ID: 902925098 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:19690736-19690758 |
Sequence | GGAGTCATAGCCAGAGTTGT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 149 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 139} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
902925098_902925102 | 14 | Left | 902925098 | 1:19690736-19690758 | CCTACAACTCTGGCTATGACTCC | 0: 1 1: 0 2: 0 3: 9 4: 139 |
||
Right | 902925102 | 1:19690773-19690795 | CAGTTTCCCAATCTATGATCTGG | 0: 1 1: 0 2: 1 3: 46 4: 550 |
||||
902925098_902925104 | 16 | Left | 902925098 | 1:19690736-19690758 | CCTACAACTCTGGCTATGACTCC | 0: 1 1: 0 2: 0 3: 9 4: 139 |
||
Right | 902925104 | 1:19690775-19690797 | GTTTCCCAATCTATGATCTGGGG | 0: 1 1: 0 2: 1 3: 49 4: 433 |
||||
902925098_902925103 | 15 | Left | 902925098 | 1:19690736-19690758 | CCTACAACTCTGGCTATGACTCC | 0: 1 1: 0 2: 0 3: 9 4: 139 |
||
Right | 902925103 | 1:19690774-19690796 | AGTTTCCCAATCTATGATCTGGG | 0: 1 1: 0 2: 4 3: 66 4: 738 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
902925098 | Original CRISPR | GGAGTCATAGCCAGAGTTGT AGG (reversed) | Intronic | ||