ID: 902923555

View in Genome Browser
Species Human (GRCh38)
Location 1:19681078-19681100
Sequence TCTGGGGTCCCAGATTGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902923555 Original CRISPR TCTGGGGTCCCAGATTGAAG GGG (reversed) Intergenic
900479083 1:2889627-2889649 TCTGGGGGCCCCGCTGGAAGAGG + Intergenic
900857613 1:5198595-5198617 TCTGGTGTCGGGGATTGAAGAGG - Intergenic
900908969 1:5580602-5580624 TCTGGGGTCCTGGAAGGAAGAGG - Intergenic
901847113 1:11990470-11990492 TCTGGGCTCCCAGAGGGGAGCGG - Intronic
902923555 1:19681078-19681100 TCTGGGGTCCCAGATTGAAGGGG - Intergenic
904024019 1:27490722-27490744 TCTGAGGTCGCAGAGTGAAGTGG - Intergenic
905441122 1:37997134-37997156 TCTGGGAACCCAGACTGCAGGGG + Exonic
905882582 1:41474337-41474359 TCTGGGGGCCCAGATTGCCTGGG + Intergenic
907045280 1:51296789-51296811 TCTGGGGTCCCAGGAAGCAGAGG - Intronic
909563454 1:77029603-77029625 TATGGAGTCACAGATGGAAGTGG - Intronic
914396674 1:147276209-147276231 TCTGGGCTCCCAGAGTAAAATGG - Exonic
915076577 1:153312833-153312855 TCTGGCTTCCCAGAGAGAAGAGG + Intergenic
915820510 1:159018322-159018344 TCTGGGGTCTCATATTCAAATGG - Exonic
916474072 1:165151775-165151797 GATGGGGATCCAGATTGAAGTGG - Intergenic
919739118 1:200971984-200972006 TCTTGGCTCCCAGACTGAAGCGG + Intronic
920196728 1:204232793-204232815 TCTGTGGTCCCAGAGGGCAGGGG + Intronic
920803718 1:209212820-209212842 TCTGGAGTCCTAGATTAGAGGGG - Intergenic
920816964 1:209343710-209343732 TATTGGGTCCTAGATTGTAGAGG - Intergenic
921766998 1:218983703-218983725 AGAGGGGTCCCAGATGGAAGGGG + Intergenic
923783698 1:237048048-237048070 TCTGGGGTCCGAGAGGCAAGAGG - Intronic
1063286506 10:4694401-4694423 CCATGGGTCCAAGATTGAAGGGG - Intergenic
1070173445 10:73950372-73950394 TCTGGGAAGCCAGACTGAAGAGG + Intergenic
1070195259 10:74151053-74151075 TCTGGGGTCCCTCATGGTAGGGG + Exonic
1072411265 10:95204069-95204091 TCTGGTGACCCAGACTGAAGTGG - Intronic
1074001560 10:109378827-109378849 TCGGGGGACCTAGACTGAAGGGG - Intergenic
1075199292 10:120388574-120388596 TCTGGGGTCACAGTTGGAGGAGG - Intergenic
1075299520 10:121309266-121309288 TCTGGGATGCAAGATGGAAGAGG - Intergenic
1075804721 10:125178241-125178263 CCTGGTGTCTCAGACTGAAGAGG + Intergenic
1077539634 11:3140460-3140482 TCAGGGGTCCCAGTCTGAGGGGG + Intronic
1079109063 11:17593917-17593939 GCTGAGGTCACAGTTTGAAGAGG - Intronic
1081906808 11:46675435-46675457 TTGGGGGTTCCTGATTGAAGGGG - Intergenic
1082118673 11:48355780-48355802 TCTGGAGGCCAAGATTGCAGGGG + Intergenic
1082255650 11:50029527-50029549 TCTGGAGTCTGAGATTGCAGGGG - Intergenic
1083643368 11:64157828-64157850 GCTGGGCTCCCAGAATGCAGCGG + Intronic
1084231788 11:67758842-67758864 TCTGAGGTTCCTGATTGAAGGGG - Intergenic
1086152281 11:83625203-83625225 TGTTGGGTCCAAGATTGGAGGGG + Intronic
1088397518 11:109384872-109384894 TTTGGGGGCCCAGGTTAAAGGGG + Intergenic
1088705562 11:112461161-112461183 TTTGTGGCCCCAGATTCAAGTGG + Intergenic
1089611799 11:119673389-119673411 CCTAGGGTCCCAGCTGGAAGAGG - Intronic
1092781498 12:11991809-11991831 TCTGGGGACACAGATTGGAAGGG + Intergenic
1095652179 12:44624501-44624523 TCTGGGATCCCAGAGAAAAGAGG - Intronic
1097287921 12:57891956-57891978 TCAGGGGTACCAGATGTAAGGGG + Intergenic
1099585385 12:84507198-84507220 CCTGGGGTTCCAGAATGAACTGG + Intergenic
1100885640 12:99066862-99066884 TCATGGGTCTCAGCTTGAAGAGG + Intronic
1102922023 12:116798688-116798710 TCTGTGGTCCCAGATTCAGGAGG - Intronic
1103322556 12:120100508-120100530 TCTGTGGTCCCAGACAGAGGTGG + Intronic
1104149525 12:126069350-126069372 CCTGGGGTTCCAGGGTGAAGAGG + Intergenic
1104964070 12:132501191-132501213 GCTGGGCTCCCAGAGTGAACAGG - Intronic
1105404892 13:20125686-20125708 GCAGGGGTCCCAGAATGCAGAGG + Intergenic
1107934871 13:45337491-45337513 TGTGGCGGCCCAGATTGAATTGG - Intronic
1110363813 13:74659258-74659280 TCTGGGAGCCCAGACAGAAGGGG - Intergenic
1112106582 13:96247168-96247190 TCTGGGGTCCAGGATGGGAGAGG - Intronic
1114549245 14:23523751-23523773 ACTGGGGTTCCAGATGGAATGGG - Exonic
1114615003 14:24063562-24063584 TCTGGTGTCACTGAGTGAAGGGG - Intronic
1119773039 14:77233316-77233338 TCTGGGGAACCAGAAGGAAGAGG + Intronic
1120282110 14:82452709-82452731 TCTGGGGCAAGAGATTGAAGAGG + Intergenic
1123991092 15:25683883-25683905 TCTGGGGTCACAGACAGAGGAGG - Intronic
1129251695 15:74312777-74312799 TCAGGGGTCCTAGACTGAGGGGG - Intronic
1129765843 15:78166436-78166458 ACGTGGGTCCCAGATTGAACAGG + Intronic
1130306518 15:82715315-82715337 GCTGGGGGCTCAGATTCAAGTGG - Intergenic
1130799295 15:87244987-87245009 GCTTGGGAGCCAGATTGAAGAGG - Intergenic
1130884462 15:88081642-88081664 TCTGGGGGCTCAGAAGGAAGGGG - Intronic
1130923140 15:88365770-88365792 TCTGGGGTCCTGGACAGAAGGGG - Intergenic
1130988114 15:88857953-88857975 TCTGGGGTCCCTGATCTCAGTGG + Exonic
1132319893 15:100918384-100918406 TCTTGGGTCCCTGGTTGGAGAGG - Intergenic
1132491622 16:234914-234936 GCCGGGGTCCCAGAGCGAAGGGG - Intronic
1132720539 16:1313602-1313624 GCTGGGGCCCCAGATGGATGTGG - Intronic
1132917991 16:2364500-2364522 TATGGGGTCCTAGATTTAAGGGG - Intergenic
1133378891 16:5313468-5313490 TCATGGGTCCCAGATTAAGGAGG - Intergenic
1133625169 16:7564222-7564244 TCTGTGTTCTCAGATGGAAGAGG - Intronic
1135044353 16:19142685-19142707 TCTGGGGACCAAGAATGCAGAGG - Intronic
1136282619 16:29222647-29222669 CCTGGGGACCCAGGTTGAACAGG - Intergenic
1136626836 16:31466649-31466671 CCTGGGGTCCCAGGTGGATGCGG - Exonic
1138654307 16:58481935-58481957 TCCGGGGTCCCAGATTTCTGGGG + Intronic
1141252077 16:82368228-82368250 TCTGGGGTCATAGACTCAAGAGG + Intergenic
1142086993 16:88188572-88188594 CCTGGGGACCCAGGTTGAACAGG - Intergenic
1143512294 17:7403582-7403604 TCTGGGGTCCCTGGGGGAAGTGG - Intronic
1147497784 17:40934361-40934383 TCTGGGTTCTGAGATTGAATAGG - Intronic
1150114306 17:62531928-62531950 TTTGGAGGCCCAGCTTGAAGTGG + Intronic
1152655590 17:81517843-81517865 GCTGCGGTCACAGATTGCAGGGG + Intronic
1155025300 18:21935341-21935363 TCTGCAGTCCCACATGGAAGGGG - Intergenic
1156585266 18:38424920-38424942 CCTGGGGTCTCAGATTACAGTGG - Intergenic
1157784368 18:50468884-50468906 TCTGGGGTCCTATGTAGAAGAGG - Intergenic
1158763564 18:60420406-60420428 TGTGATGTCACAGATTGAAGTGG - Intergenic
1160944098 19:1633193-1633215 TCTGTGGCCCCCGATGGAAGGGG - Intronic
1161542379 19:4859826-4859848 TCTGGGGCTCCAGCTTGGAGAGG + Exonic
1162124255 19:8490747-8490769 TCTCGCGCCCCAGTTTGAAGGGG - Exonic
1163953832 19:20615637-20615659 TCTTGGGTCACAAATTGAATAGG - Intronic
1165392472 19:35546400-35546422 TCTGGGGGCCCATCTGGAAGAGG - Intronic
1165610757 19:37150103-37150125 ACTGGGGTCCTAGAAAGAAGGGG + Exonic
1166356592 19:42230751-42230773 TTGGGGCTCCCAGATGGAAGTGG + Exonic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
1167596775 19:50432245-50432267 TCCGGGGTCCCAGATGGCCGGGG + Intergenic
925321451 2:2973308-2973330 TCTTAGGACCCAGATTGAACTGG - Intergenic
926543776 2:14212787-14212809 TGTGGGGTCACAGGATGAAGGGG + Intergenic
927062562 2:19437775-19437797 TATGGCTTTCCAGATTGAAGAGG + Intergenic
929440773 2:41964471-41964493 TCTGGGGTCCAAGATCCCAGAGG + Intergenic
931099890 2:58985500-58985522 TTTGGGGTCCCAGATCTATGGGG - Intergenic
932631151 2:73344589-73344611 TCTGGGGGTCCAGATTCAATAGG - Intergenic
932685915 2:73870160-73870182 GCTGGATTCCCACATTGAAGGGG - Intronic
934543644 2:95196542-95196564 GGTGGGGTCCCAGGCTGAAGAGG + Intergenic
936064457 2:109319910-109319932 TCTGGGGTCCCTCCTTGCAGGGG + Intronic
936118374 2:109720802-109720824 TGTGAGGTCCCAGCCTGAAGGGG - Intergenic
944825042 2:203474255-203474277 TCTGGGCTGCCACAATGAAGAGG + Intronic
946185547 2:217978693-217978715 CTCGGGGTCCCAGATTGGAGCGG - Intronic
1169308920 20:4518827-4518849 TCTGGGGTCACAGATTTATAGGG + Intergenic
1172405706 20:34687324-34687346 ACTTGGGTCTCAGATTGAGGAGG - Intergenic
1172806876 20:37618421-37618443 CCTGGGGCCCCAGACTGAACAGG + Intergenic
1174158034 20:48529221-48529243 TGGGGGGTCCAAGATTGAAAAGG - Intergenic
1176190025 20:63804119-63804141 TGTGGGGTCCCTGAATGGAGGGG + Intronic
1179238715 21:39569540-39569562 GAGGGGGTCTCAGATTGAAGGGG - Intronic
1179648740 21:42792897-42792919 GCTGGGGTCCCATACAGAAGGGG + Intergenic
1181976120 22:26731321-26731343 TCTGGGGTGCAAAATTTAAGGGG + Intergenic
1185097526 22:48819539-48819561 TCTGGGAACACAGATTGCAGTGG - Intronic
949619805 3:5797914-5797936 TCTGGAGACCCAGGTGGAAGTGG + Intergenic
953869682 3:46615530-46615552 TCTGGGGGCAGAGACTGAAGAGG - Intronic
957048419 3:75394145-75394167 TCTGAGGTTCCTGATTGAAGGGG - Intergenic
958993410 3:100873762-100873784 TCTGAGGTCCCAGAATGAGCAGG + Intronic
959605877 3:108241651-108241673 TCTGGTGACCCAGATGGAATTGG + Intergenic
961441281 3:126954758-126954780 TCTGGGGTCTCAGACTCTAGAGG + Intronic
961880500 3:130058258-130058280 TCTGAGGTTCCTGATTGAAGGGG - Intergenic
962433592 3:135344475-135344497 TCTTGGTTGCCAGATGGAAGGGG - Intergenic
962753371 3:138450847-138450869 TCTGAGCTCCCAGATAGAGGGGG + Intronic
968992890 4:3926602-3926624 TCTGAGGTTCCTGACTGAAGGGG - Intergenic
969572176 4:8015529-8015551 TCTGGGATTCCAGATTCTAGTGG - Intronic
969822585 4:9731759-9731781 TCTGAGGTTCCTGATTGAAGGGG + Intergenic
972480257 4:39489861-39489883 TCTTGGGTCACAGACTGAATAGG - Intergenic
973195374 4:47433685-47433707 TGTGGGGTCCAAGACTGAGGAGG - Intergenic
973798129 4:54449593-54449615 TTTGGAGTCCCAGATTGTTGCGG + Intergenic
978453589 4:108863738-108863760 GCTGGGGGCCCAGATAGAAGAGG + Intronic
979549366 4:121973547-121973569 TATGAGGTACCAGATTGAACTGG - Intergenic
980994706 4:139769278-139769300 TCTGGGGTCCCCGAATCCAGAGG + Intronic
981918671 4:150062682-150062704 TCTGGGATGCAAAATTGAAGTGG - Intergenic
983569080 4:169185235-169185257 TGTGGGATCCCAGATTGCAGAGG - Intronic
984856830 4:184202688-184202710 GCCTGGGTCCCAGAATGAAGAGG + Intronic
985938190 5:3112721-3112743 TCTCGGCTCCCAGATTCAAGTGG + Intergenic
987048415 5:14128758-14128780 TCTAGAGTCCCAGATTGAGGAGG + Intergenic
987163353 5:15168431-15168453 TTTGGGGTCCCAGCTTTATGGGG + Intergenic
987173180 5:15280050-15280072 TCTGGGGTCACTTATTTAAGTGG - Intergenic
990847745 5:60162844-60162866 TCTGTGGTACCAGGTAGAAGGGG - Intronic
992089307 5:73303441-73303463 TCTGGCCTGCCAGATTGAGGGGG + Intergenic
992572645 5:78075671-78075693 TCTGGGTGCCCAAATTCAAGTGG + Intronic
995427540 5:112042308-112042330 TCAGGGGTCCCGGAATCAAGTGG - Intergenic
996390280 5:122952942-122952964 TCTGGAGTCCCAGAAGGAAAGGG + Intronic
997607565 5:135186021-135186043 TCTAGGGTCCCAGAAGGGAGTGG + Intronic
998004433 5:138647768-138647790 CCTGGGGTCCCTGACTGCAGAGG + Intronic
999680684 5:154057071-154057093 TCTTGGGTCCCAGATGGCACAGG + Intronic
1000197307 5:158972183-158972205 GCTGGGGACACAGATTGAGGTGG - Intronic
1002564032 5:180100061-180100083 CCTGGGGTCTCAGATGGAAGAGG + Intergenic
1003504087 6:6725536-6725558 TCTGGTGACCCAGATGGAGGGGG - Intergenic
1003601143 6:7518676-7518698 TCTGGGTTCCCTGATGGAAGAGG - Intergenic
1004291296 6:14369862-14369884 TGTGGGGACACAGGTTGAAGTGG + Intergenic
1006037691 6:31226555-31226577 TCTTGGGTCACAAATTGAACAGG + Intergenic
1006455891 6:34131657-34131679 TCTGGGGGCCCAGGTAGAAGTGG - Intronic
1007419412 6:41710756-41710778 TCTGGGGGCCCAGATTGGGTTGG - Intronic
1010865421 6:80970743-80970765 TCTGGGGCACCAGATTGGATGGG - Intergenic
1011667825 6:89652196-89652218 TCTGGGTTTCCAGATTCACGTGG + Exonic
1011769596 6:90661026-90661048 TCTGGGGGCCCAGAGCAAAGGGG - Intergenic
1013422474 6:109978972-109978994 TCTGGGGTCCCAGGGTGGGGTGG + Intronic
1017967694 6:159280802-159280824 TCAGGGGTCCCTGAGTGTAGAGG - Intergenic
1018067414 6:160133727-160133749 TCCGGGGCCCCAGAGAGAAGGGG + Intronic
1019067356 6:169313448-169313470 CCTGGGAGCCCAGATGGAAGGGG - Intergenic
1020315531 7:6902956-6902978 TCTGAGGTTCCTGATTGAAGGGG - Intergenic
1022412142 7:30147485-30147507 TCTGGGGGCCCAGCTTCAAGTGG + Intronic
1030525871 7:110654286-110654308 CCTGGGTTTCCAGATTCAAGAGG - Intergenic
1032044011 7:128587699-128587721 TCTGGAGGCCCAGCTTGAAGTGG + Intergenic
1033109101 7:138559158-138559180 TCCTGGGTCACAGATTGAATAGG + Intronic
1033365138 7:140667350-140667372 TCTGGGGTCCCAGGGGGACGAGG - Intronic
1034932644 7:155174670-155174692 TCAGGGGTCACTGATTGGAGTGG - Intergenic
1035123234 7:156586891-156586913 TCTGGGCTTCCAGGTTGATGTGG - Intergenic
1039492500 8:37958565-37958587 TCCCTGGGCCCAGATTGAAGGGG - Intergenic
1039712278 8:40067722-40067744 TCTTGGCACCCAGCTTGAAGGGG + Intergenic
1044879200 8:96705424-96705446 TATGGTGTCCCACATAGAAGAGG - Intronic
1045705727 8:104920374-104920396 CCTGGGGTCCCAGAAGGATGTGG + Intronic
1047520050 8:125589203-125589225 TCCAAGGTCCCAGATTGAAGTGG + Intergenic
1048251641 8:132871118-132871140 TCTGGGGTACCTGACTGATGTGG + Intronic
1049169067 8:141147193-141147215 GCTGGTGACCCAGAGTGAAGTGG - Intronic
1053014422 9:34653902-34653924 TCTGGGGTCCCAGAACTGAGTGG + Intronic
1053021588 9:34698563-34698585 TCTCGGCTCCCAGGTTCAAGTGG + Intergenic
1053257590 9:36631348-36631370 CCTGGGTTCCCAGGTTCAAGTGG + Intronic
1054706430 9:68467204-68467226 CCTGGGGTTCCAGATACAAGGGG - Intronic
1055253540 9:74337868-74337890 TCTGTGGACTGAGATTGAAGAGG - Intergenic
1057498284 9:95577275-95577297 TCTTGGGTCCAAGATGGCAGGGG + Intergenic
1057718778 9:97516275-97516297 TCTGTGTTCCCAGATTGAGCCGG - Intronic
1060199551 9:121644798-121644820 TCTGGGGTCACACAGTGAAGAGG + Intronic
1061252849 9:129436742-129436764 TCTGGGTTCACAGTTTGCAGGGG - Intergenic
1061498695 9:130990215-130990237 CCTGGGCTCCGAGATTCAAGTGG + Intergenic
1061770557 9:132917240-132917262 TATGAGTTTCCAGATTGAAGGGG - Intronic
1062538851 9:137032651-137032673 TCTGGGTTCCTAGATGGCAGAGG - Exonic
1186073328 X:5847704-5847726 TCTGGAGACACATATTGAAGGGG + Intronic
1186638708 X:11432368-11432390 TCAGTGGTCCAAGATTGAAAAGG - Intronic
1193139222 X:78008634-78008656 TATATGGTCCCAGATAGAAGAGG - Intronic
1194849912 X:98857592-98857614 TGTGGGGTTCCAGAATGAACTGG - Intergenic
1197338542 X:125237836-125237858 TCTGGCTTTCCAGATTGATGAGG + Intergenic
1200312940 X:155098209-155098231 CCTGTGGGCCCAGAGTGAAGAGG - Intronic
1201278334 Y:12319001-12319023 TCCTGGGTCACAGACTGAAGAGG - Intergenic
1201358242 Y:13118316-13118338 TCCTGGGTCACAGACTGAAGAGG - Intergenic