ID: 902925103

View in Genome Browser
Species Human (GRCh38)
Location 1:19690774-19690796
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 809
Summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 738}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902925097_902925103 20 Left 902925097 1:19690731-19690753 CCAGACCTACAACTCTGGCTATG 0: 1
1: 0
2: 0
3: 6
4: 109
Right 902925103 1:19690774-19690796 AGTTTCCCAATCTATGATCTGGG 0: 1
1: 0
2: 4
3: 66
4: 738
902925098_902925103 15 Left 902925098 1:19690736-19690758 CCTACAACTCTGGCTATGACTCC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 902925103 1:19690774-19690796 AGTTTCCCAATCTATGATCTGGG 0: 1
1: 0
2: 4
3: 66
4: 738
902925099_902925103 -6 Left 902925099 1:19690757-19690779 CCATGCTCCCAAGTCTCAGTTTC 0: 1
1: 0
2: 0
3: 29
4: 333
Right 902925103 1:19690774-19690796 AGTTTCCCAATCTATGATCTGGG 0: 1
1: 0
2: 4
3: 66
4: 738

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type