ID: 902925592

View in Genome Browser
Species Human (GRCh38)
Location 1:19693876-19693898
Sequence GCTGTTGGGGAGCCCTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 559}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902925581_902925592 28 Left 902925581 1:19693825-19693847 CCAGCTGCTTCTCGCAGAAACAT 0: 1
1: 0
2: 1
3: 9
4: 107
Right 902925592 1:19693876-19693898 GCTGTTGGGGAGCCCTGGGTGGG 0: 1
1: 0
2: 1
3: 39
4: 559
902925583_902925592 0 Left 902925583 1:19693853-19693875 CCTGACTAGTGAGCTGAGATGGG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 902925592 1:19693876-19693898 GCTGTTGGGGAGCCCTGGGTGGG 0: 1
1: 0
2: 1
3: 39
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902925592 Original CRISPR GCTGTTGGGGAGCCCTGGGT GGG Intronic
900142918 1:1145960-1145982 GCCGGTGGGCAGCCCTGGGAGGG + Intergenic
900212322 1:1462212-1462234 GGTGTCGGGGAGCCCAGGGAAGG - Intronic
900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG + Intronic
900798131 1:4721677-4721699 GCTGCTGGGGAATCTTGGGTTGG + Intronic
900952932 1:5868114-5868136 GCTGCTTGGGTGCCCTGTGTGGG - Intronic
901325185 1:8361165-8361187 GCCGTGGGGGAGCCCTGTGGGGG + Exonic
901654424 1:10761268-10761290 GGCGTTGGGGAGCCCAGGGTTGG - Intronic
902382809 1:16060522-16060544 GCTGGAGGTGAGACCTGGGTGGG + Intronic
902607378 1:17576180-17576202 GGTCTTGGGGGGCCCGGGGTGGG + Intronic
902611743 1:17601992-17602014 GCTGCTGGGGAGACCTGAGGTGG - Intronic
902671607 1:17978403-17978425 GCAGTTTGGGAGGCCAGGGTGGG + Intergenic
902886756 1:19410621-19410643 GCTGGTGTGGAGCTCTGGGCAGG - Intronic
902925592 1:19693876-19693898 GCTGTTGGGGAGCCCTGGGTGGG + Intronic
902955691 1:19923033-19923055 GCTGGTGGGGAGCCCCTGGAAGG - Intronic
903067836 1:20710710-20710732 GCTGTGGGAGAGGCGTGGGTGGG + Intronic
903224649 1:21887752-21887774 GGTGTTGGGGAGTACAGGGTGGG - Intronic
903229069 1:21911024-21911046 GCAGTCGGAGAGCACTGGGTGGG + Intronic
903252160 1:22062635-22062657 GCAGTTTGGGAGACCTAGGTGGG + Intronic
904343368 1:29852465-29852487 GCTGTTGGGGAAACCTGGACCGG - Intergenic
904371191 1:30048488-30048510 GCAGATGGGCAGCCCTGGGCAGG - Intergenic
904530153 1:31163247-31163269 GCTTTTGGGGAGCCTAAGGTGGG - Intergenic
905176660 1:36140432-36140454 GCTGTGGTGGAGACTTGGGTTGG - Intronic
905206705 1:36346823-36346845 GCTGTGGGCTAGCCCTGGATGGG - Intronic
905920165 1:41714038-41714060 GCTGCTGAGCAGCCCTGGGCAGG - Intronic
906331887 1:44892331-44892353 GCTCTTTGGGAGGCCTAGGTGGG + Intronic
906525379 1:46490477-46490499 GGAGTTGCGGAGCCCTGGGCGGG + Intergenic
906610294 1:47196923-47196945 GCTGGCCTGGAGCCCTGGGTAGG - Intergenic
907246042 1:53109805-53109827 GATGGTGGGCAGCCCTGGGGTGG + Intronic
907247580 1:53117852-53117874 GCTGATGGGGGCCCCAGGGTGGG - Intronic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
907513812 1:54980838-54980860 GCGGCTGGTGAGCCCTGGGAGGG + Exonic
907719018 1:56954192-56954214 GCTTTTGGGGATCTCTGAGTTGG - Intronic
908295544 1:62709024-62709046 GCAGTTTGGGAGGCCTAGGTGGG + Intergenic
910288015 1:85576391-85576413 GCGTGTGGGGAGCCCTGGATAGG - Intronic
911623420 1:100093289-100093311 GCTGTTGGGGAGGCTGAGGTGGG - Intronic
911737224 1:101351108-101351130 GCACTTTGGGAGGCCTGGGTGGG - Intergenic
913133541 1:115864480-115864502 GCTACTTGGGAGGCCTGGGTGGG + Intergenic
914084650 1:144442533-144442555 GCTGTTGGGGCCGCCTGGGCTGG - Intronic
914508036 1:148306286-148306308 GCAGTTTGGGAGGCCGGGGTGGG - Intergenic
915304052 1:154967951-154967973 CATGGTGGGGAGCACTGGGTGGG - Intronic
916061954 1:161105360-161105382 GCTCTTTGGGAGGCCAGGGTGGG - Intronic
916540651 1:165750821-165750843 GCACTTTGGGAGGCCTGGGTGGG + Intronic
916754598 1:167756904-167756926 GATGTCGGGGAGCACAGGGTGGG + Intronic
917073946 1:171183831-171183853 GCAGTTTGGGAGGCCAGGGTAGG - Intergenic
917242908 1:172968567-172968589 GTAGTAGGGGAGCCCAGGGTGGG - Intergenic
917984037 1:180296675-180296697 GCACTTTGGGAGCCCCGGGTGGG - Intronic
919756447 1:201069104-201069126 GCTGTGGGGCAGCCCTGGGGAGG - Intronic
919764893 1:201120613-201120635 ACTGGTGGGAAGCCCTGGGGAGG + Intronic
920286748 1:204885167-204885189 CCTTTTGAGGAGCCCAGGGTGGG + Intronic
922447026 1:225706320-225706342 GCACTTGGGGAGGCCAGGGTGGG + Intergenic
922850743 1:228731729-228731751 GTTGTTGGGGACCCAGGGGTGGG + Intergenic
922886019 1:229021373-229021395 GCTGTTTGGGAGCCTGAGGTGGG - Intergenic
923261031 1:232268258-232268280 GCAGTTGGGGAGGCCAGGGTGGG - Intergenic
923336997 1:232979369-232979391 GCGGGTGAGGAGCCCTGGGCTGG + Exonic
923517604 1:234710408-234710430 AGTTTTGAGGAGCCCTGGGTGGG + Intergenic
924689621 1:246333625-246333647 GCACTTGGGGAGGCCTAGGTGGG + Intronic
924840789 1:247707906-247707928 GCTGTTTGGGAGCCTTTGGCAGG - Intergenic
1062955135 10:1535086-1535108 CCTGTTGAGGACCCATGGGTTGG - Intronic
1063101256 10:2951908-2951930 GCTCTTGGCGAGCCCAGTGTGGG - Intergenic
1063130074 10:3170747-3170769 GCACTTTGGGAGGCCTGGGTGGG + Intronic
1064028426 10:11867786-11867808 GTTGTTGGGGATCCCTGAGCTGG + Intronic
1064307308 10:14179075-14179097 GCTGTTGGGTAGGCCATGGTTGG + Intronic
1064388524 10:14921070-14921092 GCACTTGGGGAGGCCTAGGTGGG + Intronic
1064537988 10:16378011-16378033 GCTGCTTGGGAGGGCTGGGTTGG - Intergenic
1065585350 10:27212100-27212122 GCAGTTTGGGAGGCCAGGGTAGG + Intronic
1066076126 10:31879162-31879184 GCAGTTGGGGAGGCCTAGGCAGG + Intronic
1067369257 10:45667713-45667735 GCTCTTTGGGAGGCCAGGGTGGG - Intronic
1068029716 10:51691560-51691582 GCTGTTTGGGAGCCCAAGGCTGG - Intronic
1068197296 10:53733182-53733204 GCAGTTTGGGAGCCCAAGGTGGG - Intergenic
1068950310 10:62770034-62770056 GCTGCTGGGAAGCCCCTGGTAGG + Intergenic
1068976816 10:63019414-63019436 GCACTTTGGGAGCCCTAGGTGGG - Intergenic
1069166264 10:65164213-65164235 GCTCTTTGGGAGGCCTAGGTGGG - Intergenic
1069180978 10:65358027-65358049 GCTGTTGGGGAGGCTGTGGTAGG - Intergenic
1069428166 10:68308784-68308806 GCTCTTTGGGAGGCCTAGGTGGG - Intronic
1069429410 10:68320763-68320785 GCAGTTTGGGAGGCCTAGGTGGG - Intronic
1069482436 10:68796047-68796069 GCAGTTGGGGAGTCCTAGGTGGG - Intergenic
1069491066 10:68860960-68860982 GCTCTTTGGGAGCCCAAGGTGGG + Intronic
1069950050 10:72012400-72012422 GCAGTTGGGGAGGCCAAGGTGGG + Exonic
1071527859 10:86368220-86368242 ACTGTGAGGGAACCCTGGGTGGG + Intergenic
1072211465 10:93250397-93250419 GCTGTTGGGAAGCTCAGGGGAGG - Intergenic
1072414197 10:95233199-95233221 GTTGTTGGGCACCCCTGTGTTGG - Intergenic
1073031574 10:100529985-100530007 GCAGTTGGGAAGCCAAGGGTTGG + Intronic
1073198117 10:101711838-101711860 GCACTTTGGGAGGCCTGGGTGGG + Intergenic
1073324598 10:102634948-102634970 GGTGGTGGGGAGGCCGGGGTGGG + Intergenic
1073498859 10:103918259-103918281 GCTGGCGGGGAGACCGGGGTTGG - Intergenic
1073681468 10:105708705-105708727 GCAGTTTGGGAGCCCGAGGTGGG - Intergenic
1075247859 10:120840000-120840022 GCTCTTGGAGAGCACTGGGTGGG + Intergenic
1076288999 10:129329711-129329733 GCAGTTTCGGAACCCTGGGTGGG - Intergenic
1076411555 10:130255097-130255119 GCTGTTGAAGGGGCCTGGGTGGG + Intergenic
1076605877 10:131689591-131689613 GCTGTTGGGGAGTCCAGCGGTGG - Intergenic
1076887123 10:133268006-133268028 GCTCTTGGGGGCCCCTGGATGGG + Exonic
1076979476 11:197013-197035 GCTCTAAGGGAGCCCTGGGCCGG - Exonic
1077142337 11:1030108-1030130 AATGTTGGGGTGACCTGGGTCGG + Intronic
1077162425 11:1119822-1119844 GCTGTGGGGGAGGCCGGGGGCGG + Intergenic
1077166051 11:1139341-1139363 GCTGCAGGGAAGCCCTGGGGTGG + Intergenic
1077227129 11:1443292-1443314 GCTGTTGGGGGGCGCAGGGCAGG - Intronic
1077412600 11:2410596-2410618 GTTGGTGGGGAGCTCTGGGGTGG - Intronic
1077415166 11:2421372-2421394 GCTGCTGAGCAGCCTTGGGTGGG - Intronic
1077446158 11:2591915-2591937 GCTCTTGGAGAGCCCTGGCTTGG + Intronic
1077803610 11:5567550-5567572 TCTGTTGGGGATCCCAGGGCTGG - Intronic
1078041616 11:7868851-7868873 GCAGTTTGGGAGGCCTAGGTGGG + Intergenic
1078180177 11:9004364-9004386 GCTGTCGGTGATCCCCGGGTCGG - Intergenic
1078430039 11:11281501-11281523 GCTGTTGGCAAGGCCTGGGCCGG - Intronic
1078498259 11:11842000-11842022 GCGGCGGCGGAGCCCTGGGTCGG + Exonic
1078591813 11:12647959-12647981 GCACTTTGGGAGGCCTGGGTAGG + Intergenic
1080509200 11:32950338-32950360 GCACTTTGGGAGGCCTGGGTGGG - Intronic
1080652251 11:34232200-34232222 GCACTTGGGGAGGCCTAGGTGGG + Intronic
1080695634 11:34600798-34600820 GCTCTTGGGGAGCTCGGGGGAGG + Intergenic
1081050817 11:38338365-38338387 CCTGTTGGGGAGGGCAGGGTGGG + Intergenic
1081604279 11:44517721-44517743 GCAGTGGGTGAGCCCTGGGCTGG + Intergenic
1081842667 11:46214599-46214621 GCTGATGGGAAGCTCTGAGTGGG + Intergenic
1082060855 11:47858851-47858873 GCATTTGGGGAGCCCAAGGTCGG - Intergenic
1083179163 11:60973140-60973162 GCTGGTCTGAAGCCCTGGGTTGG - Intronic
1083333450 11:61909719-61909741 GCTATGGCGGAGCCCTGGGCTGG + Intronic
1083451942 11:62752160-62752182 GCTGTTGGGGAGCCAGGGAGAGG + Exonic
1083623670 11:64061003-64061025 GCGGTTGAGGATGCCTGGGTCGG - Intronic
1083637293 11:64127484-64127506 GTTCTTGGGGTGCCCTGGCTCGG + Intronic
1083750812 11:64759631-64759653 GCTGCTGGGGAGCCTGGGGTGGG - Intronic
1083833132 11:65246160-65246182 GCTACTTGGGAGCCCTAGGTGGG + Intergenic
1083933767 11:65859938-65859960 GCAGTTGGGGAGGCCTGAGATGG - Intronic
1083997665 11:66280068-66280090 GCTGTGGGAAGGCCCTGGGTGGG - Intronic
1085106028 11:73843830-73843852 GCACTTGGGGAGGCCTAGGTGGG + Intronic
1085260921 11:75204226-75204248 TCTGCAGAGGAGCCCTGGGTGGG - Intronic
1085380367 11:76111587-76111609 GCAGTTGGGGAACTCTGTGTTGG - Intronic
1085622402 11:78047316-78047338 GCACTTTGGGAGGCCTGGGTAGG - Intronic
1085668643 11:78440308-78440330 GCACTTTGGGAGGCCTGGGTGGG - Intronic
1086591554 11:88521169-88521191 GCTTTTTGGGAGGCCTAGGTGGG + Intronic
1087935917 11:104034886-104034908 GCAGTTTGGGAGGCCAGGGTGGG - Intronic
1088523839 11:110730007-110730029 GCAGTTTGGGAGGCCTAGGTGGG + Intergenic
1089557638 11:119323405-119323427 GTGGCTGGGGAGCCCGGGGTTGG - Intergenic
1089608744 11:119657501-119657523 GCTATTGGGGAGCCTGAGGTAGG + Intronic
1090268403 11:125369308-125369330 GCTGGTGGAGAGCTCTGGCTTGG + Intronic
1090889968 11:130915087-130915109 GCTGTTCGGGGGCACTGGCTGGG + Exonic
1091013086 11:132024062-132024084 GCACTTGGGGAGCCCGAGGTGGG - Intronic
1091053538 11:132396959-132396981 GCAGTTTGGGAGGCCAGGGTGGG + Intergenic
1091930126 12:4389329-4389351 CATGTGGGGGGGCCCTGGGTGGG - Intergenic
1092366121 12:7878503-7878525 GCGGTTTGGGAGGCCTAGGTGGG - Intronic
1093493351 12:19728577-19728599 GCACTTTGGGAGGCCTGGGTGGG + Intergenic
1093524237 12:20089328-20089350 GCTGTTTGGGAGGCCAAGGTGGG + Intergenic
1094626808 12:32132169-32132191 GCTGTTTGGGAGGCCAAGGTGGG + Intronic
1096292849 12:50356750-50356772 GCACTTTGGGAGACCTGGGTGGG + Intronic
1096464534 12:51841050-51841072 GCTGCTGGGGACTCCTGGGTGGG - Intergenic
1096465459 12:51845996-51846018 GGTGGTGGAGACCCCTGGGTGGG - Intergenic
1097201209 12:57280387-57280409 GCTGTTGCTGAGGCGTGGGTGGG + Exonic
1099106203 12:78499254-78499276 GCACTTTGGGAGCCCTAGGTGGG + Intergenic
1101609085 12:106274166-106274188 GCACTTTGGGAGGCCTGGGTGGG + Intronic
1101939474 12:109089355-109089377 CCTGGTGGAGAACCCTGGGTGGG - Intronic
1102345893 12:112161309-112161331 GGTGATGGGGAGTGCTGGGTGGG + Exonic
1102702044 12:114847734-114847756 GGTGTTGGGGTGCACTGGGGCGG + Intergenic
1102998138 12:117365147-117365169 GCTCTGGCGGAGCCCTGGGCAGG + Intronic
1103292173 12:119855476-119855498 GCTGTCAGAGAACCCTGGGTGGG + Intronic
1103364910 12:120374923-120374945 GCTGTTGGGGAGGCTGAGGTGGG - Intergenic
1103684860 12:122723877-122723899 GCTGTTTGGGAGGCCGAGGTGGG - Intergenic
1103701559 12:122850751-122850773 GGTGGGGGGGAGCCCTGGTTCGG + Intronic
1103840502 12:123859785-123859807 GCACTTTGGGAGGCCTGGGTGGG + Intronic
1103898670 12:124291816-124291838 GTGCTTGGGGAGCCCTGGGCTGG + Intronic
1103985108 12:124761709-124761731 GCTCTGGGGGAGACCTGGGTTGG + Intergenic
1104331688 12:127852952-127852974 GCTTTTGAGGAGCCCTGCTTGGG + Intergenic
1104578049 12:129986384-129986406 GCTGTAGGGAAGCCCTGTGTAGG + Intergenic
1104695401 12:130859778-130859800 GCAGTTTGGGAGGCCTAGGTGGG - Intergenic
1105363629 13:19744245-19744267 GCTGTTGGGGAGACTGAGGTGGG - Intronic
1106015905 13:25868821-25868843 GCACTTTGGGAGGCCTGGGTGGG + Intronic
1106622245 13:31381904-31381926 GCTGTTTGGGAGGCTTAGGTGGG + Intergenic
1107484908 13:40816893-40816915 GCACTTTGGGAGCCCTAGGTGGG + Intergenic
1109367287 13:61372136-61372158 GCATTTTGGGAGGCCTGGGTTGG + Intergenic
1109534082 13:63693761-63693783 GCTGCTGGAGTGCCCTGGCTAGG - Intergenic
1110177379 13:72573367-72573389 GCCCTTTGGGAGGCCTGGGTGGG - Intergenic
1111600520 13:90468355-90468377 GCACTTGGGGAGGCCAGGGTGGG - Intergenic
1111777370 13:92681461-92681483 GCTGTGGTGGAGGCCAGGGTAGG - Intronic
1112934829 13:104784126-104784148 GCTCTTTGGGAGGCCGGGGTGGG - Intergenic
1113937086 13:114000190-114000212 TCTGCTGGGGTGCCCTGGGCCGG + Intronic
1114065764 14:19059007-19059029 GCTGTTGCGGGGCCCGGGGAAGG - Intergenic
1114096497 14:19340993-19341015 GCTGTTGCGGGGCCCGGGGAAGG + Intergenic
1118303563 14:64636049-64636071 GCACTTGGGGAGGCCAGGGTGGG + Intergenic
1118765995 14:68909663-68909685 GCTGTTCCAGAGCCCTGGGCTGG + Intronic
1118852221 14:69592611-69592633 GCTATTTGGGAGGCCAGGGTGGG - Intergenic
1121335864 14:93077129-93077151 GCTGTTGGCGAGGCCAGGGCAGG - Intronic
1121459826 14:94066145-94066167 GCTGTTGGGGAGGACACGGTGGG + Intronic
1121645409 14:95514853-95514875 GCTGCCGGGGGGCCCTGGCTTGG - Intergenic
1121814721 14:96920480-96920502 GTGGTAGGGGAGCCCTGGGCTGG - Intronic
1122243418 14:100383971-100383993 TCTGTGGGGCTGCCCTGGGTGGG + Intronic
1122353120 14:101108935-101108957 GCCCTAGGGGCGCCCTGGGTGGG - Intergenic
1122793491 14:104194254-104194276 GCTGCTCCGGAGCCCTGGATGGG - Intergenic
1122793877 14:104195925-104195947 GCTGTTGGGGAGGCCATGCTGGG + Intergenic
1123048567 14:105530012-105530034 TCTGTTTGGGAGGCCTGGGCCGG + Exonic
1202830158 14_GL000009v2_random:19314-19336 GCACTTTGGGAGCCCTAGGTGGG + Intergenic
1123939908 15:25211775-25211797 GCAGGGGGGGTGCCCTGGGTTGG + Intergenic
1124014504 15:25863769-25863791 GCTCCTGGGGAGCCCTGGGAAGG + Intronic
1124015431 15:25869922-25869944 GGGGATGTGGAGCCCTGGGTGGG - Intergenic
1125502005 15:40245770-40245792 GCAGCTGGGGATCCCTGGGCTGG - Intronic
1125673649 15:41491013-41491035 GCGCTTTGGGAGGCCTGGGTGGG + Intergenic
1125686766 15:41568218-41568240 GGTTTTGGGGAGCGCTGGCTGGG - Exonic
1126031633 15:44505183-44505205 GCACTTTGGGAGCCCTAGGTGGG + Intronic
1126149731 15:45512879-45512901 GCTGTTTGGGAGGCCGAGGTGGG + Intronic
1126414583 15:48404613-48404635 GCTGTTGGGGAGGCCAAGGCAGG - Intergenic
1128001413 15:64196103-64196125 GCTGTTTGGGAGGCTGGGGTGGG + Intronic
1128940042 15:71780625-71780647 GCTGTTGGGGACCCCAGGGAGGG + Exonic
1129056848 15:72826280-72826302 GCTGTCAGGAGGCCCTGGGTGGG + Intergenic
1129115620 15:73363902-73363924 ACTGCTGTGGAGCCCTGTGTGGG - Intronic
1129338623 15:74870117-74870139 TCTGGTGGGGAGTCCTGGGTGGG - Intronic
1129436678 15:75547047-75547069 GCACTTTGGGAGGCCTGGGTGGG + Intronic
1129530479 15:76260722-76260744 GGTTTTGGGGAGCGCTGGCTGGG + Intronic
1129709938 15:77815718-77815740 GGTGCTGGGAAGACCTGGGTGGG - Intronic
1130997968 15:88914627-88914649 GCTCTTGGGGAGGCCGAGGTAGG + Intergenic
1132187844 15:99818637-99818659 GCTGTGGTGGAGGCCAGGGTAGG + Intergenic
1132575007 16:660212-660234 GGTGCTGGGGAGCCCTGCGGGGG - Intronic
1132874394 16:2129795-2129817 GCAGTTTGGGAGGCCAGGGTGGG - Intronic
1133152943 16:3850522-3850544 ACTATTGAGGAGGCCTGGGTGGG + Exonic
1133431371 16:5739963-5739985 GTTGCTGAGGAGCCCTGGGGAGG + Intergenic
1133468554 16:6051808-6051830 GCAGTTTGGGAGGCCAGGGTGGG - Intronic
1133672897 16:8041397-8041419 GCTGTTGGGGAGGCCAAGGCGGG + Intergenic
1134022202 16:10929096-10929118 GCTGTTGGGGGGCTGAGGGTGGG - Exonic
1134553339 16:15148628-15148650 GCAGTTTGGGAGGCCAGGGTGGG - Intergenic
1134661645 16:15988818-15988840 GCACTTTGGGAGCCCTGGGTGGG + Intronic
1135136423 16:19888110-19888132 GCACTTGGGGAGGCCTGGGCAGG - Intergenic
1135881109 16:26258498-26258520 GCAGTTTGGGAGGCCTAGGTGGG + Intergenic
1135955074 16:26949530-26949552 GCTGCTTGGGAGGCTTGGGTGGG + Intergenic
1135993039 16:27229036-27229058 GGTGGTGGGAAGCCCTGGGGTGG - Intronic
1136027848 16:27481502-27481524 GCTGTGAGGGAGCACTGTGTGGG - Intronic
1136076445 16:27820501-27820523 GCTGTGGGGGAGCCTTGTGAAGG - Intronic
1136136189 16:28258356-28258378 GAAGTTGGGGGGCCCTGGGAAGG - Intergenic
1137441327 16:48501112-48501134 GCACTTGGGGAGGCCGGGGTGGG - Intergenic
1137646797 16:50082093-50082115 GCACTTGGGGAGGCCAGGGTGGG + Intronic
1138009047 16:53361044-53361066 GCTGTTTGGGAGGCCGAGGTGGG - Intergenic
1138476205 16:57271953-57271975 GGTGCTGGGGAGGCTTGGGTAGG - Intronic
1138477992 16:57283545-57283567 GCTGGGTGGGTGCCCTGGGTGGG - Intronic
1139107882 16:63850273-63850295 GCACTTTGGGAGGCCTGGGTAGG - Intergenic
1139946776 16:70647277-70647299 GGTGTTGGGGAGCCCCGGGCGGG + Intronic
1139966169 16:70746581-70746603 GGAGCCGGGGAGCCCTGGGTGGG + Intronic
1140016198 16:71188239-71188261 GCTGCTTGGGAGGCCTAGGTTGG - Intronic
1140389591 16:74573732-74573754 GCTCTTTGGGAGGCCAGGGTGGG - Intronic
1140619082 16:76705995-76706017 ACTGTGGGGTAGCCCTGGGGTGG - Intergenic
1140984722 16:80147122-80147144 CCTGTTGGTGAGCCTTGGGCTGG + Intergenic
1141423204 16:83930523-83930545 CCTTGTGGGGAGCTCTGGGTGGG - Intronic
1142372608 16:89691434-89691456 GCTGATGGGGATGCCTGGGGAGG - Exonic
1142429678 16:90019386-90019408 GCTGTTGGGGCGCCCGGGCCAGG - Intronic
1142482612 17:228104-228126 GCTGGAGGGGAGCCTGGGGTGGG + Intronic
1142668359 17:1475172-1475194 GCAGTTGGGGAGGCCGAGGTGGG + Intronic
1142906891 17:3049421-3049443 GCTGGGGTGGAGCCCTGGCTCGG + Intergenic
1142917719 17:3155694-3155716 GCACTTTGGGAGGCCTGGGTGGG + Intergenic
1143139613 17:4733961-4733983 GCACTTTGGGAGGCCTGGGTGGG + Exonic
1144498214 17:15763900-15763922 GCTCTTTGGGAGCCCAAGGTGGG - Intergenic
1144992875 17:19245993-19246015 GCACTTGGGGAGCCCGAGGTAGG - Intronic
1144997341 17:19279290-19279312 GCTCATTGGGAGCCCTGGCTGGG + Intronic
1145161594 17:20578942-20578964 GCTCTTTGGGAGCCCAAGGTGGG - Intergenic
1145811831 17:27768947-27768969 GCTGTGGGGCAGCTCTGGCTGGG + Intronic
1145889040 17:28402158-28402180 GCTGATGGGCAGCCATGGCTGGG - Exonic
1146417324 17:32647965-32647987 GCAGTTTGGGAGGCCTAGGTGGG + Intronic
1146483007 17:33220169-33220191 TCAGTTGGGGAGGCCAGGGTGGG - Intronic
1146911150 17:36649371-36649393 GCAGTTTGGGAGGCCAGGGTGGG - Intergenic
1147009749 17:37435824-37435846 GCACTTTGGGAGACCTGGGTGGG - Intronic
1147246982 17:39128464-39128486 GCACTTTGGGAGGCCTGGGTGGG - Intronic
1147665224 17:42142807-42142829 GCTGTTGGCGGGCTCAGGGTAGG - Intronic
1147780353 17:42936521-42936543 GCAGTTTGGGAGGCCAGGGTGGG + Intergenic
1148060010 17:44829969-44829991 ACTCTTGGGGAGCCCGGGGAGGG - Intronic
1148208728 17:45795383-45795405 GAGGTTGGGAAGCCCTGGGTTGG - Intronic
1148669930 17:49402848-49402870 GCTGCTGGGAGGCCCTGGGAGGG + Intronic
1149701675 17:58660487-58660509 GCTGTAGGGGAGCTCAGGGAGGG + Intronic
1149709516 17:58727813-58727835 GCTGTTTGGGAGGCCAGAGTTGG + Intronic
1150207961 17:63423258-63423280 CCTGTTTTGCAGCCCTGGGTGGG + Exonic
1150342999 17:64383883-64383905 GCTCTTTGGGAGGCCTAGGTCGG + Intronic
1150454858 17:65299144-65299166 GCTGCTTGGGAGGCCTAGGTGGG - Intergenic
1150577384 17:66442301-66442323 GCACTTTGGGAGGCCTGGGTGGG - Intronic
1151313537 17:73308786-73308808 GCTCTTGGGGAGGCCGAGGTGGG + Intronic
1151836420 17:76585600-76585622 GCCGCCGGGGAGCCCTGGGCTGG + Intronic
1151954231 17:77372746-77372768 GCTGCAGGGGTGCCCTCGGTGGG + Intronic
1152144705 17:78561328-78561350 GCTGCAGGGGAGCCCCGGCTTGG - Intronic
1152335905 17:79700202-79700224 CCTGCTGGGGGGCCCTGGGCAGG - Intergenic
1152469325 17:80482171-80482193 GCTGTGGGGAAGCCCCTGGTGGG - Intergenic
1152526188 17:80889509-80889531 GCTGCTGGGGAGCCCTCAGGGGG + Intronic
1152657091 17:81524771-81524793 CCTGCTGGGCAGCCCTGAGTAGG + Intergenic
1152690398 17:81715390-81715412 GCTGAGGGGGATCCCTGGCTGGG + Intronic
1153051500 18:906327-906349 GCTGTGGATGAGCCCTGGGTAGG + Intronic
1153276687 18:3374420-3374442 GCTGCTGAGGAGCCCTGACTTGG - Intergenic
1153741765 18:8137491-8137513 GAAGTTGGGGAGCCATGGGAAGG - Intronic
1153919659 18:9777093-9777115 GCTCTTTGGGAGGCCTAGGTGGG + Intronic
1154316132 18:13304541-13304563 GCTGCTGGGGAGGGCTGGGAAGG + Intronic
1156409880 18:36817545-36817567 GCTATTGGGGAGGCTGGGGTGGG - Intronic
1158442970 18:57493606-57493628 GCTGGTGGGAAGCCCTGGGAAGG + Intergenic
1159696452 18:71562994-71563016 GCTCTTTGGGAGGCCAGGGTAGG + Intergenic
1160579117 18:79873609-79873631 TCTGTTGGGGAGCCCTGGACGGG + Intronic
1161431101 19:4232995-4233017 GCGGATGGGGATCCCGGGGTGGG - Intronic
1161447982 19:4328642-4328664 GCGTCTGGAGAGCCCTGGGTGGG - Intronic
1161723763 19:5917157-5917179 ATAGTTGGGGAGCCCTGGGCAGG + Exonic
1161950190 19:7463567-7463589 GCTGTGGGGCAGCCATGGGGAGG - Intronic
1163048518 19:14663247-14663269 GCACTTGGGGAGGCCTAGGTGGG - Intronic
1163419751 19:17207285-17207307 GCTGTCGTGGGGTCCTGGGTGGG - Intronic
1163447596 19:17356364-17356386 GCTGATGTGGGGCCCTGCGTCGG + Intronic
1163557234 19:17999699-17999721 GCAGATGCTGAGCCCTGGGTGGG + Exonic
1163767243 19:19170436-19170458 GATGCTGGGGCGCCATGGGTGGG + Intronic
1163771345 19:19192897-19192919 GCAGTGGGGGAGCTCTGGGGTGG + Intronic
1164835801 19:31354374-31354396 GCTTTTAGGGAGCCCAGGGCTGG + Intergenic
1165040154 19:33063337-33063359 ACTGGTGAGGAGCCCTGGGCAGG - Intronic
1165138273 19:33684393-33684415 GCTGCTGGGGAGCGCTGGCCTGG - Intronic
1165690612 19:37860150-37860172 GCTCTTTGGGAGGCCTAGGTGGG + Intergenic
1166139773 19:40799587-40799609 GGCGTTGGGGTGCCCTGGATGGG + Exonic
1166325387 19:42047132-42047154 GCAGTTTGGGAGGCCGGGGTGGG - Intronic
1166354918 19:42221245-42221267 GCGCTTTGGGAGGCCTGGGTGGG + Intronic
1166381898 19:42359076-42359098 GCTGTTGGGGAGACGGGGGGTGG - Exonic
1166719616 19:44989579-44989601 GATGTGGGGGAGCTCTGGGATGG + Intronic
1166744013 19:45131338-45131360 GGGTGTGGGGAGCCCTGGGTGGG - Intronic
1166765811 19:45251655-45251677 CCCCTTGGGGAGCCCTGGCTGGG + Intronic
1166779024 19:45330483-45330505 GCACTTTGGGAGGCCTGGGTGGG - Intergenic
1167244639 19:48365662-48365684 GCTGTTGGGGGCCCCAGGATTGG - Intronic
1167411685 19:49347719-49347741 GCTGCTGGGGAGCTATGGGAGGG - Intronic
1168405356 19:56107714-56107736 TCTGTTGGGGAGGCTGGGGTGGG + Intronic
925142412 2:1559253-1559275 GCTGGTGAGGGGCCCTGTGTGGG - Intergenic
925160239 2:1678307-1678329 GGTGATGGGGAGCCATGGGAGGG - Intronic
926662458 2:15482362-15482384 GCACTTTGGGAGCCCTAGGTGGG - Intronic
927846499 2:26475055-26475077 GGGGTCGGGGAGCCCTGGGGTGG + Intronic
928313197 2:30227262-30227284 GCAGTTTGGGAGGCCTAGGTGGG - Intergenic
929106159 2:38368044-38368066 GCTGTTGGGGAGCCTGAGGCAGG - Intronic
929647303 2:43640299-43640321 GCTACTCGGGAGCCCTGTGTGGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
931394188 2:61871282-61871304 GCTGTTTGGGAGGCCGAGGTGGG - Intronic
931519018 2:63074730-63074752 GCACTTGGGGAGGCCAGGGTGGG - Intergenic
931522735 2:63117524-63117546 GTTGTTGTGATGCCCTGGGTAGG + Intergenic
931776121 2:65541903-65541925 GCAGTTTGGGAGGCCAGGGTGGG - Intergenic
931996284 2:67842264-67842286 TGTGCTGGGGAGACCTGGGTTGG - Intergenic
933226376 2:79754111-79754133 GCTCTTTGGGAGGCCTAGGTGGG - Intronic
934558044 2:95297673-95297695 GGTGTTGGGGTGTCCTGGCTGGG + Intronic
934851063 2:97701514-97701536 GGGTTTGGGGATCCCTGGGTGGG + Intergenic
935144926 2:100389112-100389134 GCTGCTGGGAGGCACTGGGTTGG + Intergenic
936449523 2:112623495-112623517 GCACTTGGGGAGGCCTAGGTGGG + Intergenic
936462378 2:112722845-112722867 CCTCTTGGGGAGCCCTTGGGGGG - Intronic
936480479 2:112880459-112880481 GCTGCTGGGGAGGCTTGGGAAGG + Intergenic
938402564 2:131005369-131005391 GCTGGAGGGCAGCCCTGTGTGGG - Intronic
938483169 2:131679136-131679158 GCTGTTGCGGGGCCCAGGGAAGG - Intergenic
938540920 2:132282753-132282775 GCTCTTGGGGAGTCCGGGCTAGG + Intergenic
939888430 2:147706796-147706818 GCCCTTGGGGAGCCCAGTGTAGG - Intergenic
939934120 2:148268326-148268348 GCACTTTGGGAGGCCTGGGTGGG - Intronic
940191278 2:151042557-151042579 GCTCTTTGGGAGGCCGGGGTTGG - Intronic
940886147 2:158990824-158990846 GCTCTTTGGGAGGCCAGGGTGGG + Intronic
942189105 2:173453581-173453603 GCTCTTTGGGAGCCCAAGGTGGG + Intergenic
942455676 2:176136753-176136775 GCTGGTGGGGAGCCCGGCGAGGG + Intergenic
942648975 2:178147474-178147496 GCACTTTGGGAGGCCTGGGTGGG + Intergenic
943329223 2:186538991-186539013 GCAGTTTGGGAGGCCAGGGTGGG - Intergenic
944691121 2:202159436-202159458 GTAGTTGGGAAGCCCTGGGTGGG + Intronic
945205294 2:207325066-207325088 GCAGTTGGGGAGGCCAAGGTGGG + Intergenic
946242374 2:218364563-218364585 GATGATGGGGAGCCCTTGGCGGG + Intronic
947170928 2:227310560-227310582 GCTCTTTGGGAGGCCTAGGTGGG - Intronic
947171950 2:227320908-227320930 GCTGTGAGGGAGCCCATGGTGGG - Intergenic
947396881 2:229695428-229695450 CCTGTGGGGGAGGCATGGGTGGG - Intronic
948795179 2:240398990-240399012 GCTTTTGGGGGGACCTGGGGAGG - Intergenic
1168865553 20:1082842-1082864 GCACTTTGGGAGCCCTAGGTGGG + Intergenic
1169190307 20:3654765-3654787 GCTGCTGGGAAGCCCTGGATCGG - Intergenic
1170470210 20:16661225-16661247 GCACTTTGGGAGCCCTAGGTGGG - Intergenic
1170836925 20:19892621-19892643 GCAGTTTGGGAGGCCAGGGTGGG - Intronic
1170893066 20:20392111-20392133 CCTGCTGGGGCGCCCTGGGTGGG - Intronic
1171490942 20:25516763-25516785 GCTGGTAAGGAGCCCTGGGATGG - Intronic
1172209540 20:33187152-33187174 GCAGCTGGGGAGCCTGGGGTAGG + Intergenic
1173614937 20:44396419-44396441 GCAGTTGGGGAGGCATGTGTAGG - Intronic
1173617715 20:44413821-44413843 AGTGTGGGGGATCCCTGGGTGGG - Intronic
1173864839 20:46307367-46307389 GGTGCCGGGCAGCCCTGGGTGGG - Intronic
1174286062 20:49474415-49474437 GCAGTCAGGGAGTCCTGGGTGGG + Intronic
1175262557 20:57684015-57684037 GGTGTTGCGGAGCCGGGGGTGGG - Intronic
1175726247 20:61320650-61320672 GCTGGGAGGCAGCCCTGGGTAGG - Intronic
1176046746 20:63096852-63096874 CCTGTGAAGGAGCCCTGGGTTGG + Intergenic
1176195649 20:63835470-63835492 GGTCCTGGGGAGGCCTGGGTGGG - Intergenic
1176277400 20:64280125-64280147 GCCTCTGGGGAGCCTTGGGTTGG + Intronic
1176416114 21:6475739-6475761 GCTGCTCGGGAGCCCGAGGTGGG - Intergenic
1176609344 21:8864154-8864176 GCACTTTGGGAGCCCTAGGTGGG + Intergenic
1179104123 21:38383436-38383458 GCTGGTGGGGAGCCTAGTGTTGG + Exonic
1179623539 21:42633984-42634006 GCTGATGGCGAGCTCTGGCTGGG - Intergenic
1179691614 21:43084073-43084095 GCTGCTCGGGAGCCCGAGGTGGG - Intergenic
1180032999 21:45224708-45224730 GGTTTCGGGGAGCCCTGGGCGGG + Exonic
1180484246 22:15781599-15781621 GCTGTTGCGGGGCCCGGGGAAGG - Intergenic
1181015640 22:20066894-20066916 GCTGCTGGGGAGCCCTGGGCAGG - Intergenic
1181760341 22:25053940-25053962 GCAGTTGGGGAGGCCTAGGCAGG + Intronic
1182223367 22:28776160-28776182 GCACTTGGGGAGGCCAGGGTGGG + Intronic
1182423595 22:30260376-30260398 GCTGCTGGGAAGCTGTGGGTGGG - Intergenic
1182830207 22:33298960-33298982 GCACTTTGGGAGGCCTGGGTGGG + Intronic
1183076203 22:35428746-35428768 GGTGGTGGTGAGCCCTGAGTAGG - Intergenic
1183345980 22:37308116-37308138 GCTGAGGGAGAGCCCAGGGTGGG - Intronic
1183521724 22:38299500-38299522 GCTGTGGGGCAGCCCAGTGTGGG + Intronic
1183527074 22:38329497-38329519 GCAGTTTGGGAGGCCGGGGTGGG + Intronic
1183848040 22:40559141-40559163 GCAGTTGGGGAGGCCAAGGTGGG + Intronic
1183933480 22:41249042-41249064 GCAGATGAGGAGCACTGGGTTGG - Intronic
1184059004 22:42070709-42070731 GGTTTTGGGGAGCCCAGGGCGGG - Exonic
1184939364 22:47749806-47749828 GCTGCCAGGGAGCCCTGGGTGGG - Intergenic
950202820 3:11056975-11056997 GGTGGTGGGGAGCCATGGGAAGG - Intergenic
950799886 3:15541896-15541918 GCTGTGGGGGATGCATGGGTTGG + Intergenic
950864906 3:16181384-16181406 GCTGGTGGGGAGAGCTGGGAGGG + Intronic
952428743 3:33201699-33201721 GCTGTTGGGTAGGCCTGAGATGG - Intronic
952466843 3:33597997-33598019 GCACTTTGGGAGGCCTGGGTGGG - Intronic
952871444 3:37904557-37904579 GATCTTTGGGAGCCCGGGGTGGG - Intronic
953324245 3:41999386-41999408 GCTGTTTGGGAGGCCAAGGTGGG - Intergenic
953554332 3:43931417-43931439 GCAGGTGGGGAGACCTGGGTTGG - Intergenic
953643384 3:44729861-44729883 GCTGTTCGAGAGCCCTAGGCTGG + Exonic
954078893 3:48201050-48201072 GCGGTTTGGGAGGCCTAGGTGGG + Intergenic
954276024 3:49542213-49542235 GCTCTTGGGGAGCCTGGGGCTGG - Intergenic
954363791 3:50135859-50135881 GCTGGTGGAGAGCCCTGCCTTGG - Intergenic
954445099 3:50542175-50542197 CCTGGTGCTGAGCCCTGGGTGGG + Intergenic
954618986 3:51985151-51985173 GCTGGTGGGAAGCTGTGGGTAGG + Intronic
955034748 3:55256476-55256498 TCAGTTGGGCAGCCCTGAGTAGG - Intergenic
956643998 3:71438880-71438902 GGGGTTGGGGAGGGCTGGGTGGG - Intronic
957095686 3:75775208-75775230 GCTGTTTGGGAGGCCAAGGTAGG - Intronic
957183866 3:76916583-76916605 GCACTTTGGGAGGCCTGGGTGGG - Intronic
958515072 3:95104032-95104054 GCACTTTGGGAGCCCGGGGTGGG + Intergenic
959436119 3:106317198-106317220 GCTGTTGGGGAGAGCACGGTTGG + Intergenic
960604985 3:119496162-119496184 GCAGTTCGTGAGCCATGGGTTGG - Intergenic
961385953 3:126523771-126523793 GCTGCAGGGTAGCCTTGGGTCGG + Intergenic
961795383 3:129405059-129405081 GCAGTTTGGGAGGCCGGGGTAGG - Intronic
962108923 3:132421684-132421706 GCACTTTGGGAGGCCTGGGTGGG - Intronic
962254020 3:133858110-133858132 GCGGGTTGGGATCCCTGGGTAGG - Intronic
962827727 3:139112129-139112151 TGTGTTGGGCAGCCCTGGGGTGG + Intronic
963032884 3:140996337-140996359 GCACTTTGGGAGCCCAGGGTGGG - Intergenic
963154142 3:142077891-142077913 GCTGTTGAAGAGCCCAGGCTTGG - Intronic
963161671 3:142157009-142157031 GCAGTTTGGGAGGCCAGGGTGGG - Intergenic
963835175 3:150050819-150050841 GCTGGCGGGGAGCGCTGGGAAGG + Intergenic
964590090 3:158352021-158352043 GCTCTTTGGGAGGCCTAGGTGGG + Intronic
966185479 3:177223088-177223110 GCAGTTTGGGAGGCCTGGGTGGG - Intergenic
966856093 3:184194727-184194749 GCTGTTGGGGAGGCCAAGGTGGG + Intronic
968431893 4:563929-563951 GTTGGTATGGAGCCCTGGGTTGG + Intergenic
968432028 4:564673-564695 GTTGGTATGGAGCCCTGGGTTGG + Intergenic
968621212 4:1604241-1604263 GCCCTTGGGCAGCCCTGGGTGGG - Intergenic
968748585 4:2374048-2374070 GCTCTTGGAGACCCATGGGTTGG - Intronic
968759798 4:2436837-2436859 GCCGGTGGGGGGCCCTGGCTGGG - Intronic
968842532 4:3018155-3018177 GCAGTTTGGGAGGCCTAGGTAGG - Intronic
969214105 4:5709080-5709102 GCTGTGGGTCAGCCCTGGGCCGG + Intronic
969600302 4:8172107-8172129 GCTGTGAGGGAGCCGTGGGACGG + Intergenic
969877969 4:10149927-10149949 CCTCCTGGGGACCCCTGGGTAGG + Intergenic
970139630 4:12967768-12967790 GCAGTTCGGGAGGCCAGGGTGGG - Intergenic
971874606 4:32290698-32290720 GCTATTGGGGAGGCCCAGGTGGG - Intergenic
972390361 4:38607622-38607644 GCTGCAGAGGAGCCCTGGTTGGG - Intergenic
973633107 4:52838056-52838078 GCTGCTGGGGAGCAATGGGGAGG - Intergenic
974045499 4:56895086-56895108 GCACTTTGGGAGGCCTGGGTGGG - Intergenic
975170295 4:71225103-71225125 GCACTTTGGGAGGCCTGGGTGGG + Intronic
975308598 4:72877406-72877428 GGTGTTGTGGAGCCCTTGGGTGG - Intergenic
975462303 4:74668511-74668533 GTTATTGGGGAGGACTGGGTGGG + Intergenic
975573900 4:75844174-75844196 GCTGCTGGGGAGTTCTGTGTTGG + Intergenic
975868031 4:78745851-78745873 GCTCTTTGGGAGACCGGGGTAGG + Intergenic
976185768 4:82441374-82441396 GCTGTTTGGGAGGCCAAGGTGGG + Intronic
978387284 4:108188764-108188786 GGGGTTGGGGAGCCTTGGCTTGG + Intergenic
978578158 4:110206579-110206601 GCTGCTGGGGAGCCATGGTCAGG - Intergenic
979027004 4:115589819-115589841 GCAGTTTGGGAGGCCTAGGTGGG - Intergenic
979145367 4:117239990-117240012 GCTCATGGGTGGCCCTGGGTGGG - Intergenic
979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG + Intergenic
979732939 4:124046208-124046230 TCTGTTGCACAGCCCTGGGTAGG - Intergenic
980042174 4:127952157-127952179 GCACTTTGGGAGGCCTGGGTGGG + Intronic
980435352 4:132764757-132764779 GCACTTTGGGAGGCCTGGGTGGG + Intergenic
980461828 4:133125252-133125274 GCTGTTGCTGAGGCATGGGTGGG - Intergenic
983959205 4:173732071-173732093 GCAGTTTGGGAGGCCTAGGTGGG + Intergenic
984089625 4:175356099-175356121 GCACTTGGGGAGGCCTAGGTGGG + Intergenic
984885900 4:184449150-184449172 GCTGTAGGGCAGAGCTGGGTTGG - Intronic
985604478 5:850998-851020 GCACCTGGGGAGTCCTGGGTGGG - Intronic
985607859 5:868220-868242 GCTGTTTGGGAGGCATGGCTGGG - Intronic
985754203 5:1703539-1703561 GATGTTGGGAAGACCTGGGAGGG - Intergenic
986383505 5:7208792-7208814 GCTGCTCAGGAGCCCTGGATTGG - Intergenic
986665483 5:10100197-10100219 GCTGTTTGGGAGGCCGAGGTGGG - Intergenic
987262150 5:16214594-16214616 GCATTTTGGGAGGCCTGGGTGGG - Intergenic
988495444 5:31741741-31741763 GGGGTTGGGGAGCCCTGTGCAGG - Intronic
989387315 5:40866567-40866589 GGTGCTGGGAAGCCCTGGATGGG + Intergenic
992895220 5:81239711-81239733 CCTGTTGGGGGGTCCTGGGAGGG - Intronic
994076108 5:95651641-95651663 GCACTTTGGGAGGCCTGGGTGGG - Intronic
995804905 5:116040725-116040747 GCTGTTTGGGAGGCCAAGGTGGG + Intronic
996015942 5:118534217-118534239 GCTCTTGGAGACCCCTAGGTAGG - Intergenic
996082061 5:119267989-119268011 TCTGTTGAGGAGCCCTGGCCCGG - Intergenic
997452209 5:133992853-133992875 ACTGTTTAGGAGACCTGGGTAGG - Intronic
997482240 5:134194852-134194874 GCACTTGGGGAGGCCGGGGTGGG - Exonic
998305752 5:141075103-141075125 GCAGTTTGGGAGGCCTAGGTGGG + Intergenic
998839510 5:146238260-146238282 GCACTTTGGGAGGCCTGGGTGGG + Intronic
999772584 5:154786724-154786746 GCTGTTGAGGAGCTCTGGCAAGG + Intronic
1000083960 5:157872873-157872895 GCACTTGGGGAGGCCTAGGTGGG + Intergenic
1001447991 5:171801392-171801414 GCTATTGGGGAGGCCTAGGCAGG + Intergenic
1001669102 5:173459264-173459286 TCTCTGAGGGAGCCCTGGGTTGG + Intergenic
1002119755 5:176993433-176993455 GCACTTTGGGAGACCTGGGTGGG - Intronic
1002338854 5:178501334-178501356 GCACTTTGGGAGGCCTGGGTGGG + Intronic
1002471218 5:179437399-179437421 GCTGGTGGGGAGGCCTTGGGAGG - Intergenic
1002599749 5:180347393-180347415 GCTGTCTGGAAGCTCTGGGTGGG - Intronic
1002624538 5:180516145-180516167 GCTCTTTGGGAGGCCTGGGCAGG - Intronic
1002862572 6:1093398-1093420 GGTGTTGGGGAGAGTTGGGTGGG - Intergenic
1003088033 6:3077060-3077082 GCTGCTGCGGAGCCGTTGGTGGG + Intronic
1003386559 6:5673061-5673083 GGTGTTGGGGGGCTCTTGGTTGG - Intronic
1004587408 6:17015908-17015930 TCTGTCGGGGAGCCCAAGGTGGG + Intergenic
1005377961 6:25203386-25203408 GCTGCTGGGGAGCCTAAGGTGGG + Intergenic
1005595499 6:27375029-27375051 GCGGGTGGGGAGCCCTGGAGAGG - Intronic
1006109567 6:31736451-31736473 GCTGGTGGGGAGGCCTAGTTTGG - Intronic
1006298270 6:33179626-33179648 GCGGCAGGGGAGGCCTGGGTTGG - Intronic
1007008108 6:38386887-38386909 GCACTTTGGGAGCCCAGGGTGGG - Intronic
1007468242 6:42070378-42070400 GCTATTTGGGAGCCCGGGGCAGG + Intronic
1007887775 6:45251103-45251125 GCTGTTGAGAAGTCCTGGCTGGG - Intronic
1009415935 6:63416677-63416699 GCTGTTTGGGAGGCTGGGGTAGG - Intergenic
1009671218 6:66753523-66753545 GCACTTTGGGAGGCCTGGGTGGG + Intergenic
1010089261 6:71960834-71960856 GCTCTTGGGTAGGCCTGGGTAGG - Intronic
1010191058 6:73197123-73197145 CCTGTTGGGGAGGGCTGGGGAGG - Exonic
1010679298 6:78781109-78781131 GCTGTTGGGGAGAGCATGGTGGG + Intergenic
1011083724 6:83516059-83516081 GCAGTTTGGGAGGCCTAGGTGGG - Intronic
1011618807 6:89222867-89222889 GCTGTTGTGGAACGCTGGGCTGG - Intronic
1011633065 6:89346000-89346022 GCTATTGGGGAGGCCAAGGTGGG - Intronic
1012815718 6:104019281-104019303 GCTGTTGCTGAGGCGTGGGTGGG + Intergenic
1013021452 6:106224627-106224649 GCACTTTGGGAGGCCTGGGTGGG + Intronic
1014490802 6:122059190-122059212 GCACTTGGGGAGGCCTAGGTGGG - Intergenic
1015975545 6:138786860-138786882 GCACTTGGGGAGGCCAGGGTGGG - Intronic
1016401822 6:143689192-143689214 GCTGTGGGTGGGACCTGGGTGGG - Intronic
1016441611 6:144089871-144089893 GCTCTTGGGGAGGCCGAGGTAGG + Intergenic
1016511118 6:144844513-144844535 GCGGTTTGGGAGGCCAGGGTGGG - Intronic
1017672261 6:156778786-156778808 GCTGTTGGGGTACCCTTCGTGGG - Exonic
1017720783 6:157241697-157241719 ACTGTAGGGGAGCCCAGGTTTGG - Intergenic
1019050439 6:169179050-169179072 TCGGTGGGGGAGCCCTGGGAAGG + Intergenic
1019204224 6:170345355-170345377 GCTCTTTGGGAGGCCTAGGTGGG + Intronic
1019309529 7:353370-353392 GCCCTTGGGAAGCCCTGAGTGGG + Intergenic
1019626128 7:2016524-2016546 AGTGCTGGGGAGCACTGGGTCGG - Intronic
1020096564 7:5372774-5372796 GCAGTTCGGGAGGCCAGGGTGGG + Intronic
1021621790 7:22556199-22556221 GCTGTTGGGGAGGCTGAGGTAGG + Intronic
1022203165 7:28137512-28137534 GCTGTTAAGGAGACCTGGGTGGG - Intronic
1023048906 7:36234894-36234916 GCTGTGGGGGAGGCCTGGGCTGG - Intronic
1023048927 7:36234944-36234966 GCTATGGGGGAGGCCTGGGCTGG - Intronic
1023048937 7:36234969-36234991 GCTGTGGGGGAGGCCTGGGCTGG - Intronic
1023048954 7:36235019-36235041 GCTGTAGGGGAGGCCTGGGCTGG - Intronic
1023048978 7:36235094-36235116 GCTGTGGGGAAGGCCTGGGCTGG - Intronic
1023048987 7:36235119-36235141 GCTGTAGGGGAGGCCTGGGCTGG - Intronic
1023048996 7:36235144-36235166 GCTGTAGGGGAGGCCTGGGCTGG - Intronic
1023049012 7:36235194-36235216 GCTGTGGGGAAGGCCTGGGCTGG - Intronic
1023049021 7:36235219-36235241 GCTGTGGGGGAGGCCTGGGCTGG - Intronic
1023918363 7:44607165-44607187 GCTTTGGGGTGGCCCTGGGTGGG + Intronic
1024689462 7:51783310-51783332 ACTGTTGGGGAGGCAGGGGTGGG - Intergenic
1024940468 7:54758803-54758825 GCTGTTGTGGAGTCCTGTCTGGG - Intronic
1025058964 7:55787935-55787957 TCTGTTTGGGAGGCCAGGGTGGG - Intergenic
1025939143 7:66061321-66061343 GCACTTTGGGAGCCCGGGGTGGG + Intergenic
1026972785 7:74478175-74478197 GCGGTTGGGGAGTGCTGGGTGGG - Intronic
1029034381 7:97503548-97503570 GGGGTTGGGGACCCCTGGTTTGG - Intergenic
1029248373 7:99218796-99218818 GCTGTTTGGGGGCCCTGAGGAGG - Intergenic
1029892775 7:103948765-103948787 GCATTTTGGGAGGCCTGGGTGGG + Intronic
1030191636 7:106816364-106816386 GCTTGTGGGTAGCCCTTGGTAGG + Intergenic
1031571636 7:123366576-123366598 GCACTTTGGGAGGCCTGGGTGGG - Intergenic
1032098245 7:128950819-128950841 GCTGTTTGGGAGGCCACGGTGGG - Intergenic
1032382942 7:131503239-131503261 GCTGATGGGGGGCCCCGGGAAGG + Intronic
1032940815 7:136788547-136788569 GCAGTTTGGGAGACCTAGGTGGG + Intergenic
1033242129 7:139689162-139689184 GCTCTTGGGGAGCACTCTGTGGG - Intronic
1033409671 7:141105846-141105868 GCTGTTTGGGAGGCCAAGGTGGG + Intronic
1034317681 7:150148537-150148559 GCTGGTGGTGAGCTCTGGGCAGG - Intergenic
1034436947 7:151066963-151066985 GCTTGTGGGGGGCCCGGGGTCGG - Exonic
1034775077 7:153818688-153818710 GCTGGTGGTGAGCTCTGGGCAGG + Intergenic
1035383792 7:158457319-158457341 GATGCTGAGGAGCCCTGGGAGGG - Intronic
1036126450 8:6067378-6067400 GCTCTTGTGTAGCACTGGGTGGG - Intergenic
1036420027 8:8586786-8586808 GCTCTTTGGGAGGCCAGGGTGGG - Intergenic
1036511482 8:9404303-9404325 GCTGTTGGGGTGCCTGGTGTGGG - Intergenic
1036772528 8:11588890-11588912 GCTGTTTGGGAGGCCAAGGTGGG + Intergenic
1036925387 8:12899998-12900020 GCGCTTGGGGAGGCCTAGGTGGG - Intergenic
1037090403 8:14908503-14908525 GCAGTTTGGGAGCCCCAGGTGGG + Intronic
1037115278 8:15217972-15217994 GCTGCTGGGGAGGCCGAGGTAGG + Intronic
1038271370 8:26078622-26078644 GCACTTTGGGAGGCCTGGGTAGG + Intergenic
1038335212 8:26640548-26640570 CCAGGAGGGGAGCCCTGGGTTGG + Intronic
1038395450 8:27242655-27242677 GCTGTTCAGGATCCCTGTGTGGG + Intronic
1038452623 8:27649647-27649669 GCTGCTGGAGAGGCCTGGGATGG + Intronic
1038663840 8:29520386-29520408 GCACTTTGGGAGACCTGGGTGGG + Intergenic
1039246382 8:35613319-35613341 GCACTTGGGGAGGCCAGGGTGGG - Intronic
1039519739 8:38160196-38160218 GCAGTTGGGGAGGCCGAGGTGGG - Intergenic
1039884902 8:41649250-41649272 GCTTTTGGGGTTCCCTAGGTTGG + Intronic
1040469032 8:47721002-47721024 GCAGTTTGGGAGGCCTAGGTGGG - Intronic
1041517496 8:58716428-58716450 GCAGTTTGGGAGGCCGGGGTGGG + Intergenic
1042560500 8:70069936-70069958 GCTGGTGGGGAGGCGCGGGTCGG - Intronic
1043379419 8:79686652-79686674 GCAGTTTGGGAGGCCAGGGTGGG - Intergenic
1044694470 8:94909097-94909119 GCAGTTTGGGAGCCCGAGGTGGG + Intronic
1047204353 8:122791388-122791410 GCTGATTGGGAGCCCTGCCTGGG + Intronic
1047730147 8:127721085-127721107 GCAGTTTGGGAGGCCTAGGTGGG + Intergenic
1048926611 8:139277628-139277650 GGTGCTGGGGTGCCCTGGGCAGG + Intergenic
1049167145 8:141133497-141133519 GCTAGTGGGGAGCCCTGGGCTGG + Intronic
1049625374 8:143617485-143617507 GCTGTCGGGGAGCCGGCGGTGGG - Exonic
1049824003 8:144655250-144655272 GCTGATGGGTGGCCATGGGTGGG - Intergenic
1051077712 9:13260086-13260108 GCTCTTTGGGAGGCCTAGGTGGG - Intronic
1053097979 9:35345741-35345763 GCTGAAAGGGAGCCCTGGGCAGG + Intronic
1055084148 9:72296984-72297006 GCAGCTGGTGAGGCCTGGGTTGG + Intergenic
1055770196 9:79708698-79708720 GATGTTGTGGAGCCCAGCGTAGG - Exonic
1056591238 9:87967543-87967565 GATGTGGGGGGGCCCTGGATGGG + Exonic
1056950500 9:91037254-91037276 GCGGGAGGGGAGCCCTGGGGCGG - Intergenic
1057594232 9:96401279-96401301 GCTGATTGGGAGGCCAGGGTGGG + Intronic
1057620555 9:96630838-96630860 GCACTTTGGGAGGCCTGGGTGGG - Intergenic
1058676514 9:107404843-107404865 CCTGATGAGGAGTCCTGGGTTGG + Intergenic
1058756815 9:108090227-108090249 GATTTTGGGGAGCCTTGGGGAGG + Intergenic
1059869963 9:118561898-118561920 GCAGTTTGGGAGGCCTAGGTGGG + Intergenic
1060590654 9:124814297-124814319 GGAGTTAGGGAGCCCTGGGTTGG + Exonic
1060863741 9:126978231-126978253 GCACTTTGGGAGCCCTAGGTGGG + Intronic
1061035879 9:128114159-128114181 GCTCCAGGGGAGCCCTGGGGCGG + Intergenic
1061164703 9:128915699-128915721 GCTCCTGGTGAGCCCTGGGATGG + Intronic
1061191563 9:129085456-129085478 ACTGTTTGGGAGGCCTGGGCTGG + Intronic
1061225901 9:129280880-129280902 GCTTGTGATGAGCCCTGGGTAGG - Intergenic
1061993811 9:134174001-134174023 GGGGCTGGGGAGCCCTGGGGAGG + Intergenic
1062024611 9:134334600-134334622 GCTGCTGTGTAGCCCTGGGCAGG + Intronic
1062170401 9:135131832-135131854 GGTGGTGGAGAGCCCTGGCTTGG - Intergenic
1185726951 X:2429700-2429722 GCTCTTTGGGAGGCCGGGGTGGG - Intronic
1185880455 X:3735447-3735469 GCTCTTTGGGAGGCCGGGGTGGG + Intergenic
1186515824 X:10165463-10165485 GCAGTTGGGGCGCCCAGGATGGG + Intronic
1186996461 X:15128701-15128723 GGTGTTGGGAAACCCTGGATCGG + Intergenic
1187588814 X:20693320-20693342 GCTGTTGGGGAGGGCATGGTGGG + Intergenic
1187860804 X:23680642-23680664 GCTCTTTGGGAGACCTAGGTGGG + Intronic
1189830133 X:44964201-44964223 GCTCTTTGGGAGGCCTCGGTAGG + Intronic
1190127848 X:47722208-47722230 GCTGTTGGTCAGCCCTAAGTGGG - Intergenic
1190679242 X:52810994-52811016 GCTGTTGTGGGGTCCTGGGCAGG + Intergenic
1195304037 X:103561623-103561645 GCACTTGGGGAGGCCAGGGTGGG + Intergenic
1196904160 X:120415819-120415841 GCTGCTTGGGAGCCTGGGGTGGG - Intergenic
1198533903 X:137568567-137568589 GCGCATTGGGAGCCCTGGGTCGG + Intronic
1199037118 X:143064293-143064315 GCTCTTTGGGAGCCATGGATTGG - Intergenic
1199760186 X:150898885-150898907 GTGGGTGGGGAGGCCTGGGTTGG + Intergenic
1199760791 X:150902551-150902573 CCTGTTGGAGGGCCCTGGCTGGG + Intergenic
1200053899 X:153448771-153448793 GCAGCTTGGGAGCCCTGGGCTGG + Intronic
1200073496 X:153540236-153540258 GCTGATGAGCAGCCCAGGGTGGG + Intronic
1200774937 Y:7161788-7161810 GCTGTACAGGAGGCCTGGGTAGG + Intergenic
1200785331 Y:7255865-7255887 GCTCTTTGGGAGGCCGGGGTGGG - Intergenic