ID: 902925854

View in Genome Browser
Species Human (GRCh38)
Location 1:19695258-19695280
Sequence CTGAAGCAATGGGCAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 267}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902925854_902925862 16 Left 902925854 1:19695258-19695280 CCCTCTGCTGCCCATTGCTTCAG 0: 1
1: 0
2: 1
3: 33
4: 267
Right 902925862 1:19695297-19695319 CTACAGAGGACATGGTCTGAGGG 0: 1
1: 0
2: 1
3: 10
4: 178
902925854_902925861 15 Left 902925854 1:19695258-19695280 CCCTCTGCTGCCCATTGCTTCAG 0: 1
1: 0
2: 1
3: 33
4: 267
Right 902925861 1:19695296-19695318 TCTACAGAGGACATGGTCTGAGG 0: 1
1: 0
2: 1
3: 17
4: 139
902925854_902925859 2 Left 902925854 1:19695258-19695280 CCCTCTGCTGCCCATTGCTTCAG 0: 1
1: 0
2: 1
3: 33
4: 267
Right 902925859 1:19695283-19695305 GCAATGAGCACTGTCTACAGAGG 0: 1
1: 0
2: 0
3: 7
4: 126
902925854_902925860 8 Left 902925854 1:19695258-19695280 CCCTCTGCTGCCCATTGCTTCAG 0: 1
1: 0
2: 1
3: 33
4: 267
Right 902925860 1:19695289-19695311 AGCACTGTCTACAGAGGACATGG 0: 1
1: 0
2: 1
3: 40
4: 220
902925854_902925863 17 Left 902925854 1:19695258-19695280 CCCTCTGCTGCCCATTGCTTCAG 0: 1
1: 0
2: 1
3: 33
4: 267
Right 902925863 1:19695298-19695320 TACAGAGGACATGGTCTGAGGGG 0: 1
1: 0
2: 0
3: 18
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902925854 Original CRISPR CTGAAGCAATGGGCAGCAGA GGG (reversed) Intronic
900302798 1:1986396-1986418 GTGCAGCCATGGGGAGCAGAGGG - Intronic
900358191 1:2274809-2274831 CTGCAGCAAGGGGCAGCAGCCGG - Intronic
902186834 1:14731745-14731767 CTCAGGCACTGTGCAGCAGAGGG - Intronic
902666423 1:17942361-17942383 GATAAGAAATGGGCAGCAGAAGG - Intergenic
902667792 1:17951796-17951818 CTGAAGGTAGGGGCTGCAGAGGG + Intergenic
902925854 1:19695258-19695280 CTGAAGCAATGGGCAGCAGAGGG - Intronic
905791830 1:40793761-40793783 ATGATGCAGTGGGCAGAAGAGGG - Intronic
910473922 1:87586159-87586181 CTCAAGCAATTTGTAGCAGAGGG - Intergenic
910722880 1:90306755-90306777 CTGAAGCAAAGGGGGTCAGAAGG + Intergenic
910773925 1:90856121-90856143 CTGATGCAGTGGGCAGCAAGGGG - Intergenic
913251457 1:116915149-116915171 CTCAAGCAATACGCAGCATAAGG - Intronic
915633652 1:157171648-157171670 CTGAAGCAATGAGGATAAGACGG + Intergenic
915649130 1:157294771-157294793 CTGAAGGAAGGGGCAGCTGTGGG + Intergenic
919964966 1:202513728-202513750 CTGAAGCAAAGGCAAGCAAAAGG + Intronic
920499542 1:206477548-206477570 CTGAAGCAAAGGGCTCCAGGAGG + Intronic
920600446 1:207319716-207319738 CTCCAGCAATGGGCAACACAAGG + Intergenic
921898244 1:220423460-220423482 CTGAAGCTATGGACACCTGAGGG + Intergenic
922532893 1:226357849-226357871 CTGCAGCAATGTGCAGAGGAGGG - Intergenic
922602210 1:226865004-226865026 CTGGAGCAAGGGACAGCAGATGG + Intergenic
923399588 1:233603381-233603403 CTAAAGCAAATGGCAGAAGAAGG - Intergenic
923521633 1:234739435-234739457 AAGCAGCAAGGGGCAGCAGAAGG - Intergenic
924603511 1:245512554-245512576 CTGTAGCACTGGGCACCCGAGGG + Intronic
1063523347 10:6760811-6760833 GGGAAGCAATGGGTAGAAGAGGG + Intergenic
1064033349 10:11896942-11896964 CTCAAGCAAGGGTCAGCACAGGG + Intergenic
1064198309 10:13263499-13263521 CTGGAGAAGCGGGCAGCAGAGGG - Intergenic
1065377910 10:25061438-25061460 CTCAGGCAATGAGGAGCAGAAGG - Intronic
1066311877 10:34205549-34205571 CAGATGCAATGGCAAGCAGAGGG + Intronic
1067082155 10:43217933-43217955 CTGAGGCCATGCACAGCAGATGG + Intronic
1067445923 10:46345708-46345730 GTGAAGTAATGGGAAGCATATGG - Intergenic
1067591458 10:47515036-47515058 GTGAAGTAATGGGAAGCATATGG + Intronic
1067638576 10:48023131-48023153 GTGAAGTAATGGGAAGCATATGG + Intergenic
1067860212 10:49838857-49838879 ATGAAGCCATGTGAAGCAGATGG - Intronic
1068884010 10:62079817-62079839 CCTACTCAATGGGCAGCAGATGG - Intronic
1069347466 10:67487071-67487093 CTGAAGCATTGGGCAGAATGGGG - Intronic
1069373466 10:67770514-67770536 CTGAAGGGGTGGGAAGCAGAGGG + Intergenic
1069591130 10:69642650-69642672 CCCAAGAAATGGGGAGCAGAGGG - Intergenic
1069744788 10:70708365-70708387 TTGAAGCAATGAGTAGCAAAGGG - Intronic
1070089348 10:73269535-73269557 AGTAAGCAAGGGGCAGCAGATGG - Intronic
1070925327 10:80217095-80217117 CTGAAACAATGGAAAGCACATGG - Intergenic
1073736596 10:106354796-106354818 CAGAAGCAAGGGGCTGAAGAGGG - Intergenic
1075508981 10:123053672-123053694 CTTAAGCAAAAGGAAGCAGAAGG - Intronic
1075584865 10:123650363-123650385 GTGAAGGAATGGGCAGCACATGG + Intergenic
1075811986 10:125231084-125231106 ATGAAGCAAAGGGAGGCAGAGGG + Intergenic
1078966644 11:16352233-16352255 ATGAACCAATGGGCAGATGATGG + Intronic
1079154338 11:17930504-17930526 CTGCAGCCATGGGGAGAAGATGG + Intronic
1079518588 11:21297965-21297987 GTCAAGCAATGGGCAGGTGATGG - Intronic
1081967153 11:47176988-47177010 CTGGACCAATGGGCAGCCGGCGG + Exonic
1083163698 11:60870953-60870975 CTGAAGCACTGGACAGTAGCTGG - Exonic
1083193902 11:61071658-61071680 CTGAAGCAAGAGCCAGCAGGTGG + Intergenic
1083423670 11:62571376-62571398 TTGAAGCAGTGGGCAGTTGATGG - Intronic
1083739178 11:64698897-64698919 ATGAAGCAATAGGCAGGAGGGGG + Intronic
1084034419 11:66499952-66499974 CTGAAGCCATGGACAGTACAGGG - Intronic
1085325156 11:75601031-75601053 CTGGGGCTCTGGGCAGCAGAGGG + Intronic
1087773814 11:102239629-102239651 TTCAAGCAATAGGCAGCACATGG - Intergenic
1087929934 11:103965622-103965644 CTCAAGGCAAGGGCAGCAGAGGG + Intronic
1089854096 11:121525830-121525852 CTGGAGCCATGGGCAACATAGGG + Intronic
1090027102 11:123177297-123177319 ATGAGGCAATAGGAAGCAGATGG + Intronic
1090157915 11:124460937-124460959 GCAAAGCAAAGGGCAGCAGATGG - Intergenic
1091797867 12:3307573-3307595 CTGAAGCCAGGGCCAGCAGCTGG + Intergenic
1092132989 12:6125422-6125444 CTGATGCAATGGGCAGCGGTGGG + Intergenic
1095700752 12:45188614-45188636 TTGAAGCAATGGGCAGGAATGGG + Intergenic
1096100277 12:48966577-48966599 GTGAAGCAGAGGGCAGCAAATGG + Intronic
1097647436 12:62253153-62253175 CTGGAACAATGGGCACAAGAAGG - Intronic
1100826172 12:98476654-98476676 CAGAATGAATGGGCAGGAGATGG + Intergenic
1100838767 12:98591539-98591561 CTGAAAAAATGTGCAGCAAAGGG + Intergenic
1101314209 12:103614535-103614557 CTGTAGCACTGGGCAGCTGGTGG - Intronic
1102549076 12:113677951-113677973 CAGAAGCTATGGGCAGGAGTAGG - Intergenic
1103408696 12:120695008-120695030 CTTCAGCAATGGGCAGAATAGGG - Intronic
1103483811 12:121268999-121269021 CTGGAGCAATGGGCAAAGGAGGG + Intronic
1104274554 12:127313282-127313304 CTGAAGTAATGTTCAGCAAAAGG + Intergenic
1104755120 12:131264477-131264499 CTAAAGCACTGGGGGGCAGAGGG - Intergenic
1105309454 13:19193259-19193281 CTGAAGCAAAGGGCTGAAAAAGG + Intergenic
1105528144 13:21194847-21194869 CTGAAGCAAAGGGCTGAAAAAGG - Intergenic
1107540442 13:41384444-41384466 TGGAAGGAATGGGCACCAGAAGG + Intergenic
1109072568 13:57787616-57787638 CTTAAGCAGCGGGCAGCTGAAGG + Intergenic
1109150045 13:58835742-58835764 CTGGAGGAGTGGGGAGCAGAGGG - Intergenic
1109529801 13:63627106-63627128 CTCTAGCTATAGGCAGCAGATGG + Intergenic
1110004440 13:70248702-70248724 GTGAAGAAATGGGCACCACATGG + Intergenic
1110331337 13:74276941-74276963 CTAAATCAATGGGCAGAAGTGGG - Intergenic
1110884831 13:80619624-80619646 CTGAGGCAATGGCAAGAAGAGGG - Intergenic
1111262792 13:85764066-85764088 CTAAATCAATGGGAAACAGAGGG - Intergenic
1111706448 13:91755372-91755394 CAGAAGGAAGGGGCAGAAGAAGG - Intronic
1112542788 13:100333348-100333370 CTGAACAGATGGGAAGCAGATGG - Intronic
1113145559 13:107203820-107203842 GTGTAGCAATGAGAAGCAGAAGG + Intronic
1114675384 14:24436772-24436794 CTTATGTAATGGTCAGCAGAAGG - Intronic
1117946177 14:61024398-61024420 CTGAGGAAATGGGCTGCAGAGGG - Intronic
1119428644 14:74551695-74551717 CTGAAACAATGGGTAGCATCTGG - Intronic
1119757876 14:77131557-77131579 CTTAAGCAATGGGAGGGAGAGGG - Exonic
1120222254 14:81747500-81747522 CTGGTGCAATGGGCATCATAGGG - Intergenic
1121024178 14:90602290-90602312 ATGAAGCACTAGGCAGGAGATGG + Intronic
1121745090 14:96282479-96282501 CTGAAGCAAAGCAAAGCAGAGGG + Exonic
1122258597 14:100499014-100499036 CTGAAGTCATGGGCAGCACTTGG - Intronic
1122864104 14:104595772-104595794 TGGAAGCAGTGGGCATCAGAGGG + Intronic
1123430947 15:20215940-20215962 GGGAAGGAATGGGCAGGAGAGGG + Intergenic
1123430953 15:20215960-20215982 GGGAAGGAATGGGCAGGAGAGGG + Intergenic
1124217215 15:27817333-27817355 CTGGGGCAACAGGCAGCAGATGG - Intronic
1125236510 15:37520306-37520328 CTGGAGCAGTGGGCAGGAAAGGG + Intergenic
1128374149 15:67064020-67064042 CTGAATCAAAGGGCAGCAGGCGG + Intronic
1128691909 15:69731038-69731060 CTGGAGCAAAGGCCAGCAGAAGG - Intergenic
1129659634 15:77545844-77545866 CTGAAGAAATGGGGAGCAGGGGG + Intergenic
1130179086 15:81607033-81607055 GGGAATCAATGGGCAACAGAAGG + Intergenic
1130881420 15:88059131-88059153 CAGCAGCAATGGCAAGCAGAGGG + Intronic
1132663420 16:1071399-1071421 CTGAGGGGAGGGGCAGCAGATGG + Intergenic
1134586363 16:15414804-15414826 ATGAAGCAATGTGCCGCAGCAGG + Intronic
1135336854 16:21608992-21609014 CTGAATAAATGGGAAGCATAGGG - Intronic
1137477360 16:48820923-48820945 CTGAAGCAATGGGAGTCAGATGG + Intergenic
1138450552 16:57091669-57091691 CTCAAGGACTGGGCAGCTGAGGG - Intergenic
1139363724 16:66419745-66419767 GTGAAGCATTGGCCAGCAGGGGG - Intergenic
1139970230 16:70769780-70769802 CTTAAGCCATGGGCTGCAGAGGG - Intronic
1140633038 16:76877515-76877537 CTGATGCAATGTGTAGCACATGG - Intergenic
1140985950 16:80158099-80158121 CTGGAGCACAGGGAAGCAGAGGG - Intergenic
1141316892 16:82970883-82970905 CTGAAGCACTGGGCATTGGAAGG - Intronic
1141866077 16:86750903-86750925 CTGAAGCAACTGGCACCAAAAGG - Intergenic
1141979901 16:87543597-87543619 GTGTAGCACTGGGCAGGAGAGGG + Intergenic
1203115292 16_KI270728v1_random:1483732-1483754 GGGAAGGAATGGGCAGGAGAGGG - Intergenic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142761300 17:2043273-2043295 CTGAAGAAAAGGGGAGCACAAGG + Exonic
1143727708 17:8860771-8860793 CTGAAGCCCTGGGGAGCACATGG - Intronic
1144483460 17:15646068-15646090 TTGAAGCAGTCGGCAGCAGCGGG + Intronic
1144648381 17:16990746-16990768 CTGAAGCAGTGGGGGGCAGGGGG - Intergenic
1144915226 17:18718959-18718981 TTGAAGCAGTCGGCAGCAGCAGG - Intronic
1145035245 17:19536132-19536154 TTCAAGCAATGGGCAACACAGGG - Intronic
1145266218 17:21380777-21380799 CTGTAGCAGTGGGCCCCAGATGG + Intronic
1145787201 17:27601895-27601917 TTCCAGCAATGGCCAGCAGATGG - Exonic
1145902801 17:28499047-28499069 CAGAAGGAAGTGGCAGCAGAGGG - Intronic
1146544303 17:33725104-33725126 CTGAAGCAGAGGGCACCACAGGG - Intronic
1147754330 17:42758424-42758446 CTGTAGCAATGGGTAGAGGAAGG - Intergenic
1149308906 17:55375174-55375196 CAGAGGCAAAGGGAAGCAGATGG + Intergenic
1149549231 17:57527633-57527655 CTTCAGAAATGGGGAGCAGAAGG + Intronic
1150551398 17:66213977-66213999 ATGAAGCAGTGAGCTGCAGATGG - Intronic
1150608730 17:66716014-66716036 AAGAAGCAATGGGGAGCACAAGG - Intronic
1151481206 17:74370959-74370981 CTGAAGGCATGGGCAGCACGGGG - Intronic
1152223871 17:79083738-79083760 CTGAAGAAAAGGGCAGAACAGGG - Intronic
1152896009 17:82911812-82911834 CTGCGGCAAAGGGCTGCAGAGGG - Intronic
1152934001 17:83125397-83125419 CTGAAGCACTGGGAACAAGAAGG - Intergenic
1155371103 18:25101723-25101745 CAGAAGCAAAGGGAAGCAGCAGG + Intronic
1156451220 18:37267420-37267442 CTGAAGCATGGGCCAGCAGTAGG + Intronic
1157537199 18:48468555-48468577 CAGGAGCACTGAGCAGCAGATGG - Intergenic
1157974571 18:52312447-52312469 TTGTAGCAAAGGGCTGCAGAAGG + Intergenic
1158521295 18:58173512-58173534 CTCAATCACTAGGCAGCAGAAGG - Intronic
1160026687 18:75223791-75223813 GAGAAGCAATGGGCATTAGAAGG + Intronic
1160078565 18:75702342-75702364 ATGAAGAACTGGGCAGCGGAGGG + Intergenic
1160177480 18:76607693-76607715 CTGATGAAATTGGCAGCCGATGG - Intergenic
1161663534 19:5561338-5561360 CTGAAGCAGTGTGCATCAGCTGG + Intergenic
1162861320 19:13507416-13507438 CTGAACCACTGGCCAGCAAACGG + Intronic
1167880932 19:52456699-52456721 CTGGTGCTGTGGGCAGCAGAGGG + Intronic
1167902866 19:52635257-52635279 CTGGTGCAGTGGGCAGCAGAGGG - Exonic
1167932074 19:52874173-52874195 CTGGTGTAGTGGGCAGCAGAGGG - Intronic
1167933812 19:52890431-52890453 CTGGGGCAGTGGGCAGCAGAGGG - Intronic
1167988907 19:53341110-53341132 CTGGTACAGTGGGCAGCAGAGGG + Intronic
1168001163 19:53447071-53447093 CTGGTGCAGTGGGCAGCAGACGG + Intronic
925981023 2:9177553-9177575 CTGAAGCAATGGGAAATGGATGG + Intergenic
926241728 2:11093934-11093956 CTGCAGCACTGGGGAACAGAAGG + Intergenic
926925389 2:17982076-17982098 CACAAGCATGGGGCAGCAGATGG - Intronic
929538402 2:42800126-42800148 CTAATGCTATGGGTAGCAGATGG - Intergenic
931462148 2:62458356-62458378 CTGGAGCCAAGGGGAGCAGAAGG - Intergenic
931758178 2:65392890-65392912 CGGAAGCAGAGGGCAGCACATGG + Intronic
932285179 2:70525605-70525627 CAGAAGCAAGGGGCAGGAGGAGG + Intronic
932480698 2:72037340-72037362 TTTAAGCAGTGGGCTGCAGAAGG + Intergenic
933595420 2:84278373-84278395 TTGAGGCAATGATCAGCAGAAGG - Intergenic
934574719 2:95392632-95392654 ATGAAGCAATGGGCAGACGGGGG - Intergenic
936099083 2:109559529-109559551 CTGAAGAAATGCTCAGCAAATGG + Intronic
939530355 2:143352139-143352161 CAAAAGCAATGGGGGGCAGAGGG - Intronic
941004806 2:160237132-160237154 CTGCAACAGTGCGCAGCAGAGGG - Intronic
942354422 2:175093930-175093952 CTGATTCATTGGGGAGCAGAGGG - Intronic
942768408 2:179485279-179485301 CTTAAGCAAAGGGCAGAAGGAGG - Intronic
943436150 2:187867844-187867866 CTGAAGCCCTAGGCAGGAGAGGG - Intergenic
944568339 2:201015191-201015213 CTGAAGACTTGGGCAGCACAAGG - Intronic
946531246 2:220572626-220572648 TTGTAGGAATGAGCAGCAGAGGG - Intergenic
947684993 2:232075751-232075773 CTGAAGCAAGGGGAAGGGGAAGG - Intronic
947739824 2:232479998-232480020 CTGAAGTGAGGGGCAGCAGGGGG + Exonic
947802436 2:232938577-232938599 CTGAAGCAAGGGGCACCTAAGGG + Intronic
1169356361 20:4909956-4909978 TTGAAACAACGGGCAGCAAAAGG + Intronic
1171354634 20:24534456-24534478 CTGAGGCAAAGGCCAGCAGAGGG - Intronic
1172613282 20:36267069-36267091 GTGAAGCCATGGGAGGCAGATGG + Intronic
1173945330 20:46945818-46945840 CTGCAGCAAAGAGCCGCAGAAGG - Intronic
1174227908 20:49019087-49019109 CTGAGGCACAGGGCAGAAGAAGG - Intronic
1175804499 20:61820055-61820077 CTGAAGCAAGGTGCAGCTGAGGG - Intronic
1176252887 20:64134000-64134022 CTGAAGCAAAAAGCAGCCGAGGG - Intergenic
1177610704 21:23443801-23443823 ATGATGCAATGGGCACAAGATGG + Intergenic
1178142241 21:29697726-29697748 CTGAAGCTATGGGGAGGAGAAGG - Intronic
1179930056 21:44562679-44562701 CAGAAACAATGGGCACCAGAAGG + Intronic
1180649499 22:17367018-17367040 CAGAAGGAAAGGGCAGCAGAAGG + Intronic
1184320825 22:43741032-43741054 CTGAAGAATTGAGCTGCAGATGG + Intronic
1184538792 22:45106243-45106265 CTGAAGCAAGGGGTAGCAGTGGG + Intergenic
1184877501 22:47284719-47284741 CTGAGGAAATGGTCAGCAAATGG + Intergenic
1184933986 22:47705594-47705616 GTGAAGCAAAGGTCAGAAGAGGG - Intergenic
950419009 3:12885776-12885798 CTGAAGCAATGGGAGGCAAAAGG + Intergenic
950624743 3:14236847-14236869 CTAATCCAAGGGGCAGCAGAAGG - Intergenic
953397363 3:42583780-42583802 CTGATGCCAAGGGCAGAAGAGGG - Intronic
954499663 3:50999970-50999992 TTGAAGCAGTGGCCAGCACATGG - Intronic
954639190 3:52088016-52088038 CTGAAGAAATGGGTTGCAGAAGG - Intronic
955264548 3:57428929-57428951 GTGAAGCTATGTGAAGCAGATGG - Intronic
955526681 3:59827624-59827646 CTGAAGCACAGGGCAGTAAAGGG + Intronic
955874135 3:63472553-63472575 ATGAAGGAATGGGCAATAGAAGG - Intronic
960611344 3:119557714-119557736 CTGAAGCCATGGGCCACACACGG - Exonic
961313947 3:126021608-126021630 CTGAAATAATGAGCAGGAGAAGG - Intronic
962106931 3:132399969-132399991 GTGAAGAAATGGGTGGCAGAAGG - Intergenic
962280557 3:134048816-134048838 CTGACGGTATGGGCAGGAGATGG - Intronic
963582169 3:147139125-147139147 GTTAACCAATGGGCACCAGATGG + Intergenic
965768909 3:172160127-172160149 CTGAAGCCAAGGGCAGCAGTGGG + Intronic
968184038 3:196619176-196619198 CTGCAGCCATGGGCCACAGATGG - Intergenic
968280211 3:197471463-197471485 CTGAAGCAGTGGGAAGCAATGGG + Intergenic
969264149 4:6054254-6054276 CGGAGGCAAGGGGCAGGAGAGGG + Intronic
969499802 4:7545764-7545786 CTGAAGACAGAGGCAGCAGAAGG - Intronic
969686874 4:8680483-8680505 GTGGAGCAAGGGGCAGCAGAGGG + Intergenic
970839053 4:20445125-20445147 CTGAATTAATGGCCAGGAGAGGG - Intronic
971860728 4:32101522-32101544 CTGAAGCAATCAGCAGCTGTTGG - Intergenic
974812375 4:66960980-66961002 GTGAGGCAATAGGAAGCAGACGG - Intergenic
977632134 4:99254872-99254894 CTGAAGTAATAGGAAGCTGAGGG - Intergenic
978371772 4:108036403-108036425 CTGAAGCAAACAGCAGCAGCGGG - Intergenic
981562167 4:146059735-146059757 GTGAAGGAATGGGCTGCTGAGGG - Intergenic
982063182 4:151625020-151625042 CTGCAGCCAAGGGCAGCAGCTGG - Intronic
982138513 4:152295361-152295383 TAGAAGCAAGGGCCAGCAGAAGG + Intergenic
983938721 4:173521148-173521170 CTGACTCATTGGGCAGCACAAGG - Intergenic
985318967 4:188687804-188687826 CTGCAGCAAAGGGTGGCAGAGGG - Intergenic
985786929 5:1900953-1900975 CTCAAGGAATGAGCAACAGAAGG - Intergenic
985913988 5:2903832-2903854 CAGAAGCCATGGGCAGATGATGG + Intergenic
986318083 5:6604540-6604562 CTGAAGCAGTCGGGAGTAGATGG - Intronic
990996198 5:61734491-61734513 CTGAAGCAAGGGGCAAGATAGGG + Intronic
991048179 5:62244892-62244914 GGGAAGGAATGGGCAGGAGAGGG + Intergenic
991734414 5:69618665-69618687 CTGCAGATAGGGGCAGCAGAGGG - Intergenic
991780564 5:70128060-70128082 CTGCAGATAGGGGCAGCAGAGGG + Intergenic
991810848 5:70473800-70473822 CTGCAGATAGGGGCAGCAGAGGG - Intergenic
991859852 5:71003483-71003505 CTGCAGATAGGGGCAGCAGAGGG + Intronic
991873012 5:71128379-71128401 CTGCAGATAGGGGCAGCAGAGGG + Intergenic
992654012 5:78890511-78890533 CTAAAGCAATGGGCTGCAGAAGG - Intronic
992770402 5:80042135-80042157 CTGAGGACATGGCCAGCAGATGG + Intronic
995447594 5:112262968-112262990 CTAGAGCAATGGTCAGCAGGAGG + Intronic
995833266 5:116376654-116376676 CTGGAGCAGTGGGAAGCACAAGG - Intronic
997338845 5:133126796-133126818 CTGAAGAAATGGGTCTCAGATGG - Intergenic
999126571 5:149250484-149250506 CCGAAGAAATGGGCTGCACAGGG + Exonic
1000363075 5:160466171-160466193 CCGAGGCAAAAGGCAGCAGATGG + Intergenic
1001600542 5:172925538-172925560 CAGGAGCAGTGGGCAGCAGCGGG - Intronic
1002449080 5:179308897-179308919 CTGAATGAATGGGCAGCTGAGGG - Intronic
1002452501 5:179326849-179326871 CTGAAGTCATGGGAAGGAGAGGG + Intronic
1004140039 6:13009891-13009913 CTGAAGCAGTAGGGGGCAGAGGG - Intronic
1007153010 6:39713463-39713485 CTGAAGCAAAGGGCAGTGGCTGG + Intronic
1007208522 6:40172294-40172316 CTGAAGAAATGGGCAGGGGCAGG - Intergenic
1009542026 6:64972299-64972321 CTAAAGCAAATGGCAGGAGAAGG + Intronic
1009585074 6:65590240-65590262 ATGAAGCAATGTGCAACAGATGG + Intronic
1010713649 6:79204411-79204433 CTGAAGCATTGTGTGGCAGAGGG - Intronic
1010910412 6:81548383-81548405 CTGAAGGAATGAGCTGCAGTAGG - Intronic
1010911089 6:81557612-81557634 CTGAAGGAATGAGCTGCAGTAGG - Intronic
1013746991 6:113357484-113357506 CTGAGACAGTGGGCAGAAGAAGG + Intergenic
1015654860 6:135506433-135506455 CTAAAGCAATGAGCACTAGATGG + Intergenic
1020038629 7:4983607-4983629 TTGAAGCAATGGGCAGGTGTGGG + Intergenic
1020156670 7:5730859-5730881 TTGAAGCAATGGGCAGGTGTGGG - Intronic
1022426711 7:30276243-30276265 CTGAAGCTATTTGCAGCAGTGGG - Intergenic
1022438358 7:30411409-30411431 CTGAAGCAACTGGGACCAGAAGG + Intronic
1024594365 7:50919331-50919353 CTGAAGAAAAAGGCAGCAAAAGG - Intergenic
1024742778 7:52372844-52372866 CTGAAGCAATGGGAAGTAAGGGG - Intergenic
1026988987 7:74572583-74572605 CTCAAGTCTTGGGCAGCAGAAGG - Intronic
1029191649 7:98776247-98776269 CTGAAGCCAGGGGCAGCTGTGGG - Intergenic
1029492760 7:100881431-100881453 CTGAGGCAAAGGGGAGGAGAGGG - Intronic
1032311937 7:130795775-130795797 CTGAAGAAATGGCCATCTGAGGG - Intergenic
1032656827 7:133939430-133939452 CTGAAGCAGTGGGCTTCAGAGGG + Intronic
1033282757 7:140017602-140017624 CTGGAGCACAGGGCTGCAGAGGG + Intronic
1036012121 8:4737807-4737829 CTAAAGTAATGGGCAGCATATGG + Intronic
1036474585 8:9081563-9081585 GTGAAGAAATGGGTAGCAGAGGG - Intronic
1038023856 8:23571965-23571987 CTAAGGCATTGGGGAGCAGAGGG - Exonic
1039128362 8:34230587-34230609 GTGAAGCAATGTGAAGCAGTAGG + Intergenic
1041171478 8:55146841-55146863 CTGTATCAAGGGACAGCAGAAGG - Intronic
1041271331 8:56112033-56112055 CTGATGCAATGGCTGGCAGAGGG - Intergenic
1042046934 8:64663868-64663890 CTGAAGCACTGGGCAACTTAGGG - Intronic
1042888397 8:73578599-73578621 CTGAAGCAATTGGGAGCAATGGG - Intronic
1046669367 8:117041208-117041230 CTAAGGCACTTGGCAGCAGAAGG + Intronic
1047749946 8:127872882-127872904 CTGAAGCAAGGGGCAGGCGTGGG - Intergenic
1048169925 8:132096614-132096636 CTGGAGCACAGTGCAGCAGAGGG + Intronic
1048200077 8:132365441-132365463 GTGAAGCAACTGGAAGCAGATGG - Intronic
1050507426 9:6362469-6362491 CTTTAGCAAAGGGGAGCAGATGG + Intergenic
1057294151 9:93825701-93825723 CTGAAGCCCTGGCCTGCAGACGG - Intergenic
1058712982 9:107697257-107697279 CTGCAGCAATGAGGAGAAGATGG + Intergenic
1058941956 9:109821740-109821762 CTGGAGCCTTGGGCAGCACAGGG - Intronic
1059334914 9:113562998-113563020 CTGGAGCTATGGGAGGCAGAGGG + Intronic
1059368769 9:113807987-113808009 GGGAGGTAATGGGCAGCAGATGG + Intergenic
1059588584 9:115632644-115632666 CTGAGGCACTGGGAACCAGAAGG + Intergenic
1061974053 9:134059545-134059567 CTGCGGGAATGTGCAGCAGAAGG + Intronic
1062473232 9:136715250-136715272 CTCAGGCACTGGCCAGCAGAGGG - Intronic
1186198450 X:7132601-7132623 CAGAAGCAATGCCCAGGAGAGGG + Intronic
1186215216 X:7292761-7292783 CTGATGCAATTGCAAGCAGAGGG - Intronic
1186793692 X:13023806-13023828 CTCATGCAATGGGCAGCTAATGG + Intergenic
1189415193 X:40806506-40806528 CTGAATCAAAGGGAAGCAGTAGG - Intergenic
1192301049 X:69903429-69903451 CTGAAGCAATTTGCTTCAGAAGG + Intronic
1192698827 X:73446892-73446914 CTGACGCTATGGGGACCAGATGG + Intergenic
1195706037 X:107738651-107738673 CTGGCCCCATGGGCAGCAGAAGG - Intronic
1195938859 X:110150297-110150319 CTGTGGCAATGGGGAGCACAAGG + Intronic
1197017288 X:121641324-121641346 CTTAGGCAATGGACAACAGAAGG - Intergenic
1197593400 X:128437474-128437496 TGGAAGCAATTGGCAGCACAGGG - Intergenic
1198265662 X:135006284-135006306 CTGAAGGATTAGGGAGCAGATGG - Intergenic
1201349380 Y:13023195-13023217 GAGCAGCAATGGGCAGTAGATGG + Intergenic
1201705151 Y:16928539-16928561 CTGAGGGAATGGGCAGCTGTAGG + Intergenic
1202300594 Y:23409555-23409577 CTGAAGCAAGGGCAAGCAAAAGG + Intergenic
1202570217 Y:26261043-26261065 CTGAAGCAAGGGCAAGCAAAAGG - Intergenic