ID: 902925104

View in Genome Browser
Species Human (GRCh38)
Location 1:19690775-19690797
Sequence GTTTCCCAATCTATGATCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 433}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902925099_902925104 -5 Left 902925099 1:19690757-19690779 CCATGCTCCCAAGTCTCAGTTTC 0: 1
1: 0
2: 0
3: 29
4: 333
Right 902925104 1:19690775-19690797 GTTTCCCAATCTATGATCTGGGG 0: 1
1: 0
2: 1
3: 49
4: 433
902925098_902925104 16 Left 902925098 1:19690736-19690758 CCTACAACTCTGGCTATGACTCC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 902925104 1:19690775-19690797 GTTTCCCAATCTATGATCTGGGG 0: 1
1: 0
2: 1
3: 49
4: 433
902925097_902925104 21 Left 902925097 1:19690731-19690753 CCAGACCTACAACTCTGGCTATG 0: 1
1: 0
2: 0
3: 6
4: 109
Right 902925104 1:19690775-19690797 GTTTCCCAATCTATGATCTGGGG 0: 1
1: 0
2: 1
3: 49
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902925104 Original CRISPR GTTTCCCAATCTATGATCTG GGG Intronic