ID: 902925098

View in Genome Browser
Species Human (GRCh38)
Location 1:19690736-19690758
Sequence GGAGTCATAGCCAGAGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902925098_902925102 14 Left 902925098 1:19690736-19690758 CCTACAACTCTGGCTATGACTCC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 902925102 1:19690773-19690795 CAGTTTCCCAATCTATGATCTGG 0: 1
1: 0
2: 1
3: 46
4: 550
902925098_902925104 16 Left 902925098 1:19690736-19690758 CCTACAACTCTGGCTATGACTCC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 902925104 1:19690775-19690797 GTTTCCCAATCTATGATCTGGGG 0: 1
1: 0
2: 1
3: 49
4: 433
902925098_902925103 15 Left 902925098 1:19690736-19690758 CCTACAACTCTGGCTATGACTCC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 902925103 1:19690774-19690796 AGTTTCCCAATCTATGATCTGGG 0: 1
1: 0
2: 4
3: 66
4: 738

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902925098 Original CRISPR GGAGTCATAGCCAGAGTTGT AGG (reversed) Intronic