAGGACCTGG + Intronic
1172656709 20:36542234-36542256 GCTGGAGGGCTGGGAAGAGCAGG - Intronic
1173684006 20:44910103-44910125 GCTGCGGGGCAAGCAGGAGCCGG - Exonic
1174370400 20:50083203-50083225 GCTGCTGGGCTGGCGGCTGCCGG + Intronic
1175401796 20:58704253-58704275 GGAGCTGGGCTGGCTCCAGCCGG - Intronic
1175777716 20:61663588-61663610 GCTGCTGGGACGGCAGGACCGGG + Intronic
1175903123 20:62367633-62367655 GCCCCTGGGCTGGGAGGAGCTGG - Intergenic
1175916966 20:62430518-62430540 GCTGCAGGGCTGGCCTGACCTGG - Intergenic
1175983503 20:62753018-62753040 GGCGCTGGGCTGGCAGGTGCAGG + Intronic
1176050919 20:63119375-63119397 TTTGCTGGGCTGGCAAGTGCAGG + Intergenic
1176062366 20:63178085-63178107 GCTCCTGGGTCGGCACGGGCAGG + Intergenic
1176150835 20:63589991-63590013 GCCGCAGGGCTGGCTCGGGCAGG - Exonic
1178417068 21:32412682-32412704 GCGCCTGGGCTGGCCCGCGCAGG + Exonic
1179573393 21:42291650-42291672 CCTCCTGGGCTGGCACCTGCAGG - Exonic
1179640548 21:42744930-42744952 GTGTCTGGGCTGGCACCAGCGGG - Intronic
1179926831 21:44539365-44539387 GCAGCTGGCCTGGCAGGAGGAGG + Exonic
1179929533 21:44558152-44558174 GCAGCTGGGCTGGCAGGTGGAGG + Exonic
1179931675 21:44574909-44574931 GCAGCTGGGTTGGCAGGAGGAGG - Exonic
1179934095 21:44591483-44591505 GCAGCTGGGCTGGCAGGAGGAGG + Exonic
1179935542 21:44601616-44601638 GCAGCTGGCCTGGCAGGAGGAGG - Exonic
1179937078 21:44612795-44612817 GCAGCTGGGCTGGCAGGAGGAGG - Exonic
1179940790 21:44638055-44638077 GCAGCTGGGCTGGCAGGAGGAGG - Exonic
1179942144 21:44647237-44647259 GCAGCTGGACTGGCAGGAGGAGG - Exonic
1179948723 21:44697854-44697876 GCAGCTTGGCTGGCAGGAGGAGG - Exonic
1179949664 21:44702683-44702705 GCAGCTGGGCTGGCAGGAGAAGG - Intronic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181584448 22:23845361-23845383 GCTGCGGAGCTGGCACAGGCAGG + Intergenic
1181777847 22:25172332-25172354 GCTCCTGGGGTGGCCCGAGGAGG - Intronic
1183332480 22:37228928-37228950 GGGGCTTGGCTGGCAAGAGCAGG + Intronic
1183396157 22:37572004-37572026 GCAGCTGGGTTGGCATGAGGTGG - Intronic
1183543202 22:38441613-38441635 GATGCTCGGCTGGCCCCAGCAGG + Intronic
1183585275 22:38749816-38749838 ACTGGTGGGCTGGCACCACCTGG - Exonic
1183704145 22:39466597-39466619 GCAGCTGGGCTGGAAGGGGCAGG - Intronic
1183780337 22:39995153-39995175 GCTGCTGGGCGGCGGCGAGCAGG + Exonic
1184189121 22:42883203-42883225 GCTGCTCTGCTGGCAGGAGCAGG - Intronic
1184523800 22:45009858-45009880 GCGGCTGGGCGGGCGCGCGCGGG - Intronic
1184889298 22:47369715-47369737 CCAGCTGGGCAGGCACGGGCAGG - Intergenic
1185027743 22:48425267-48425289 CCTGCTGGGCTGGTCCAAGCAGG - Intergenic
1185408741 22:50672155-50672177 GCTGGTGGGTTGGCAGGAGGCGG + Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
952764644 3:36944236-36944258 GCTGCTGGGCTGGCTCAAACTGG - Intronic
952968953 3:38638536-38638558 GCTCCTGGCCTGGCAAGACCAGG + Intronic
953389818 3:42527622-42527644 GAAGCTGGCCTGGCAGGAGCTGG - Intronic
953392400 3:42541068-42541090 TCTGCTGTGCTGGCAGGAGTGGG + Intergenic
953715914 3:45316928-45316950 TCTCCTGAGCTGGCACAAGCTGG + Intergenic
954200847 3:49022265-49022287 GGTGCTGGGCTGGCAGTCGCCGG - Intronic
954304576 3:49718754-49718776 GCTACAGCGCTGGCACCAGCGGG - Exonic
954314821 3:49795452-49795474 TCTGGTGGGCTGGCAGGAGTGGG - Intronic
955134308 3:56200749-56200771 GCTCCTGAGCTGGTACGACCTGG - Intronic
959671332 3:108980835-108980857 GCTACTGGGCTGGAGTGAGCAGG + Intronic
960960452 3:123067156-123067178 GCTGCTGGGATGGCGCGGGCCGG + Exonic
961029546 3:123589884-123589906 GCTGTTGGTCTGGCAGGAGGTGG + Intergenic
961385085 3:126518643-126518665 GCAGCTGGGCTTCCACGTGCGGG - Intergenic
961469198 3:127100850-127100872 GCTGATGGGATGGCCTGAGCAGG + Intergenic
962278624 3:134033754-134033776 GCTGCTGGGGAGGCAAGAGAAGG + Intronic
962810538 3:138955544-138955566 GCTGTTGGGGTGGTACAAGCAGG + Intergenic
964313252 3:155416747-155416769 GATGTTGGGCTGGCATGGGCTGG - Intronic
965363847 3:167774618-167774640 GCTGCTGGTCTGACAGGAGGTGG - Intronic
966861723 3:184234304-184234326 GCTGCAGAGCTGGCATGAGGGGG - Exonic
968655296 4:1775964-1775986 GCTGCTCGGCTGCCCCGGGCAGG + Intergenic
969529081 4:7719852-7719874 CCTGCTCTGCTGGCAGGAGCTGG + Intronic
969595963 4:8149431-8149453 GCTGCAGAGCAGGCAGGAGCAGG + Intronic
970585673 4:17512055-17512077 GGAGCCGGGCTGGCAGGAGCAGG - Exonic
977867692 4:102049596-102049618 GCAGCTAGGCAGACACGAGCAGG + Intronic
982145340 4:152382578-152382600 GCTGTTTGACTGGCAGGAGCAGG - Intronic
982485811 4:155964532-155964554 GCTGCTGGGCTGGAGGGAGTGGG - Intergenic
982767875 4:159368741-159368763 GCTGCTGGTCTGACAGGAGACGG - Intergenic
983060347 4:163153020-163153042 GCTGCTGGGCTGGCACTGCTGGG - Intronic
985911633 5:2888197-2888219 GATGCTGGGCTGGTAAGTGCTGG - Intergenic
988504223 5:31807786-31807808 GATGCTGGGCTGGCAGGAGGGGG + Intronic
993183471 5:84585472-84585494 GCTGCTGATCTGGCAGGAGGTGG - Intergenic
994769779 5:103966512-103966534 GCTGCTGGGCTGGCACTGCTGGG + Intergenic
994985184 5:106924098-106924120 GCTGCTGGTCTGACAGGAGGTGG - Intergenic
997740888 5:136252769-136252791 GCTGCTGATCTGACAGGAGCTGG + Intronic
999430706 5:151522855-151522877 ACTGATGGGCTGGCACGCGCAGG + Intronic
1002296964 5:178237091-178237113 GCTGCTGGGCAGGCTGAAGCGGG - Intergenic
1002671275 5:180869670-180869692 GCAGCTGGGCTTGAACCAGCAGG - Intergenic
1002743208 5:181449067-181449089 GCTGCTGAGATGGCACCCGCGGG + Intergenic
1002743225 5:181449208-181449230 GCTGCTGAGATGGCACCCGCGGG + Intergenic
1003070231 6:2939805-2939827 GCTGGTGGGCTGGCACTATGGGG - Intergenic
1007391614 6:41552694-41552716 GCAGCTGGGCTAGCTCGGGCCGG + Intronic
1008092117 6:47304498-47304520 GCTTCTGGGCTGGCTCTGGCAGG - Intronic
1010613393 6:77984336-77984358 CCTGCTTGGCTGGTATGAGCTGG + Intergenic
1013309224 6:108878324-108878346 TGAGCTGGGCTGGCAGGAGCAGG + Intronic
1014783978 6:125597175-125597197 GCTGCTGGGGTGGGAGAAGCTGG - Intergenic
1018758791 6:166872419-166872441 GCAGCTGGGCTGGAGGGAGCTGG + Intronic
1018894343 6:168002967-168002989 GCTGCTGGTCTGACAGGAGGTGG + Intronic
1018923802 6:168193337-168193359 GGAGATGGGCTGGCAGGAGCGGG + Intergenic
1019302130 7:311012-311034 GATGCTGGGCTGCCACGATCAGG + Intergenic
1019641339 7:2105397-2105419 TCTGCTGGCCTGGCAGCAGCAGG + Intronic
1024075609 7:45816453-45816475 GCTGCTGGGGCAGCATGAGCAGG - Intergenic
1025051844 7:55739343-55739365 GCTGCTGGGGAAGCATGAGCAGG + Intergenic
1026231624 7:68488848-68488870 GCTGCAGGGCTGCCAAGGGCTGG + Intergenic
1026479057 7:70763171-70763193 GCTGCGGGGCAGGCTGGAGCTGG - Exonic
1032293549 7:130613264-130613286 GCTGCTGGTCTGGCAGGAGGCGG + Intronic
1032425612 7:131820068-131820090 GGTGCTTGGCTGCCAGGAGCTGG + Intergenic
1034514802 7:151567482-151567504 GCTGCAGGCCTGGCACGTGGGGG + Intronic
1034517526 7:151592215-151592237 CCTGCTGGGCTGGCCCCTGCTGG + Intronic
1038415138 8:27389571-27389593 GCCTCTGAGCTGGCAGGAGCTGG + Intronic
1039070716 8:33647176-33647198 GCTGCTGGTCTGACAGGAGGCGG + Intergenic
1039435440 8:37556526-37556548 GCTCCAGGGCTGGCTGGAGCTGG - Intergenic
1042928466 8:73990507-73990529 GCTGCTGGTCTGACAGGAGCTGG - Intergenic
1045084829 8:98671010-98671032 TTTGCTGGGCTCGCAGGAGCAGG - Intronic
1045290685 8:100830117-100830139 GCTGCTGAGCTGACAGGAGGTGG - Intergenic
1047408515 8:124605259-124605281 GCTGCTTCGCTGGCAGGAGCTGG - Intronic
1048511905 8:135070526-135070548 CCAGCTGCTCTGGCACGAGCAGG - Intergenic
1049044158 8:140136352-140136374 GCTGCCTGGCAGGCACAAGCAGG + Intronic
1049052520 8:140210142-140210164 TCTGCTAGGCTGGCACGCCCAGG - Intronic
1049168148 8:141139798-141139820 GCTGCTGGGAAGGCAGGAGCAGG - Intronic
1049221580 8:141431116-141431138 CCTGCTGGGCTGGGCAGAGCAGG - Exonic
1049368022 8:142250092-142250114 GCTGCCGGCCTGGCTCCAGCAGG - Intronic
1049418020 8:142504384-142504406 CCTGCTGGGCTGGCCTGTGCAGG + Intronic
1049603246 8:143517791-143517813 GGTGCGGGGCAGGCAGGAGCGGG - Intronic
1049622940 8:143606724-143606746 CCTGCTGGGCAGGCCCCAGCAGG + Intronic
1050081511 9:1920566-1920588 GCTGCTGGTCTGACCCCAGCAGG - Intergenic
1050318317 9:4425739-4425761 CCTGCTGGGCAGTCCCGAGCAGG - Intergenic
1052128475 9:24809703-24809725 TCTTCTGGGCTGGCATGCGCTGG - Intergenic
1053418349 9:37960971-37960993 GCTGCTGGTCTGGCAGGAGCTGG + Intronic
1055247505 9:74264644-74264666 GCTGCTGATCTGGCAGGAGGTGG + Intergenic
1055621061 9:78125692-78125714 GCTGCTGGTCTGGCGCCACCCGG - Intergenic
1056189187 9:84167905-84167927 GCTGCTGATCTGGCAGGAGGTGG - Intergenic
1057042487 9:91857668-91857690 TCTTCTGGGCCGGCAGGAGCAGG + Intronic
1057481228 9:95447149-95447171 GGTGATGGGCTGGCAGTAGCCGG + Exonic
1057481780 9:95450320-95450342 TCTGCTGGGTTTTCACGAGCGGG - Intronic
1057520674 9:95757760-95757782 GCTCCAGCGCTGGCACAAGCTGG + Intergenic
1060196281 9:121625631-121625653 GCTGATGGGATGGCAGGATCAGG + Intronic
1060295045 9:122337632-122337654 GCAGCTGGGCTGGCAGGGGAGGG + Intergenic
1060629382 9:125142928-125142950 GGAGCTGGGCTGTGACGAGCAGG - Intronic
1061263779 9:129494204-129494226 GCAGCTGGGGTGGCCAGAGCTGG - Intergenic
1061642316 9:131968861-131968883 GCTGCTGAGCTGACAGGAGGTGG - Intronic
1061674534 9:132208335-132208357 GCTGCAGGGCTGGCGTGATCTGG - Intronic
1061844250 9:133378029-133378051 GCTGCTGAGCTGACAGGAGGTGG + Intronic
1061976631 9:134071359-134071381 GCTGCTGATCTGACAGGAGCCGG + Intergenic
1062044288 9:134417947-134417969 TCTCCTGGGCTGGCTCCAGCTGG + Intronic
1062096354 9:134705971-134705993 GCTGCTGTGATGGCAGGTGCAGG - Intronic
1062442676 9:136578189-136578211 GCTGCTGGCCTGGCACCTCCCGG + Intergenic
1062601364 9:137320008-137320030 GGTGCAGGGCTGGCAGGAGCGGG - Intronic
1185680703 X:1886576-1886598 ACTGCTGGGCTGGGAGGAGAAGG - Intergenic
1186626421 X:11298658-11298680 GCTGCTGAGCTGGCACCACTGGG - Exonic
1190598773 X:52069191-52069213 GCTGCTGTGCTGGCAGCAGTAGG - Exonic
1190610051 X:52184882-52184904 GCTGCTGTGCTGGCAGCAGTAGG + Exonic
1192497640 X:71626779-71626801 GCTGCTGGGCTTCCAGGAACAGG + Intergenic
1192795058 X:74420070-74420092 GCTACTCGGCTTCCACGAGCGGG - Intergenic
1196628044 X:117900732-117900754 ACTGCTGGCCTGGCACTGGCAGG + Intronic
1196765131 X:119236156-119236178 GCTGCGGGGCGGGACCGAGCAGG + Intergenic
1198065090 X:133088433-133088455 GCTGCTGAGCTGACAGGAGGTGG + Intronic
1198267304 X:135021862-135021884 GGGGCTGAGCTGGCACGAGAGGG + Exonic
1199792943 X:151171921-151171943 GCTGCTGGGATGGGAGGAGCAGG + Intergenic
1200070645 X:153527372-153527394 GCTGCTGGGCAGGCCCGGGCTGG + Intronic
1200110190 X:153737018-153737040 GCTGCTGGTCAGGAACCAGCTGG + Intronic
1200742411 Y:6868330-6868352 GCTGCTGAGCTGGCACCACTGGG + Exonic
1201707746 Y:16955293-16955315 GCTGCTGGGGTGGCAGGTACTGG - Intergenic