ID: 902923174

View in Genome Browser
Species Human (GRCh38)
Location 1:19679317-19679339
Sequence GCCGCAGCTCGGGCTCCGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 6, 3: 19, 4: 174}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902923174_902923183 12 Left 902923174 1:19679317-19679339 CCCCGCGGAGCCCGAGCTGCGGC 0: 1
1: 0
2: 6
3: 19
4: 174
Right 902923183 1:19679352-19679374 GCATCCCCACGAACTGACCCGGG 0: 1
1: 0
2: 0
3: 7
4: 83
902923174_902923182 11 Left 902923174 1:19679317-19679339 CCCCGCGGAGCCCGAGCTGCGGC 0: 1
1: 0
2: 6
3: 19
4: 174
Right 902923182 1:19679351-19679373 GGCATCCCCACGAACTGACCCGG 0: 1
1: 0
2: 0
3: 9
4: 58
902923174_902923189 19 Left 902923174 1:19679317-19679339 CCCCGCGGAGCCCGAGCTGCGGC 0: 1
1: 0
2: 6
3: 19
4: 174
Right 902923189 1:19679359-19679381 CACGAACTGACCCGGGCTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 62
902923174_902923190 23 Left 902923174 1:19679317-19679339 CCCCGCGGAGCCCGAGCTGCGGC 0: 1
1: 0
2: 6
3: 19
4: 174
Right 902923190 1:19679363-19679385 AACTGACCCGGGCTTGGGGCTGG 0: 1
1: 0
2: 2
3: 9
4: 254
902923174_902923193 30 Left 902923174 1:19679317-19679339 CCCCGCGGAGCCCGAGCTGCGGC 0: 1
1: 0
2: 6
3: 19
4: 174
Right 902923193 1:19679370-19679392 CCGGGCTTGGGGCTGGCCAATGG 0: 1
1: 0
2: 0
3: 19
4: 235
902923174_902923179 -10 Left 902923174 1:19679317-19679339 CCCCGCGGAGCCCGAGCTGCGGC 0: 1
1: 0
2: 6
3: 19
4: 174
Right 902923179 1:19679330-19679352 GAGCTGCGGCCGCATCCACTTGG 0: 1
1: 0
2: 0
3: 6
4: 91
902923174_902923188 18 Left 902923174 1:19679317-19679339 CCCCGCGGAGCCCGAGCTGCGGC 0: 1
1: 0
2: 6
3: 19
4: 174
Right 902923188 1:19679358-19679380 CCACGAACTGACCCGGGCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
902923174_902923186 17 Left 902923174 1:19679317-19679339 CCCCGCGGAGCCCGAGCTGCGGC 0: 1
1: 0
2: 6
3: 19
4: 174
Right 902923186 1:19679357-19679379 CCCACGAACTGACCCGGGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902923174 Original CRISPR GCCGCAGCTCGGGCTCCGCG GGG (reversed) Exonic
900166635 1:1246627-1246649 GCCGCAGCTCGTGCTCCTCGGGG - Exonic
901324419 1:8358373-8358395 GCCGCAGCTGGGGGCCCGCCAGG + Exonic
901832104 1:11898887-11898909 GCCGCAGCACGGGCACCAGGGGG + Intergenic
901886974 1:12230191-12230213 GCCGCCGCTAGGGCTCCGCCTGG + Intronic
902923174 1:19679317-19679339 GCCGCAGCTCGGGCTCCGCGGGG - Exonic
903628249 1:24746032-24746054 GCCGCAGTTCGGGCTCCGGGCGG - Intronic
903646775 1:24900862-24900884 GAGGCAGCTGGGGGTCCGCGGGG + Exonic
905223405 1:36464289-36464311 GCCGCGGCGCGGGCCCCGCGGGG - Exonic
906103761 1:43279523-43279545 GCCCCAGCTCGGGCACCCTGTGG + Intergenic
906673606 1:47677554-47677576 ACCTCAGCTCGGGAACCGCGGGG - Intergenic
910981113 1:92961154-92961176 GCCGCGGCGCGGGAGCCGCGAGG + Intronic
912363494 1:109113951-109113973 GCCTCCTCTCTGGCTCCGCGCGG - Intronic
915345414 1:155194705-155194727 GCTGCGCCTCGGGCGCCGCGCGG - Intergenic
915549772 1:156625275-156625297 CCCGCAGCGCGGCCTCGGCGTGG - Exonic
920071388 1:203305513-203305535 GCCGCTGCTCGGGCTCTGCCCGG - Intronic
920641105 1:207752477-207752499 GCTTCACCTCGGGCTCTGCGTGG - Intronic
922460264 1:225810212-225810234 GACGCGGTTCGGGCTCCGCGCGG + Intronic
1063371428 10:5525214-5525236 CCCGCAGCTCGGCCTCCGTGGGG - Exonic
1067472950 10:46549387-46549409 GCAGCAGCTGGGGCGCCGCAGGG + Exonic
1069744317 10:70705374-70705396 GCCCGAGCTCGGGCTCTCCGTGG + Intronic
1070862335 10:79683240-79683262 GCAGGAGCTCGGGCTCTGTGTGG + Intergenic
1073325960 10:102644108-102644130 GCCGGAGCCCGGGGTCTGCGGGG - Intergenic
1073577495 10:104638966-104638988 GCCGAAGCTCGGGGTTCGGGAGG - Intergenic
1076848998 10:133083854-133083876 GCCGCAGCTCAGGCCCCAAGGGG + Intronic
1077503125 11:2918131-2918153 GCCGCAGCTGGGACTCTGCCAGG - Intronic
1078334092 11:10450618-10450640 GCCGCCTCCTGGGCTCCGCGGGG - Intronic
1083682833 11:64359192-64359214 CGCGCGGCTCGGGCTCCGGGCGG - Exonic
1083811193 11:65107909-65107931 GCTGCAGCACGGCCTGCGCGCGG - Exonic
1091718556 12:2795945-2795967 CCCGCAGCCCTGGCTCCGGGAGG - Intronic
1096482415 12:51951586-51951608 GCCGCGGCGCCGGCTCCGCCGGG + Intergenic
1097251241 12:57633172-57633194 GCGGCTGCTTCGGCTCCGCGCGG + Exonic
1101144747 12:101830699-101830721 GCGGCGGCTCAGGCTCCTCGGGG - Exonic
1101910454 12:108857316-108857338 GCGGCTGCGCGGGCTCCTCGGGG - Intronic
1103188503 12:118981302-118981324 GCTGCAACTCGGTCGCCGCGGGG + Intergenic
1104049658 12:125186820-125186842 GCCGCCGCTCGGGCTCCTGCTGG + Intronic
1104376210 12:128267181-128267203 GCCGCTGCTCGCGCTCCGGCCGG - Intergenic
1104633574 12:130424511-130424533 GCCGCTGTCCGGGCTCCGGGTGG + Intronic
1104860282 12:131919851-131919873 GCCACAGCCCTGGCTCCCCGTGG - Intronic
1105578036 13:21671013-21671035 GCCGCAGCCCGGGCTCCCCGCGG - Intergenic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1105927138 13:25018488-25018510 GCTGCAGCTCGGGCTCCGGCGGG + Intergenic
1106241917 13:27919938-27919960 GCCGCACCATAGGCTCCGCGGGG - Intergenic
1110450794 13:75636118-75636140 GCCGCGGCCCGGGCCCCGCTGGG - Intronic
1112238093 13:97654109-97654131 GCAGAATCTCGGGCTCCGCAAGG + Intergenic
1119325948 14:73759679-73759701 GCCACAGCTCGCGCGCCGCCTGG + Intronic
1119330112 14:73787205-73787227 GCCGCACCGCCCGCTCCGCGAGG - Intronic
1119786828 14:77320636-77320658 GACGCAGCTCGGACTCTGCCAGG + Exonic
1122975213 14:105168217-105168239 GCGGCGGCTGGGGCTCCGGGCGG - Intronic
1129116382 15:73367649-73367671 GGCGCACCTCGGCCTCCGGGAGG + Exonic
1130891187 15:88135356-88135378 GGCGCAGCTCAGGCTCCTCCAGG + Exonic
1132516504 16:368524-368546 CCCGCCGCTCGGGGTCCTCGGGG + Exonic
1132557993 16:580851-580873 GCCACAGCTCCGGCTCCTGGTGG + Exonic
1136141653 16:28292577-28292599 GCTCCAGCTCGCGCTCCGCCTGG - Exonic
1136375551 16:29863142-29863164 GCCGCTGCTCCAGCTGCGCGTGG + Exonic
1137036709 16:35574778-35574800 CCAGCAGCACTGGCTCCGCGTGG - Intergenic
1140263463 16:73400469-73400491 TCCACAGCTCGGTCTCCACGGGG + Intergenic
1140481992 16:75266877-75266899 GCCGCAGCCCGGGCTCATGGCGG + Intronic
1141422315 16:83925203-83925225 GCAGCAGCTCAGGCTCAGCACGG + Exonic
1142698985 17:1648462-1648484 GCAGCAGCTCGGGCGCCCCTCGG - Exonic
1144269239 17:13601276-13601298 GCAGCGGCCGGGGCTCCGCGGGG + Exonic
1144595807 17:16569243-16569265 GCGGCAGCTTGGGCTCCGATTGG - Intergenic
1145885742 17:28381380-28381402 GCAGCAGCGCGGGGTCCGTGCGG - Exonic
1146759088 17:35460548-35460570 GCCGCAGCTCCGGTGACGCGAGG + Intergenic
1147459268 17:40557988-40558010 GCTGCAGCCCAGGCTCCGGGGGG + Intronic
1148880243 17:50719851-50719873 GCCTGAGCCCGGGCTCCGTGGGG + Intronic
1151559162 17:74861545-74861567 GCCGGAGCCCGGGCGCGGCGGGG + Intergenic
1152260091 17:79262193-79262215 GCCGCATCTCGGGCTTGGCCTGG - Intronic
1152785646 17:82246617-82246639 GCCCCAGCCCGGACTCCGCCTGG - Intronic
1152911809 17:83009575-83009597 GCTGCAGCTCAGACTCCCCGTGG + Intronic
1153688495 18:7568296-7568318 GCCGCTGCTCGGGGTCGGCGGGG - Intronic
1160978671 19:1806594-1806616 GCTGCAGCTGGGGATCCGCGGGG - Intronic
1161279076 19:3435280-3435302 GCCACTGCGCGGGCGCCGCGGGG + Intronic
1161628725 19:5340731-5340753 GCTGGCGCTCGGGCTCCGCTCGG - Exonic
1162299331 19:9835391-9835413 GCCGCAGCTCAGGTGCCGCGGGG + Exonic
1163018832 19:14472232-14472254 GCCGGGGCTGGGGCTCCGCTGGG - Intergenic
1163316360 19:16542853-16542875 GCCGCAGCCCGGGATCCACCCGG - Intronic
1163720426 19:18895889-18895911 GCAGCAGCTCGGGCGGCGCCAGG + Exonic
1165360972 19:35336743-35336765 ACTGCAGCGCTGGCTCCGCGTGG - Intronic
1165803146 19:38565232-38565254 GCCGCAGGCCGGGCCCTGCGAGG + Exonic
1166317938 19:41999046-41999068 GCGGCGGGTCGGGCTCCGCTGGG + Exonic
1166688346 19:44809072-44809094 GCTGCAGCTCGGCCGCTGCGGGG - Intronic
1167257997 19:48442677-48442699 GCCGCGGCGCGGGGTACGCGGGG - Exonic
1168154565 19:54465502-54465524 GCCGCTTCTTGGGCTGCGCGGGG + Exonic
1168310071 19:55455764-55455786 TCCCCAGCTCGGGCACCGTGGGG + Exonic
1168350895 19:55675043-55675065 GCTGCAGCGGGGGATCCGCGCGG - Intergenic
925725274 2:6865633-6865655 GCCGCTGCTCGGGCGGCGCGGGG - Exonic
926111713 2:10188108-10188130 GCTGCAGCTCGGGGTCCTCAGGG - Intronic
927472253 2:23385359-23385381 CTCGCGGCTCGGGCTCCGGGCGG - Exonic
927487096 2:23495997-23496019 GCTGCAGCTCGGGCTGAGGGAGG - Intronic
932567424 2:72918404-72918426 GCCGCAGCACGGGCGCCGGCCGG - Intronic
934113763 2:88765395-88765417 GCTGCAGCTCGGGCTCCGGCTGG - Intergenic
934479459 2:94622138-94622160 GCCCCAGCGCGGGATCCGCTAGG - Intergenic
934636263 2:95992276-95992298 ACTGCAGCTCGGGCTCCGGCGGG + Intergenic
934797384 2:97113150-97113172 ACTGCAGCTCGGGCTCCGGCGGG - Intergenic
934836025 2:97590289-97590311 ACTGCAGCTCGGGCTCCGGCGGG + Intergenic
937249035 2:120511762-120511784 GTCGCGGCACCGGCTCCGCGAGG + Intergenic
938319834 2:130355651-130355673 GCCCCAGCTCGGACTCCGCGCGG + Intergenic
938319974 2:130356112-130356134 GCCGCAGCCTGGACTCGGCGCGG + Exonic
938392427 2:130916274-130916296 GCCGCCACGCGGGCTCCGCAAGG + Intronic
944055163 2:195515691-195515713 GCGGCAACTGGGGCTGCGCGGGG + Intergenic
944615205 2:201452133-201452155 AGTGCAGCTCGGGCTCAGCGGGG + Intronic
948055629 2:235007729-235007751 GCCGCAGCCCGGGCTCAGGATGG - Intronic
948423461 2:237874366-237874388 GGAGCAGCTCGGCCTCCGCACGG + Intronic
948942270 2:241202487-241202509 GCCTCAGGTCCGGCTCTGCGGGG + Intronic
1169118632 20:3082841-3082863 GGCGCAGCTCGGGGTGCGGGGGG + Intronic
1169664527 20:8019514-8019536 GCGGCAGCGCGGCCTCCTCGGGG + Exonic
1171782391 20:29430826-29430848 GGGCCAGCTCGGGCTCGGCGAGG - Intergenic
1172581231 20:36050559-36050581 GCGGCAGCTCGAACGCCGCGCGG - Intergenic
1175859904 20:62144262-62144284 GCCGCGGCTCCGGCCCCGAGGGG - Intronic
1176380790 21:6111312-6111334 GCCGCCGTGGGGGCTCCGCGCGG + Intronic
1178624231 21:34202157-34202179 GCCGCAGCCCGGCCGCCGAGTGG + Intergenic
1178922457 21:36747707-36747729 GCCGCAGCTCGGGAAGCTCGGGG - Exonic
1178922466 21:36747735-36747757 GGCCCAGCGCGGGCTCCTCGCGG - Exonic
1179742682 21:43426928-43426950 GCCGCCGTGGGGGCTCCGCGCGG - Intronic
1179833294 21:44012001-44012023 CCCGCAGCTCGGGCGTCCCGCGG - Intergenic
1180033228 21:45226682-45226704 GCTGCAGCTCTGCCTCCACGTGG + Intergenic
1180064433 21:45405436-45405458 CCTGCTGCTCGGGGTCCGCGCGG + Intronic
1180076879 21:45467589-45467611 GCCTCAGCTGGGGTTCCACGTGG - Intronic
1180871593 22:19149974-19149996 GCCGCGCCCCGGGCTCCGCCGGG + Intronic
1180968336 22:19802046-19802068 GGGGCATCTCAGGCTCCGCGGGG - Exonic
1183545986 22:38455134-38455156 GCTGCCGCTCGGTCTGCGCGTGG + Exonic
1183966713 22:41446729-41446751 GCCGTGGCTCGGGCGACGCGGGG - Exonic
1184035281 22:41915094-41915116 GCTCCCGCTCGGGCTCGGCGCGG + Intergenic
1185080682 22:48707907-48707929 GACGCCACCCGGGCTCCGCGGGG + Intronic
1185184611 22:49391548-49391570 GCCGGAGCTGGGGCTGCGTGAGG - Intergenic
949548886 3:5096180-5096202 GCCCCAGCCTGGGCTCCCCGTGG - Intergenic
950097450 3:10338223-10338245 GCCGCAGCTCCCGCTCCGCGTGG + Exonic
950428151 3:12935743-12935765 GCCGCAACTCAGGCTCCTCCCGG + Exonic
950710603 3:14810701-14810723 GGCGCGCCTCGGACTCCGCGCGG - Intergenic
950829531 3:15859969-15859991 GCCGCGGCTCGGGCGGGGCGGGG + Intergenic
951080461 3:18445274-18445296 GCGGCGGCTCGGGCTCGGCTCGG - Intronic
952152395 3:30606986-30607008 TCCCCAGCCCGGGCTCGGCGGGG + Intronic
954879485 3:53823801-53823823 GCAGCAGCACGCGCTCGGCGGGG + Exonic
957048773 3:75396153-75396175 GCTGCAGCTCGGGCTCCGGCCGG + Intergenic
959530746 3:107431563-107431585 GCGGAAGCGCGGGCTCCGGGGGG + Intergenic
961202447 3:125055695-125055717 GCGGCGGCTCGCGCTCCGGGCGG + Exonic
963335586 3:143971354-143971376 CCCTCAGCTCGTGCTCCTCGCGG - Intergenic
965404217 3:168249895-168249917 GCCGCCGCCCGGGCTGCGCGCGG - Intergenic
966863144 3:184241695-184241717 CCCCCAGCTCGGGCTCTGAGGGG + Exonic
966864515 3:184249844-184249866 GCCGCAGCTCCGGCTCTAGGAGG - Exonic
968418764 4:464787-464809 GCAGCAGCTGGGGCTGGGCGCGG + Intronic
969346516 4:6573956-6573978 GCTGCAGCTCTGGTTCCGCTAGG + Intergenic
971244086 4:24912938-24912960 GCCGCCGCCCGGGCCCCGCGCGG + Intronic
975439988 4:74399414-74399436 CCCGCAGCCCGGGTTCCGCCCGG + Intergenic
975779073 4:77819970-77819992 GCCGCGGCTCCGGCCCTGCGGGG - Intergenic
976184395 4:82430199-82430221 GCCGAAGCCCGGGCCCCGCGCGG + Exonic
977370304 4:96126401-96126423 GGCGCCGCTCGGGTTCCGGGTGG - Intergenic
981920400 4:150079128-150079150 GCAGCAGCTCGGGCCCCAAGGGG + Exonic
982198527 4:152937766-152937788 GACGCAGCTGGGGCTCCGCGCGG + Intronic
985546553 5:512811-512833 GCCGCAGCCTGGGCTCCGCCAGG - Intronic
985558930 5:571944-571966 GCCGCGGCTCCAGGTCCGCGTGG - Intergenic
988264106 5:28928042-28928064 GCTGCAGCTCGGGCTCCGGCGGG + Intergenic
989207127 5:38821910-38821932 GCGGGAGCTGGGGCTGCGCGTGG + Intergenic
997265017 5:132490402-132490424 GCCTCCGCGCGGGCTCCGGGGGG - Intronic
998279117 5:140787862-140787884 GCAGCAGCTCCAGCTCCTCGTGG - Exonic
998280534 5:140802769-140802791 GCAGCAGCTCTAGCTCCTCGTGG - Exonic
998281160 5:140808759-140808781 GCAGCAGCTCTAGCTCCTCGTGG - Exonic
998282927 5:140829663-140829685 GCAGCAGCTCTAGCTCCTCGTGG - Exonic
998284235 5:140842893-140842915 GCAGCAGCTCTAGCTCCTCGTGG - Exonic
998287467 5:140877044-140877066 GCAGCAGCTCCAGCTCCTCGTGG - Exonic
1002046162 5:176542957-176542979 GCCGCAGCTGGGACTCGCCGGGG + Intronic
1003641727 6:7880858-7880880 GCCACAGCCAGGGCTCCACGGGG + Exonic
1006248612 6:32761777-32761799 GCCCCAGCTCGGTCACCGCCTGG + Exonic
1007532361 6:42554242-42554264 GCGGGAGCTGGGGCTGCGCGCGG + Intergenic
1008294825 6:49762486-49762508 GCCGCAGCTCGCGGTCAGCCAGG - Intergenic
1018491233 6:164295448-164295470 GCTGCAGGTTGGGCTCCGAGAGG + Intergenic
1018679656 6:166253413-166253435 GCCGCTGCTCCGTGTCCGCGCGG - Intergenic
1019343084 7:517622-517644 GCCGGGGCGAGGGCTCCGCGGGG - Intronic
1019475327 7:1241541-1241563 GCCACAGCCCCGGCTCCTCGTGG - Intergenic
1020275475 7:6622206-6622228 GCTGCAGCTCCGGCTGCACGGGG - Exonic
1024638449 7:51309924-51309946 GCTGCAGCTGGGGCTCCCCCAGG - Intronic
1026806682 7:73433648-73433670 GCCCCACCCCGTGCTCCGCGTGG + Intergenic
1027260520 7:76461764-76461786 GCTGCAGCTCCGGCTCGGCCTGG - Exonic
1027311897 7:76959877-76959899 GCTGCAGCTCCGGCTCGGCCTGG - Intergenic
1028086699 7:86644924-86644946 GCGGAAGCTCGGGTGCCGCGTGG + Intronic
1029487578 7:100852851-100852873 CCCACAGCTCGGGGGCCGCGAGG - Intronic
1029561873 7:101308449-101308471 TCCGCTCCTCGGGCTCCCCGTGG - Intergenic
1031051990 7:116953900-116953922 GGCGCAGCTCTTCCTCCGCGGGG - Exonic
1033288613 7:140062766-140062788 GCCGCAGCTCGGGCAACTCCAGG + Exonic
1033372493 7:140723202-140723224 GCAGCAGCTCGCACTCCGCCTGG + Intronic
1034222881 7:149459819-149459841 GACGCAGCGCGGGCCCCGCAGGG + Intronic
1035747620 8:1973707-1973729 GCCGGAGCGCTGGCTCCGCGCGG + Intergenic
1042155560 8:65841529-65841551 GCGGCAGGGCGGGCGCCGCGCGG - Exonic
1043847296 8:85177534-85177556 GCCGCAGCTCGGGGGCGCCGGGG + Exonic
1045499986 8:102737917-102737939 GCAGCAGCTCAGGCTCGGGGGGG + Intergenic
1045510785 8:102810658-102810680 GCCACGGCTCGGGCTGCGCCGGG - Intergenic
1046654122 8:116874444-116874466 GCCGCCGCTTGGGCGCCGGGAGG + Intronic
1049291849 8:141807512-141807534 GCCGCAGCAGAGGCTCCACGAGG - Intergenic
1049651299 8:143771198-143771220 CCCGCAGCTCGGGAGCCCCGAGG - Intergenic
1050455752 9:5832730-5832752 GCAGCAGCTCGTGCTACGCGGGG - Exonic
1053928353 9:43089786-43089808 GCCCCAGCGCGGGATCCGCTAGG + Intergenic
1056968115 9:91180797-91180819 GCCCCAGCCCGGGCTCAGCAGGG + Intergenic
1060979854 9:127785813-127785835 GCCGGAGCTGGGGCTCGGGGTGG - Intronic
1062289625 9:135788723-135788745 CCCCCAGCTGGGGCTCCACGAGG + Intronic
1062362103 9:136193080-136193102 CCCGCACCTCCCGCTCCGCGGGG + Intergenic
1062491844 9:136808516-136808538 CCCGCGGCTCGGGGGCCGCGAGG - Intronic
1062544248 9:137054472-137054494 TCCCCAGCCCGGGCCCCGCGTGG - Intergenic
1062547403 9:137069929-137069951 GGGACCGCTCGGGCTCCGCGGGG + Exonic
1187698161 X:21941094-21941116 GCCGCAGCTCGGGGCCTGCAGGG + Intronic
1190337215 X:49269884-49269906 GCCGCAGCGGGGGCTCCACAGGG - Exonic