ID: 902926426

View in Genome Browser
Species Human (GRCh38)
Location 1:19698742-19698764
Sequence CTCCATAAAGAGATGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 152}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902926419_902926426 12 Left 902926419 1:19698707-19698729 CCTTCCCTTTCTTCTTCCTTCTC 0: 2
1: 13
2: 188
3: 1572
4: 9121
Right 902926426 1:19698742-19698764 CTCCATAAAGAGATGGCCCAGGG 0: 1
1: 1
2: 1
3: 9
4: 152
902926418_902926426 15 Left 902926418 1:19698704-19698726 CCTCCTTCCCTTTCTTCTTCCTT 0: 1
1: 23
2: 289
3: 2030
4: 10683
Right 902926426 1:19698742-19698764 CTCCATAAAGAGATGGCCCAGGG 0: 1
1: 1
2: 1
3: 9
4: 152
902926422_902926426 -4 Left 902926422 1:19698723-19698745 CCTTCTCTTTCTCCTTTCTCTCC 0: 1
1: 9
2: 121
3: 990
4: 5685
Right 902926426 1:19698742-19698764 CTCCATAAAGAGATGGCCCAGGG 0: 1
1: 1
2: 1
3: 9
4: 152
902926414_902926426 22 Left 902926414 1:19698697-19698719 CCCCTTCCCTCCTTCCCTTTCTT 0: 1
1: 13
2: 145
3: 869
4: 4562
Right 902926426 1:19698742-19698764 CTCCATAAAGAGATGGCCCAGGG 0: 1
1: 1
2: 1
3: 9
4: 152
902926415_902926426 21 Left 902926415 1:19698698-19698720 CCCTTCCCTCCTTCCCTTTCTTC 0: 1
1: 28
2: 326
3: 1933
4: 7454
Right 902926426 1:19698742-19698764 CTCCATAAAGAGATGGCCCAGGG 0: 1
1: 1
2: 1
3: 9
4: 152
902926416_902926426 20 Left 902926416 1:19698699-19698721 CCTTCCCTCCTTCCCTTTCTTCT 0: 4
1: 65
2: 1046
3: 7037
4: 24673
Right 902926426 1:19698742-19698764 CTCCATAAAGAGATGGCCCAGGG 0: 1
1: 1
2: 1
3: 9
4: 152
902926421_902926426 7 Left 902926421 1:19698712-19698734 CCTTTCTTCTTCCTTCTCTTTCT 0: 2
1: 9
2: 174
3: 1371
4: 8621
Right 902926426 1:19698742-19698764 CTCCATAAAGAGATGGCCCAGGG 0: 1
1: 1
2: 1
3: 9
4: 152
902926420_902926426 8 Left 902926420 1:19698711-19698733 CCCTTTCTTCTTCCTTCTCTTTC 0: 2
1: 9
2: 129
3: 1190
4: 7523
Right 902926426 1:19698742-19698764 CTCCATAAAGAGATGGCCCAGGG 0: 1
1: 1
2: 1
3: 9
4: 152
902926417_902926426 16 Left 902926417 1:19698703-19698725 CCCTCCTTCCCTTTCTTCTTCCT 0: 1
1: 38
2: 455
3: 3389
4: 19463
Right 902926426 1:19698742-19698764 CTCCATAAAGAGATGGCCCAGGG 0: 1
1: 1
2: 1
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902926426 Original CRISPR CTCCATAAAGAGATGGCCCA GGG Intronic
902926426 1:19698742-19698764 CTCCATAAAGAGATGGCCCAGGG + Intronic
903323085 1:22554112-22554134 CTCCATGGTGAGATGGCCCAAGG + Intergenic
903356332 1:22750187-22750209 TTTCATAGAGAGGTGGCCCATGG - Intronic
909136081 1:71802324-71802346 CTCCATAAAGAGATTGCCCATGG + Intronic
909973210 1:82015683-82015705 GTCCTGCAAGAGATGGCCCAGGG - Intergenic
912177571 1:107179069-107179091 CCCCACAAAGAGAAGACCCAGGG + Intronic
913109005 1:115641615-115641637 CACTATAAACACATGGCCCAGGG - Intergenic
919466003 1:197921989-197922011 CTCCACAAAGAAATTGCCCTGGG - Intronic
924198253 1:241632806-241632828 CTCTATAAATAGATTACCCAAGG - Exonic
1062780043 10:194726-194748 CTCCATAAAAAAATGGGCAAAGG - Intronic
1062847300 10:717815-717837 CTCCGGACAGAGGTGGCCCATGG + Intergenic
1062847322 10:717885-717907 CTCCGGACAGAGGTGGCCCATGG + Intergenic
1062847344 10:717955-717977 CTCCGGACAGAGGTGGCCCATGG + Intergenic
1062847366 10:718025-718047 CTCCGGACAGAGGTGGCCCATGG + Intergenic
1062847388 10:718095-718117 CTCCGGACAGAGGTGGCCCATGG + Intergenic
1062847409 10:718165-718187 CTCCAGACAGAGGTGGCCCATGG + Intergenic
1062847431 10:718235-718257 CTCCGGACAGAGGTGGCCCATGG + Intergenic
1062847451 10:718305-718327 CTCCGGACAGAGGTGGCCCATGG + Intergenic
1062847487 10:718444-718466 CTCCAGACAGAGGCGGCCCATGG + Intergenic
1065192933 10:23231338-23231360 CTCCAGAAAGAGAAAGTCCAGGG - Intronic
1066314150 10:34227180-34227202 CTCCATTAAGAAATGGGCAAAGG + Intronic
1068598818 10:58934280-58934302 CTCTTTGAAGAGATGGCCCATGG - Intergenic
1069726502 10:70583388-70583410 CTTCATAAAGAGATTTTCCAGGG + Intergenic
1074205232 10:111277373-111277395 CTTCATTAAGAAAAGGCCCAGGG + Intergenic
1077115977 11:884839-884861 GGCCATCCAGAGATGGCCCAGGG - Intronic
1079864616 11:25719572-25719594 CTCCATCAAAAAATGGGCCAAGG - Intergenic
1081806533 11:45893884-45893906 CTCCATAAAGGGACCCCCCAGGG + Intronic
1085321041 11:75574180-75574202 CTCCATGAAGAGAGGGTCCATGG + Intergenic
1088374309 11:109123444-109123466 ATACATAAAGAGAAGGCACAGGG + Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1089184887 11:116608112-116608134 CTCCACAAAGAGAGTGCCCTTGG + Intergenic
1091270381 11:134307231-134307253 CTCCAGGAAGAGATGGCCCCAGG + Intronic
1094305088 12:29009485-29009507 CTGTATAAAGAGATGACCCATGG - Intergenic
1095930537 12:47620736-47620758 CTCCAGAAAGGGAGGCCCCAGGG - Intergenic
1098887701 12:75976939-75976961 CTCCATCAAGAAATGGAACATGG - Intergenic
1099709085 12:86196756-86196778 CTCCTTAAAGAGATTACCTATGG - Intronic
1099734790 12:86553280-86553302 CCCTAAAAAGAAATGGCCCAAGG - Intronic
1102511981 12:113422110-113422132 ATCCCGGAAGAGATGGCCCAGGG + Intronic
1103321453 12:120094918-120094940 CTCCATGAACAGGTGGGCCAGGG - Intergenic
1104584688 12:130038610-130038632 CTCCATAAAGAGCCCGCCCTAGG + Intergenic
1108826964 13:54423881-54423903 CTCAAATAAGAGATGGCCCCAGG - Intergenic
1113286179 13:108851721-108851743 CTCTAGAAAAAGGTGGCCCAAGG - Intronic
1113485430 13:110649338-110649360 CAGGATAAAGACATGGCCCAAGG + Intronic
1114885090 14:26839390-26839412 CTCCATAAAGGCACAGCCCACGG + Intergenic
1116874006 14:50093354-50093376 TTCTATAAAGAGAGAGCCCAGGG - Intergenic
1121493759 14:94378160-94378182 CTCCAGAAACAGATGGGCCCAGG + Exonic
1121928085 14:97947485-97947507 CATGCTAAAGAGATGGCCCATGG - Intronic
1126437779 15:48653495-48653517 CTTCATAAACACATAGCCCAGGG - Intergenic
1126565675 15:50096312-50096334 CTTCCTAAAGAGAAGCCCCAGGG - Intronic
1128698035 15:69783247-69783269 CTTCATAGAGAAATGGCCGAAGG - Intergenic
1128721629 15:69954708-69954730 CCCCATGAGGAGATGCCCCAGGG - Intergenic
1134102118 16:11459896-11459918 CTCCATGAAGTGATTGCTCAGGG + Exonic
1134561664 16:15215366-15215388 CTCCATAAATAGAAGGCCTTTGG - Intergenic
1134922202 16:18126992-18127014 CTCCATAAATAGAAGGCCTTTGG - Intergenic
1135405642 16:22195662-22195684 CTACATAAAGAGATGGTTTATGG + Intergenic
1140305220 16:73796755-73796777 CGACATAAAGAGATGGCAAAGGG + Intergenic
1141500757 16:84442734-84442756 CACCACCAACAGATGGCCCAAGG - Intronic
1146910716 17:36646771-36646793 CTCCCTAAAGATGTGACCCAGGG - Intergenic
1147981054 17:44274297-44274319 CTCCCTACTGAGATGGTCCATGG + Intergenic
1148321985 17:46762176-46762198 CTCCTAAAAGATGTGGCCCAAGG - Intergenic
1149553129 17:57554832-57554854 GTCTGTAAAGATATGGCCCACGG - Intronic
1150310610 17:64126259-64126281 CTCCCTAAAGAGATGACATAGGG - Intronic
1150418487 17:65007061-65007083 CTCAAAAAGCAGATGGCCCAGGG - Intergenic
1151659017 17:75508980-75509002 CTCCAACAAGAGCTGGCACAGGG + Intronic
1160444080 18:78913868-78913890 CTCCACAAAGAGCCGGCCCGAGG + Intergenic
1161628057 19:5338469-5338491 AGCCAGAAAGAGATGCCCCACGG + Intronic
1165216517 19:34277956-34277978 CTCCACAGAGAGATGACCAATGG + Intronic
1165995390 19:39840253-39840275 CTCCATAAACTGATTCCCCAGGG + Exonic
1166007988 19:39920197-39920219 CTCAAAAAAAAGATGCCCCAGGG - Intronic
925532268 2:4877239-4877261 CTCCATTAAGAGCTGGGCGAGGG - Intergenic
927601971 2:24451157-24451179 CTCCATGAAGATGTGGACCATGG + Intergenic
932924043 2:75950293-75950315 CACCATTATGAGATGACCCAAGG - Intergenic
936873859 2:117164853-117164875 GTCCAGAAAGAGGTGGTCCAGGG + Intergenic
937698770 2:124839578-124839600 CTCAATGAAGGGATGCCCCAGGG - Intronic
937885261 2:126895121-126895143 TGCCAAAAGGAGATGGCCCAAGG + Intergenic
939944258 2:148389755-148389777 CTCCATTAAAAAGTGGCCCAAGG - Intronic
939985587 2:148826855-148826877 CTCCATCAGGAGATTACCCATGG + Intergenic
940014886 2:149093530-149093552 ATGTTTAAAGAGATGGCCCATGG - Intronic
945384928 2:209186237-209186259 CTCAATAAAGAAATGGTCAAAGG + Intergenic
1168827390 20:823028-823050 CTCCAGGCAGAGATGGACCAGGG + Intergenic
1170377243 20:15713602-15713624 CTCTATCATGAGATGGCACAAGG + Intronic
1175515609 20:59568132-59568154 CTCCAGAACGAGAGGACCCAGGG + Intergenic
1175884815 20:62283762-62283784 CCCAAAAGAGAGATGGCCCATGG - Intronic
1177885815 21:26744101-26744123 CTCAACACAGAGATGCCCCATGG + Intergenic
1179118108 21:38513581-38513603 CTGCATAAAGAGATGGCTGTGGG + Intronic
1180183094 21:46126672-46126694 CTCCTTAGGGAGATGGCCCCAGG + Intronic
1181113097 22:20613250-20613272 TCCCATGAAGTGATGGCCCAGGG - Intergenic
1182020659 22:27078973-27078995 CTCCCTAAAGAAAAAGCCCAGGG - Intergenic
1183358458 22:37371564-37371586 CTCCCAAAAGAGCTGGCCCCAGG + Exonic
1184526411 22:45026341-45026363 CTCCATAAAGAGATTACCCAAGG + Intergenic
950022944 3:9801464-9801486 CGTCATTAAGAGATGCCCCAAGG + Intronic
951477135 3:23118889-23118911 ATACATAAAGAGATGGGCTATGG + Intergenic
951579292 3:24144867-24144889 CTTCATCAAGAAATGGCCCTAGG - Intronic
953482213 3:43261468-43261490 ACACATAAAGAGATGTCCCAGGG - Intergenic
955467452 3:59252050-59252072 CTTCATAAGGAGCTGGTCCAAGG - Intergenic
956854318 3:73260969-73260991 ACTCATAAAGGGATGGCCCATGG - Intergenic
957608375 3:82433772-82433794 CTCCATAAAGAAGTGGGCAAAGG - Intergenic
958758378 3:98276537-98276559 CCCCATAAAGAGAGAGGCCAGGG + Intergenic
961264717 3:125632550-125632572 GTCCACTAGGAGATGGCCCAGGG - Intergenic
962830696 3:139136628-139136650 CTCCCTAATGAAATGGCCCAGGG - Intronic
963960731 3:151306023-151306045 CTCCTGAAAGAGGTGGCCCAGGG - Intronic
969416890 4:7066757-7066779 CTGCAGAACGAGATGGCCCCGGG - Intronic
969907834 4:10413816-10413838 CACCATAAAGAGTGAGCCCAAGG + Intergenic
971330432 4:25677085-25677107 CTTCAGAAAGAAAAGGCCCAGGG + Exonic
971843120 4:31880361-31880383 CTCCATAAAAATGTAGCCCAGGG + Intergenic
974969745 4:68808942-68808964 CTCCATTAAAAAATGGGCCAGGG + Intergenic
979373743 4:119919791-119919813 CTCCATCAAAAAATGGGCCAAGG + Intergenic
984882607 4:184423697-184423719 CTTCCTCAAGAAATGGCCCAGGG + Intronic
986986700 5:13508326-13508348 CTGCATTATGAGAGGGCCCAAGG - Intergenic
989365181 5:40647849-40647871 CTCCCTGAAGAGATATCCCAAGG - Intergenic
991956008 5:71996746-71996768 CTCCCAAAAAAAATGGCCCAAGG + Intergenic
994309131 5:98246137-98246159 CTCCATCTACAGATGACCCAAGG + Intergenic
1000373802 5:160560891-160560913 CCCCAAAAAGAGAAGCCCCAAGG - Intergenic
1001277322 5:170360187-170360209 CTGCTGAGAGAGATGGCCCAGGG - Intronic
1001686761 5:173599191-173599213 CTCCATAAACACTTGGGCCAGGG - Intergenic
1001771440 5:174300075-174300097 CTAAATAAAGGGATGGCCAAGGG + Intergenic
1003544291 6:7045414-7045436 CTCCATGCACAGATGGCACAGGG - Intergenic
1004887881 6:20069263-20069285 CTCGATAAACAGCTCGCCCATGG + Intergenic
1007785474 6:44276966-44276988 CTCCATAGAGAGAGGCCCCAGGG - Exonic
1008754471 6:54777741-54777763 CTACACAAAAAGATGGACCATGG - Intergenic
1008920476 6:56839097-56839119 CTGCAGATAGAGATGGCCCCTGG + Intronic
1009485093 6:64211185-64211207 CTCCAGAAAGACATGACCAATGG - Intronic
1011982805 6:93404403-93404425 CTCTATAAAGACATGATCCAGGG + Intronic
1011990521 6:93509614-93509636 CCCCATAAAGTAATGGCCAAAGG - Intergenic
1013947018 6:115733607-115733629 CTGCAATAACAGATGGCCCAAGG - Intergenic
1014255740 6:119158765-119158787 CTTCATTAAGAAATGACCCATGG - Intergenic
1016648659 6:146439130-146439152 CATCAGAAAGAGCTGGCCCATGG + Intergenic
1019308756 7:348694-348716 CTCCAGGAATAGATAGCCCAGGG + Intergenic
1022837926 7:34134637-34134659 CTCCTTAAAGATGTGGCCCCTGG + Intronic
1023715440 7:43039345-43039367 CTCCATAGAGAGGAAGCCCAGGG + Intergenic
1026026528 7:66749108-66749130 CTCCATACAGAGATGGGCTGAGG + Intronic
1026811039 7:73465236-73465258 CTCTATATATAGATGGCCAAAGG + Intronic
1027112883 7:75454768-75454790 ATGGATAAAGAGATGGCACACGG + Intronic
1027285129 7:76639379-76639401 ATGGATAAAGAGATGGCACACGG + Intergenic
1028869647 7:95755306-95755328 TTCCACAAAGAGAAGGCCAAAGG + Intergenic
1032789292 7:135230855-135230877 CCCCATCAAGACATGTCCCAGGG - Intergenic
1036634520 8:10539905-10539927 CTCAAAAGAGAGAAGGCCCAAGG - Intronic
1037385149 8:18332108-18332130 ATCCATGAAGAAATGGGCCATGG + Intergenic
1040722077 8:50336835-50336857 CTCCATAAAATCATGGCCTAAGG + Intronic
1041998461 8:64091963-64091985 CTCCATGAAGAGATTACTCATGG + Intergenic
1043641961 8:82464810-82464832 CTCCTAAAAGATATGGCCCTAGG + Intergenic
1047089335 8:121556385-121556407 CTCCAAAAAGAAATGGGCCCTGG + Intergenic
1047921525 8:129639596-129639618 CTACATAATCAGATGGCTCATGG + Intergenic
1048892492 8:138960343-138960365 TTCCAAAAAGAGAAGGCACAAGG - Intergenic
1051480027 9:17549717-17549739 CTCCATGAAGACTGGGCCCAGGG - Intergenic
1052581829 9:30366747-30366769 CTCCATTAAAAGATGGGCAAAGG - Intergenic
1055077135 9:72227937-72227959 CTCCAGACAGTGATGGCACACGG + Exonic
1055085455 9:72309030-72309052 CTCAATATAGGGATGGACCAAGG + Intergenic
1057287754 9:93774151-93774173 TTTCATAAGGAGATTGCCCATGG + Intergenic
1057602786 9:96473066-96473088 CTACAGAAAGAGAAGGCCTAAGG - Intronic
1059178583 9:112190541-112190563 CTCCATCAAGAAATGGGCAAAGG - Intergenic
1059303168 9:113331827-113331849 CTGAAGAAAGAGAAGGCCCAGGG - Intronic
1059493660 9:114691422-114691444 CTCCCCCAATAGATGGCCCAAGG + Intergenic
1061383702 9:130276023-130276045 TGCTAGAAAGAGATGGCCCAGGG + Intergenic
1061907642 9:133707013-133707035 CTCCTTAGAAAGGTGGCCCATGG - Intronic
1062677717 9:137757436-137757458 GTAGCTAAAGAGATGGCCCAAGG - Intronic
1187007716 X:15248751-15248773 CTCCAAGAAGAGCTGGGCCAAGG + Exonic
1188287448 X:28344867-28344889 GGACATAAAGAGATGGCTCATGG - Intergenic
1192218060 X:69177695-69177717 CTCCCTACAGAGTGGGCCCAGGG - Intergenic
1194751469 X:97689472-97689494 CTCCATATTGAAAAGGCCCAGGG + Intergenic
1198332366 X:135633466-135633488 TTTCTTAAAGAGATTGCCCAAGG + Intergenic
1198364662 X:135928533-135928555 TTTCTTAAAGAGATTGCCCAAGG + Intergenic
1198520961 X:137451877-137451899 CTCCATAAGGAGATTACACAAGG - Intergenic
1199941670 X:152633650-152633672 CTCCAGCATGAGATAGCCCAAGG + Intergenic