ID: 902924919

View in Genome Browser
Species Human (GRCh38)
Location 1:19689776-19689798
Sequence GCTCCCTTTCACCCCATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902924915_902924919 4 Left 902924915 1:19689749-19689771 CCTGGGGTGCTGAGGCACAAAGT 0: 1
1: 0
2: 0
3: 25
4: 244
Right 902924919 1:19689776-19689798 GCTCCCTTTCACCCCATTCAGGG 0: 1
1: 0
2: 1
3: 22
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902924919 Original CRISPR GCTCCCTTTCACCCCATTCA GGG Intronic
900556875 1:3285046-3285068 CCTCCCTTGCACCCCGTCCAGGG - Intronic
901186031 1:7373944-7373966 GCTCCTGTTCATCCCATCCATGG - Intronic
902924919 1:19689776-19689798 GCTCCCTTTCACCCCATTCAGGG + Intronic
904244911 1:29181216-29181238 GCTCCCTTTCACCTCTTGCCCGG - Intronic
904371879 1:30052909-30052931 GTTCCCTCCCACCCCATCCATGG - Intergenic
904980772 1:34499223-34499245 GCTCCCTTTCCCCCTTTGCAAGG + Intergenic
905168488 1:36097260-36097282 GCTCCCTCTCAGCTCCTTCAGGG + Exonic
905468854 1:38176457-38176479 GCTCCCTTCCACCCCCCTCTTGG + Intergenic
905825694 1:41024401-41024423 TCTCCCTGTCCCCCCATTGAGGG + Intergenic
907471827 1:54679315-54679337 GCTGCCTTTCAGCCCTTCCAGGG - Exonic
907850347 1:58249749-58249771 GCTCCCTGACACCCCAGTCGAGG - Intronic
908404882 1:63805047-63805069 CCTCCCTTTCAGCGCATTCAGGG - Intronic
912080073 1:105925347-105925369 GGTCCCTTTCATCACATTCAGGG + Intergenic
915228351 1:154427800-154427822 CCTTCCTTTCACCCCATCCAAGG - Intronic
916501545 1:165391836-165391858 GCTCCATTGCACTCCATTCTGGG - Intergenic
919223769 1:194666259-194666281 GCTCCCTTTAACCTTATTCAGGG - Intergenic
920285245 1:204874351-204874373 GCTGCCTTTCGCCCCATTTTGGG + Intronic
920404204 1:205696990-205697012 GAGCCCTTCCACCTCATTCAAGG - Intergenic
920521235 1:206628446-206628468 GCTCCTTTTCACCATCTTCAGGG - Intergenic
920795559 1:209133025-209133047 ACTACCCTTCAACCCATTCATGG - Intergenic
921053431 1:211526974-211526996 GCTCCCTTTCACCCCCAGTAGGG - Intergenic
924957284 1:248941596-248941618 GCTGCCATTAACCCCATCCAAGG - Intergenic
1062795753 10:343924-343946 CCTCTCTTACACCCCATACACGG - Intronic
1065539111 10:26743135-26743157 GAACCATTTAACCCCATTCAGGG + Intronic
1067575023 10:47403651-47403673 GCTCACATTCACCCCAGGCAGGG + Intergenic
1069515936 10:69077274-69077296 GCGCCCTTTGACCCTGTTCAAGG + Intergenic
1073913834 10:108378610-108378632 GCTCACTTTCTCCACATTCTAGG - Intergenic
1076963187 10:133783440-133783462 GCTGCCATTAACCCCATCCAAGG - Intergenic
1078932653 11:15924668-15924690 ACTCACTTGCAGCCCATTCAGGG + Intergenic
1079493213 11:21012364-21012386 CCTCCCTTTCTCCCCAGTTAGGG + Intronic
1080321925 11:31019994-31020016 TCTCCCTTTCAACCCCTTCATGG + Intronic
1083656769 11:64233815-64233837 GCCCCCTTCCACCCCACTCTAGG - Intronic
1083726389 11:64630722-64630744 GCTCCCCTTCCCCACATGCAAGG + Intronic
1084894890 11:72258873-72258895 ACTTGCCTTCACCCCATTCATGG - Intergenic
1084904855 11:72337874-72337896 GCTCCCTTTCCTCCCATTCAGGG + Intronic
1085707075 11:78796050-78796072 ACGGCCTTTCACCTCATTCAAGG + Intronic
1089004738 11:115082007-115082029 GCTCCTTTGCACTCCATGCAGGG - Intergenic
1089059075 11:115611437-115611459 TCTCCCTCTCTCCACATTCAAGG - Intergenic
1089447584 11:118565710-118565732 ACTCCCCTTTACCCCATTCCCGG - Intronic
1093308084 12:17544199-17544221 GCACCCATGCACACCATTCAGGG - Intergenic
1093808431 12:23464490-23464512 GCTGCCCTTCCCCCCATTTAGGG - Intergenic
1094482466 12:30895792-30895814 GTTTCCTTTCAACTCATTCAGGG - Intergenic
1095473175 12:42558327-42558349 CCTCCCTTTTACACCCTTCATGG - Intronic
1095594076 12:43938955-43938977 GCTCCATTGCACTCCAGTCAGGG + Intronic
1097641798 12:62191533-62191555 GCTCACCTTCACCCGCTTCAGGG - Exonic
1098008198 12:66021322-66021344 TCTCCCTTTCTCCCTCTTCAGGG + Intergenic
1098298338 12:69027627-69027649 GCTTCCTTTCACCTCAGGCATGG + Intergenic
1098769447 12:74535424-74535446 GCTCCCTATCAGCCAATTTATGG + Intergenic
1102752272 12:115305752-115305774 GCTCCACTTCTGCCCATTCATGG - Intergenic
1103661161 12:122518637-122518659 CATCCCTTACACCCCATTCTTGG + Intronic
1106960555 13:34992530-34992552 GCTCCTTTTCTCCCCATTAAGGG - Intronic
1111945887 13:94665467-94665489 GCTGCATCTCACCCCATGCATGG - Intergenic
1115635347 14:35285692-35285714 CCTCCCTTTCCCCACCTTCAGGG + Intronic
1115849512 14:37578728-37578750 TCTCCCTTTCTCCCCAGTCTTGG - Intergenic
1121638428 14:95469236-95469258 GCTCTCCTTCACCCCAGCCATGG - Intronic
1121887880 14:97561411-97561433 ACTCCCATTCACCCAATTCCAGG + Intergenic
1121962611 14:98275213-98275235 GCTCCCTTCCAACCTATTGAGGG - Intergenic
1122503444 14:102217037-102217059 GCTCCCTACCACCCCTTCCAGGG + Intronic
1123943044 15:25225790-25225812 GGTCCCTTCCACCCCACACAGGG + Intergenic
1127327050 15:57906046-57906068 GCTCCCCTTCCTCCAATTCAGGG + Intergenic
1130872688 15:87983742-87983764 CCTCCATTTCACCCCCTTCCTGG - Intronic
1131720067 15:95158195-95158217 GTTCACTTCCACCCAATTCAGGG + Intergenic
1133000035 16:2845636-2845658 CCTCCTTTTCACACCACTCAAGG - Intergenic
1133138013 16:3725589-3725611 GCCCCCATTCACCCCATCCCAGG - Exonic
1135079531 16:19422332-19422354 CCCTCTTTTCACCCCATTCAGGG - Intronic
1137714183 16:50587962-50587984 TCTCCCTTTGCCCCCATCCATGG + Intronic
1137955786 16:52827657-52827679 GATTCCTTTCCCACCATTCAAGG - Intergenic
1138538353 16:57672648-57672670 GTTCCCTTTCACCTAATACAGGG - Intronic
1139447182 16:67005114-67005136 GCTCCCTTTCTCCCCCTCCCAGG + Intronic
1139973233 16:70789458-70789480 CCTCCCTTTAACCCCATTCTTGG - Intronic
1140852941 16:78951736-78951758 GCTCTCTCTCACCCCTTCCATGG - Intronic
1141348061 16:83266742-83266764 GCTGTCTTTTACCTCATTCATGG + Intronic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1145241210 17:21241918-21241940 CCTCCCTTTGACTCCATGCACGG - Exonic
1150353869 17:64466748-64466770 GCTCCCATCCACCCCATTAACGG - Intronic
1152952333 17:83245667-83245689 GCTGCCATTAACCCCATCCAAGG - Intergenic
1158112882 18:53961336-53961358 GCACCCTTTCCCCCAGTTCAGGG - Intergenic
1158195314 18:54878586-54878608 ACTCCCTGACAACCCATTCAGGG + Intronic
1158486996 18:57876429-57876451 CCTACTTTTCACCCCATTGAAGG - Intergenic
1160630662 18:80245083-80245105 GCTGCCTTACACCCCAAGCATGG - Intronic
1160653818 19:249819-249841 GCTGCCATTAACCCCATCCAAGG + Intergenic
1161489532 19:4554287-4554309 GGACCCTCTCACCCCATGCAGGG + Intronic
1162041408 19:7973118-7973140 TGTCCTTTTCACCCCATTCATGG + Intronic
1162319083 19:9960195-9960217 GCCTCCTCTCACCCCATTCCAGG - Exonic
1162419945 19:10560400-10560422 GCTCCCCTTCATCCAACTCAGGG + Exonic
1164149179 19:22533551-22533573 GGTCCCTTTTTCCACATTCAAGG + Intergenic
1165010316 19:32841327-32841349 GCTCCCTCTCACTCCCTGCATGG - Intronic
1165431505 19:35775868-35775890 GGTCCCTGTCACCCCATCCAGGG - Intronic
1167449003 19:49556247-49556269 CCTCCCCTTCACCCCCTCCAAGG - Intronic
1168380246 19:55914125-55914147 TCTCCCATTCTCCCCATTCCTGG + Intronic
1168728321 19:58603890-58603912 GCTGCCATTAACCCCATCCAAGG - Intergenic
926408659 2:12579623-12579645 GGTCCCGTTCATCCCAGTCAGGG - Intergenic
927329650 2:21847119-21847141 TCTCCTTCTCACTCCATTCAGGG + Intergenic
927430864 2:23025198-23025220 GCTCCCATTCCACCCACTCATGG - Intergenic
927962716 2:27250727-27250749 TCTCCATTTCACCCCTTTCCTGG + Intergenic
930257109 2:49105204-49105226 GCTCCCTTTCTCACTTTTCAAGG - Intronic
932029673 2:68170791-68170813 CCTCCATTTCACCCTTTTCAGGG + Intronic
932172188 2:69567191-69567213 TGGCCCTTTCACCCCATTCTTGG + Intronic
932527380 2:72485514-72485536 TCTCCATTTCACCCCAGTCAGGG + Intronic
934649527 2:96083103-96083125 CCTCCCTCCCACCCCACTCATGG + Intergenic
936233397 2:110724149-110724171 ACTCCCATGCACCCCATTCTTGG - Intergenic
936570233 2:113607120-113607142 GCTGCCATTAACCCCATCCAAGG + Intergenic
940185609 2:150981813-150981835 GCTCTCTTTGACCCCATGCCAGG - Intergenic
946247552 2:218396268-218396290 GCACCCATTCGCCCCATTCAGGG + Exonic
946564238 2:220945675-220945697 CCTCCCTGACCCCCCATTCAGGG + Intergenic
948315786 2:237027315-237027337 TCTCCTGTTCACCCCTTTCATGG - Intergenic
1168803119 20:656374-656396 GCTCCGCTTCACCTCAGTCACGG - Intronic
1172064691 20:32210690-32210712 GCTGCCTCTCACCCCATCAAGGG + Intronic
1172190726 20:33060416-33060438 ACTCCCTATCTCCCCATTCTGGG + Intronic
1172560252 20:35881660-35881682 TTTGCCTTTCACCCCATTTATGG + Intronic
1173497320 20:43529024-43529046 GCTCCCTCTCACCAAAGTCATGG - Intronic
1175604975 20:60305168-60305190 CCTCACCTTCACCCCATTCACGG - Intergenic
1176136040 20:63522425-63522447 GCTCCCTTTCCCCCCGCTAAAGG - Intergenic
1176277814 20:64283197-64283219 GCTGCCGTTAACCCCATCCATGG - Intronic
1176277821 20:64283237-64283259 GCTGCCATTAACCCCATCCACGG - Intronic
1180263746 21:46695492-46695514 GCTGCCATTAACCCCATCCAAGG - Intergenic
1180670296 22:17547957-17547979 ACTTCCTTTCACCCCTTTCACGG - Intronic
1184297266 22:43532796-43532818 GCTCCCACTCACCCCACCCAAGG - Intronic
1184410321 22:44322485-44322507 GCTCCCTGTCACCCACTGCATGG + Intergenic
1185429976 22:50803852-50803874 GCTGCCATTAACCCCATCCAAGG - Intergenic
955390909 3:58521589-58521611 GCTCCCTTTCATTCCATCCTGGG + Intronic
957191817 3:77019565-77019587 TCTCCCTTTCATTCCATTCAAGG - Intronic
959078686 3:101778325-101778347 ACTTCCTTTTATCCCATTCACGG + Intergenic
962910604 3:139845890-139845912 TCTCCCCTTCACCCCATGCCAGG + Intergenic
965667691 3:171113048-171113070 GGTCCATTTCACTCCATACAAGG + Intronic
965988770 3:174790053-174790075 GCTCTCTTTCACCACACTCAAGG + Intronic
967828928 3:193902283-193902305 GCTCCCTCTCAGCCCCTTCTCGG + Intergenic
969422842 4:7107395-7107417 GCAGCCATTCACCCCATGCAGGG - Intergenic
969999748 4:11353162-11353184 GCACCCTTTTACCTCAGTCATGG + Intergenic
970196800 4:13559214-13559236 GCTCCCTTTCACCCTGATCATGG + Intergenic
971863605 4:32140584-32140606 CATCCCCTTCACCCCATCCATGG + Intergenic
975039762 4:69731381-69731403 GCCCCCTTGCACCCTGTTCATGG + Intronic
977402882 4:96555982-96556004 TTTCCATTTCACCCTATTCAGGG + Intergenic
979549543 4:121975546-121975568 GATGCCTTTCACCCTCTTCATGG + Intergenic
982562747 4:156950231-156950253 GCCCCCTTTCCCTCCATTCCAGG + Intronic
982684475 4:158471662-158471684 CCTCCATTCCACCCCATCCAGGG + Intronic
984611366 4:181843385-181843407 GCTACCTTGGACCCCATTCAAGG - Intergenic
985338472 4:188921743-188921765 GATGCCTTTTACCCCATTGAAGG + Intergenic
985466408 4:190200738-190200760 GCTGCCATTAACCCCATCCAAGG - Intergenic
986055368 5:4131026-4131048 GCTTCCTCTCACCCCCTCCAGGG + Intergenic
986234210 5:5892641-5892663 GCTTCCCTTCATCTCATTCAGGG + Intergenic
990780062 5:59350498-59350520 GCTTCCTTTTGCCACATTCATGG - Intronic
991574093 5:68084562-68084584 GCTCCCTTACACCACTTACATGG - Intergenic
992559173 5:77933413-77933435 GCTGACTTTCCCCCCATTGAGGG + Intergenic
998266005 5:140668355-140668377 GCTCCCTTCCACCACATTGCTGG - Intronic
998994260 5:147853194-147853216 GCCCCCCTTCAGCCCATTGAAGG - Intergenic
999220492 5:149972378-149972400 TCTCCCTTTCTCTACATTCATGG - Intronic
999865383 5:155695192-155695214 GGTCCCTTTCATCTCATACAGGG + Intergenic
1000414362 5:160967776-160967798 CTTCCCTTTCACCCCCTTCTGGG + Intergenic
1000793887 5:165640509-165640531 GCTCTCTTTCACTCCATCCAAGG - Intergenic
1002746361 5:181477069-181477091 GCTGCCATTAACCCCATCCAAGG - Intergenic
1002755089 6:151353-151375 GCTGCCATTAACCCCATCCAAGG + Intergenic
1003364245 6:5457311-5457333 GCACCCTGTCACCCAATTCTCGG + Intronic
1003430797 6:6035605-6035627 TCTCCATTTCTCCCCATTGAGGG - Intergenic
1004133531 6:12944707-12944729 GCTCCTTTCATCCCCATTCACGG - Intronic
1004934205 6:20491599-20491621 GCTCTCTTACACCGCACTCAGGG + Exonic
1007205504 6:40146800-40146822 ACACCCTTTCACCACTTTCAGGG - Intergenic
1008503017 6:52202082-52202104 GCTCACTTTGACCCCATTTCGGG + Intergenic
1010889953 6:81294261-81294283 TCTCCCTTTCAGCCTATTCCTGG + Intergenic
1012665233 6:101961029-101961051 TCTCCCTGTCACTCCAGTCAAGG - Intronic
1016594432 6:145783560-145783582 TCACCCTTTCGCCCCACTCATGG + Intergenic
1019235241 6:170606376-170606398 GCTGCCATTAACCCCATCCAAGG - Intergenic
1019726298 7:2604704-2604726 GCTCCCACTCACCCCAGTCTGGG - Intronic
1021605914 7:22409630-22409652 ACTTCCTATCAGCCCATTCAAGG + Intergenic
1023537468 7:41228649-41228671 GTTCCTTTTCACCGCATTTATGG + Intergenic
1026042323 7:66878356-66878378 GCACCATTTCACCCCAGCCAGGG - Intergenic
1026152411 7:67799451-67799473 GTTCCCTTTGACCCCATGGAAGG - Intergenic
1027652634 7:80888904-80888926 GCGCCCTTGCACCCCAGCCAGGG - Intronic
1028198898 7:87937603-87937625 CCTCCTTTTCTCCCCATTTATGG + Intronic
1030161671 7:106515766-106515788 GCTCCCTTTCAAACTATTCCAGG - Intergenic
1031100498 7:117474108-117474130 TCTTCCCTCCACCCCATTCATGG - Intronic
1032121816 7:129162322-129162344 GCACCCTCCCACCCCATCCAGGG + Intronic
1035061813 7:156074980-156075002 GCTCCCTTTCGCCTCCATCAGGG - Intergenic
1035513349 8:209609-209631 GCTGCCATTAACCCCATCCAAGG + Intergenic
1035758580 8:2052430-2052452 TCTCCCTCTCACCCCAGGCATGG - Intronic
1037606070 8:20438183-20438205 GCTCCCTTTCTCGCCATCCCAGG + Intergenic
1038348513 8:26754910-26754932 GCTGGCTTTCACACCATCCAAGG - Intronic
1041991228 8:63994580-63994602 GCTCCTTTTCACACTATTCAGGG - Intergenic
1042954464 8:74234208-74234230 GCTCCCTTTGAAGCCATCCAAGG - Intergenic
1044604100 8:94034003-94034025 GCTCACTTGCATTCCATTCATGG - Intergenic
1045244287 8:100429425-100429447 CCTCTCTTTCACACCCTTCAAGG + Intergenic
1045257843 8:100544844-100544866 GTTGCCTCTGACCCCATTCAAGG - Intronic
1046083931 8:109408244-109408266 GCACCCTCTCACATCATTCATGG + Intronic
1046849179 8:118953006-118953028 ACTGCCTTTCACCAGATTCAAGG + Intergenic
1047930583 8:129724789-129724811 GCTCCCTCCCACCCCAGTAAGGG - Intergenic
1049601233 8:143508722-143508744 GCCCCCCTCCACCCCCTTCAGGG + Intronic
1055016494 9:71624145-71624167 GCTCCCTTTACCCCCAGTTAGGG - Intergenic
1060687709 9:125626358-125626380 GCTCCCTCTGACCCCATTACTGG + Intronic
1062234483 9:135501316-135501338 GCTCCCTCTCACCCTATCCATGG - Intronic
1187736514 X:22310536-22310558 GCTCACTTTCCCTCCCTTCATGG + Intergenic
1189049056 X:37624934-37624956 GCTCACATTCACCACTTTCATGG + Intronic
1190012732 X:46799194-46799216 TCTCCCTTTCCCACCTTTCAAGG - Intergenic
1190526750 X:51335520-51335542 GCCACCTTTCACCCCTTTCAGGG - Intronic
1191605579 X:63058491-63058513 GCTGCATTTCACCTCTTTCATGG - Intergenic
1193062351 X:77220176-77220198 GCCCCCTTCCCCCCCATCCAGGG - Intergenic
1196923470 X:120608601-120608623 GCTGCATTTCAGCCCAGTCAGGG + Intronic
1197252426 X:124229682-124229704 GCTCCCTTTCCCCACAGACATGG + Intronic
1197729576 X:129798200-129798222 CCTCCATTTCACTCCTTTCAAGG + Intergenic