ID: 902929069

View in Genome Browser
Species Human (GRCh38)
Location 1:19717612-19717634
Sequence CACATGCACCTTCCTGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 9, 3: 45, 4: 395}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902929064_902929069 6 Left 902929064 1:19717583-19717605 CCTTGGCTGCAGTCACTGGCCCT 0: 1
1: 0
2: 2
3: 39
4: 340
Right 902929069 1:19717612-19717634 CACATGCACCTTCCTGCCTCTGG 0: 1
1: 0
2: 9
3: 45
4: 395
902929062_902929069 17 Left 902929062 1:19717572-19717594 CCTGGCAGAAACCTTGGCTGCAG 0: 1
1: 0
2: 5
3: 48
4: 360
Right 902929069 1:19717612-19717634 CACATGCACCTTCCTGCCTCTGG 0: 1
1: 0
2: 9
3: 45
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902929069 Original CRISPR CACATGCACCTTCCTGCCTC TGG Intronic
901115383 1:6839772-6839794 AGCAAGCACATTCCTGCCTCAGG - Intronic
901181073 1:7342252-7342274 TGCATCCACCTTGCTGCCTCTGG - Intronic
901718535 1:11176387-11176409 CAGATGCTCCTTGCTGCCTGAGG - Intronic
901727225 1:11251275-11251297 CACCAGCACGCTCCTGCCTCAGG + Intronic
902929069 1:19717612-19717634 CACATGCACCTTCCTGCCTCTGG + Intronic
903047220 1:20573928-20573950 CTCAAGCATCTTCCCGCCTCAGG - Intergenic
903208853 1:21803911-21803933 GCCAGGCACATTCCTGCCTCAGG + Intergenic
903276704 1:22226477-22226499 CCCAAGCTGCTTCCTGCCTCAGG + Intergenic
904271797 1:29354980-29355002 CCCAAGCTCCTTCTTGCCTCAGG + Intergenic
904392406 1:30194764-30194786 AACAGGCACGTTCCTGCCTTGGG - Intergenic
904618123 1:31760837-31760859 CACACCCTCCATCCTGCCTCCGG + Intronic
905664739 1:39756152-39756174 CAGCTGCACCTGGCTGCCTCGGG + Intronic
905732717 1:40307589-40307611 GACATGCCCTTTCTTGCCTCTGG - Intronic
905920584 1:41716240-41716262 CCCATGGGCCTCCCTGCCTCTGG - Intronic
907912636 1:58840277-58840299 CACAAGCACTATCCTGCCACTGG + Intergenic
909775791 1:79483015-79483037 AAAATGCCCCTTCCTGGCTCTGG - Intergenic
912475806 1:109934049-109934071 CTGATTCACTTTCCTGCCTCTGG - Intergenic
912709340 1:111938693-111938715 GCCAAGCACGTTCCTGCCTCAGG - Intronic
912971715 1:114289958-114289980 CATAGGCACCCTCCTGTCTCAGG - Intergenic
913699665 1:121362240-121362262 CACTGGCAATTTCCTGCCTCTGG + Intronic
914137879 1:144917796-144917818 CACTGGCAATTTCCTGCCTCTGG - Intronic
915466620 1:156102161-156102183 CACAGGCACATTCCTCCCTTTGG - Intronic
916700556 1:167289537-167289559 CACAAGCACCTTACAGCCTTTGG - Intronic
917475014 1:175362001-175362023 CCCTTGCACCTCCCTTCCTCTGG + Intronic
917637956 1:176955408-176955430 CCCATCCATCCTCCTGCCTCAGG + Intronic
918400668 1:184159522-184159544 GTCATGCCTCTTCCTGCCTCAGG - Intergenic
919745736 1:201008236-201008258 CACCTGGCCCTTCCTGTCTCTGG - Intronic
920176105 1:204102943-204102965 CACACCCACCCACCTGCCTCCGG + Intronic
920487073 1:206380949-206380971 CACTGGCAATTTCCTGCCTCTGG + Intronic
922257716 1:223907444-223907466 CACATGCACTTTCCTCCAACAGG - Intergenic
923065922 1:230517306-230517328 CACACACACCTTCTTTCCTCCGG - Intergenic
923096396 1:230778549-230778571 CTCAAGCACCTCTCTGCCTCGGG + Intronic
923101223 1:230819141-230819163 CACATGATCCTCCCAGCCTCCGG - Intergenic
1062811828 10:472376-472398 CACAGGCACCGTCCTGGCACAGG + Intronic
1063372073 10:5528534-5528556 CACTTTGACCTTGCTGCCTCTGG - Intergenic
1065293397 10:24253111-24253133 GACAAGCCCCTTCCTTCCTCTGG - Intronic
1065712535 10:28532401-28532423 CACGCGCTCCTTCCTGCCTCGGG + Intergenic
1065911057 10:30305850-30305872 TACATTCACCTTCATTCCTCTGG - Intergenic
1065922735 10:30407393-30407415 AACCTCCACCTTCCTGGCTCAGG - Intergenic
1065956235 10:30696287-30696309 CCCAGACACATTCCTGCCTCTGG - Intergenic
1067478657 10:46581844-46581866 CCCATGCCCCTGCCTTCCTCTGG + Intronic
1067616080 10:47759957-47759979 CCCATGCCCCTGCCTTCCTCTGG - Intergenic
1069940816 10:71954116-71954138 CACATGGACTGTCCTTCCTCAGG - Intergenic
1070327632 10:75398954-75398976 CACATGCACATCCCCACCTCGGG - Exonic
1070729273 10:78814095-78814117 CACATGCACCCTCCTTGCTCTGG - Intergenic
1070859408 10:79638541-79638563 CACCAGTACCATCCTGCCTCTGG - Intergenic
1070948422 10:80411750-80411772 CACATGGGCCTCCTTGCCTCAGG - Intronic
1071203636 10:83249643-83249665 TACAAGGACCCTCCTGCCTCAGG + Intergenic
1072745615 10:97937200-97937222 CCCAGGCACTTTCTTGCCTCAGG + Intronic
1073136904 10:101225277-101225299 GACACGCACGTTCCTGGCTCGGG + Intergenic
1074090220 10:110245775-110245797 CAAAAGCATCTTCATGCCTCTGG - Intronic
1074301501 10:112237271-112237293 CACACACCCTTTCCTGCCTCTGG + Intergenic
1075157230 10:119988454-119988476 CACAGGCACTTACCAGCCTCTGG - Intergenic
1075409894 10:122219616-122219638 CAGATGTCCCTTGCTGCCTCTGG - Intronic
1076244690 10:128937635-128937657 CCCCTGCACCATCCAGCCTCAGG + Intergenic
1076473220 10:130734663-130734685 CACATTCCCCTTCATGCCTATGG - Intergenic
1076995755 11:296799-296821 CACCAGCACCTCCCTGCCTCAGG - Intergenic
1077061427 11:619390-619412 GACAAGCCCCTTCCTGCCCCAGG - Exonic
1077434475 11:2532181-2532203 CACAAGCATCTGTCTGCCTCAGG + Intronic
1078255052 11:9651630-9651652 CACATGCAGCTACCTGTTTCTGG + Intergenic
1078354450 11:10623704-10623726 CACATTCACCTTCCTTGATCTGG + Intronic
1079469598 11:20765632-20765654 CACAAGCTCCTTCCTGCCTTAGG - Intronic
1079590742 11:22179429-22179451 CATATGCTCATTCCTACCTCAGG + Intergenic
1080461028 11:32455156-32455178 GCCACCCACCTTCCTGCCTCAGG - Intergenic
1081608256 11:44541241-44541263 CCCAAGCACCTTCCCACCTCGGG - Intergenic
1084565955 11:69929075-69929097 GACATGCACATTGCTGCCCCAGG + Intergenic
1085181437 11:74540186-74540208 CTCATCCTCCTTCCTCCCTCCGG - Intronic
1085379199 11:76097376-76097398 CACATGCAGTTTCCTCTCTCTGG + Intronic
1086025506 11:82285748-82285770 CACATGCACTTTCTTACCTGGGG - Intergenic
1089700289 11:120240333-120240355 CAGATTCACCATCCTGCCCCAGG - Intronic
1089838730 11:121394970-121394992 CACATGTAACTTCCTGTGTCTGG + Intergenic
1089858132 11:121565268-121565290 CATATGAACCTCCCTTCCTCTGG + Intronic
1089973462 11:122712678-122712700 CACAGGTACCTTCCTACCTGTGG + Intronic
1090976709 11:131685517-131685539 GCCAAGCACATTCCTGCCTCAGG + Intronic
1091112355 11:132981496-132981518 CAAATTCACATTCCTCCCTCAGG - Intronic
1091372164 11:135070125-135070147 CACATGCTCTTCCCTCCCTCAGG + Intergenic
1091547321 12:1510124-1510146 CCCAAACACCTTCCTCCCTCTGG + Intergenic
1091636124 12:2198179-2198201 CACAAGCACCTTGCTTCCTGAGG - Intronic
1091846186 12:3657849-3657871 CACTTGCACCTTCCAACCCCAGG - Intronic
1091848859 12:3679051-3679073 CACCTGCATCTTCCTGACTTGGG + Exonic
1094524677 12:31223607-31223629 CACATGCACCTCCTTCCTTCTGG - Intergenic
1095673877 12:44893172-44893194 CACTTGCCTCTTCCTGCCTCTGG + Intronic
1095702109 12:45201165-45201187 CACATCCACCTCTCTGCCTTGGG - Intergenic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1098150049 12:67537470-67537492 AACATGCTTGTTCCTGCCTCTGG + Intergenic
1098470391 12:70836623-70836645 TGCATGCTCCTTGCTGCCTCAGG + Intronic
1098600384 12:72324378-72324400 CACCTGCACCTCCCCTCCTCTGG - Intronic
1099457388 12:82880381-82880403 CACATGCAACTTCATGCCATGGG - Intronic
1099701675 12:86091820-86091842 AACCTGCAAGTTCCTGCCTCTGG + Intronic
1099766234 12:86989338-86989360 CAGATGCATCTGCCTTCCTCAGG + Intergenic
1101507781 12:105362696-105362718 AACATGCACCTTCCCGCAGCTGG - Intronic
1102016303 12:109650145-109650167 GTCTTGCCCCTTCCTGCCTCAGG - Intergenic
1102790396 12:115639636-115639658 CAGATTTACCTTCCTGCTTCTGG + Intergenic
1102861957 12:116343906-116343928 GCCAAGCACCTTCCTGGCTCAGG - Intergenic
1103326831 12:120127212-120127234 AACATGAAGCTTCCTGCATCAGG - Exonic
1104198519 12:126565106-126565128 CAAATGCAACATCCTGCCTAGGG + Intergenic
1105914450 13:24900239-24900261 CTCAGGCACATTCTTGCCTCAGG - Intronic
1106112326 13:26787741-26787763 TGCATGCACCTTCCTTCCCCTGG + Intergenic
1106136653 13:26978626-26978648 CACTCGCACCTTCCGGGCTCAGG - Intergenic
1107242256 13:38250514-38250536 CACATGGACAGTCATGCCTCAGG + Intergenic
1107731338 13:43352101-43352123 CATCTGCCCCTTCCTCCCTCTGG + Intronic
1110090653 13:71443156-71443178 CTCATGGACATCCCTGCCTCTGG - Intronic
1111311842 13:86499569-86499591 CACATGCCCTTTCCAGCCTCTGG - Intergenic
1112897359 13:104316320-104316342 CAAATGCATCTACCTGCCACAGG + Intergenic
1113267752 13:108638220-108638242 AACATGCTCATTCCTGCCTCAGG - Intronic
1113404325 13:110023805-110023827 CTCAGGCACCTTCCTGGCTTCGG - Intergenic
1114769890 14:25417070-25417092 TACAAGCTCCTTCCTTCCTCAGG + Intergenic
1115443476 14:33462674-33462696 CACTGGCACCTTCCAGCCTAAGG + Intronic
1115809326 14:37089320-37089342 CACATTAACCTTCCTACCTAGGG + Intronic
1116869063 14:50054621-50054643 TACTTGCCCCTTCCTGCCTTAGG - Intergenic
1119192516 14:72692823-72692845 AACACTCACCTTCCTTCCTCTGG + Intronic
1119357761 14:74021025-74021047 CACATCCACTTTCCTACCTCTGG - Intronic
1119362511 14:74063124-74063146 GCCATGCTTCTTCCTGCCTCGGG + Intronic
1119716486 14:76863297-76863319 CATCTGCACTTCCCTGCCTCTGG - Intronic
1119972004 14:78981337-78981359 CACATGCACATTCCCCACTCTGG + Intronic
1120577003 14:86194873-86194895 CACAAGCACAAACCTGCCTCAGG + Intergenic
1120722423 14:87903583-87903605 CCCAGGCACCTTCCTTCCTTAGG - Intronic
1120996303 14:90420996-90421018 CCCATGCACCTTCCTTCCCAGGG + Intergenic
1121410392 14:93745122-93745144 ACCATGCCCCTTCCTGCCCCAGG + Intronic
1122232303 14:100312815-100312837 CCCATGAGCCTTCCTGCCTCAGG + Intergenic
1122623863 14:103074362-103074384 CCCCGGCACCTTCCTGCCTCCGG + Intergenic
1123714590 15:23017518-23017540 CACATGCATTTTCCTCACTCTGG - Intronic
1124069401 15:26377700-26377722 CACATGCACCCTCTTGCCATGGG + Intergenic
1124651592 15:31478045-31478067 CACAGGCACCCTCCTGCCTCAGG - Exonic
1124866114 15:33492989-33493011 CACTTACACCCTCCTCCCTCTGG - Intronic
1124893410 15:33754430-33754452 AACATGCATGCTCCTGCCTCAGG + Intronic
1125575368 15:40751807-40751829 CACATGCTCCTTGCTGCTTCTGG - Intronic
1127995146 15:64149611-64149633 GACAAGCTCTTTCCTGCCTCAGG - Intergenic
1128028858 15:64461530-64461552 CAGATTCTCCTTCCTCCCTCTGG + Intronic
1128090653 15:64916697-64916719 CAGCTGCTCCTTCCTACCTCAGG - Intronic
1128127518 15:65204006-65204028 CACAGGCACATTCCTGCCTCAGG - Intronic
1128642709 15:69351548-69351570 CACCTTCACCGTCCTACCTCAGG + Intronic
1128762389 15:70226179-70226201 CCCATGCCCACTCCTGCCTCTGG - Intergenic
1129274562 15:74436468-74436490 GGCATGGACTTTCCTGCCTCAGG + Intergenic
1129998044 15:80023740-80023762 CACAACCTCTTTCCTGCCTCAGG + Intergenic
1130312463 15:82767364-82767386 TTCATGCTCCTTCCTGCCACAGG - Intronic
1132083283 15:98885340-98885362 GACATGCAGCGTCCTGCCCCAGG - Intronic
1132516261 16:367521-367543 CCCATGCACCTTCCAGCCCGGGG - Exonic
1132638563 16:966279-966301 CACACGCTCCCTGCTGCCTCTGG - Intronic
1132726050 16:1338814-1338836 CACATGGCCCTTCCTGCCCCTGG + Intronic
1132749088 16:1449119-1449141 CACGTCCACCCTCCTGGCTCAGG + Intronic
1133303159 16:4795382-4795404 CACAGGCTGCTTCCTGCTTCCGG - Intronic
1133424674 16:5677763-5677785 CACATGCAATTTCCTCCATCTGG - Intergenic
1134451857 16:14368598-14368620 CACAGGCTCCTTCATGCCCCAGG + Intergenic
1135590936 16:23704931-23704953 CACATCCGACTGCCTGCCTCAGG - Exonic
1135809946 16:25577944-25577966 CAAATGATCCTGCCTGCCTCAGG + Intergenic
1135814706 16:25621953-25621975 ACCATGCTCCTTCCTGCATCTGG + Intergenic
1135973102 16:27086674-27086696 AACAGGCACATTCCTGCCCCAGG + Intergenic
1137369183 16:47888838-47888860 CCCAAGCATCTTCCTGCCTCAGG + Intergenic
1137876930 16:52006181-52006203 CACATGTCCTCTCCTGCCTCAGG - Intronic
1138646001 16:58425430-58425452 CTCAGGCAAGTTCCTGCCTCAGG - Intergenic
1139559077 16:67730285-67730307 CACATTTACCCTCCTGCCTTTGG - Intronic
1140532199 16:75676422-75676444 CAGATGATCCCTCCTGCCTCAGG + Intronic
1140981013 16:80109351-80109373 CAGATGCACCTTTCTGCCTGTGG - Intergenic
1141496605 16:84414726-84414748 CACAGGCTCCTTCTGGCCTCAGG - Intronic
1141797615 16:86285685-86285707 CACAGGTACCTGCCTCCCTCCGG - Intergenic
1142183668 16:88684347-88684369 CTCTTGCCCCGTCCTGCCTCTGG - Intronic
1142246575 16:88972976-88972998 CACACTGACCTCCCTGCCTCTGG + Intronic
1142469187 17:153226-153248 CACAAGCTCCTCCCTGCCACAGG - Intronic
1142886680 17:2917105-2917127 CACATGATCCTGCCTGCCACAGG + Intronic
1143029880 17:3961986-3962008 CAGCTGTTCCTTCCTGCCTCAGG - Intronic
1143563484 17:7708492-7708514 GAGAAGCACCTTCATGCCTCTGG - Exonic
1143874984 17:9984872-9984894 CAGATGCACCATCCAGCCTCAGG + Intronic
1144349628 17:14382603-14382625 CATATGCACTGTCCTGCCTCCGG - Intergenic
1144391118 17:14794266-14794288 GTCAAGCACTTTCCTGCCTCAGG + Intergenic
1144727993 17:17511404-17511426 CAGATGCCACTTCCTCCCTCGGG + Intronic
1145294727 17:21579068-21579090 CAAATGCCCCTTCCTGCTTCTGG - Intergenic
1145369107 17:22294106-22294128 CAAATGCCCCTTCCTGCTTCTGG + Intergenic
1145786681 17:27598236-27598258 CACAGTCACCTTCCTTCCTCTGG - Intronic
1146645507 17:34574503-34574525 ATCAAGCACATTCCTGCCTCAGG - Exonic
1147129106 17:38395624-38395646 CACACACACCTTCCTCCCTCTGG - Intronic
1148444338 17:47728349-47728371 CACCTGCCCTTTCCTCCCTCTGG - Intergenic
1148751088 17:49946315-49946337 CTCACACACCTCCCTGCCTCAGG + Intergenic
1149068013 17:52503434-52503456 CACTTGCCCCTTCCAGCTTCTGG - Intergenic
1151033009 17:70763587-70763609 CACATTCACCTGCATTCCTCTGG - Intergenic
1151455799 17:74225205-74225227 CCCATGCTCGCTCCTGCCTCTGG - Intronic
1152564225 17:81093021-81093043 CACATGCCCCATCCTGCATCTGG + Intronic
1152636983 17:81434246-81434268 CACGTGCACATTCCAGGCTCGGG + Intronic
1152640433 17:81447163-81447185 CACAAGGACATTCCTGCCTGGGG + Exonic
1152703001 17:81828764-81828786 CACAGGCACCGTCCTGGCCCCGG - Intronic
1155036730 18:22030742-22030764 GCCAGGCACCCTCCTGCCTCGGG + Intergenic
1155522576 18:26684015-26684037 CACATACACCTTCCTGCAAATGG + Intergenic
1155908500 18:31481624-31481646 CACACCCACATTCTTGCCTCAGG + Intergenic
1157131968 18:45015498-45015520 GACATGCACCTGCCTTTCTCGGG + Intronic
1158300455 18:56046558-56046580 CACAAGGACTTTCCAGCCTCTGG - Intergenic
1158543454 18:58376870-58376892 CACAAGCCCCTTCCTGCCTCAGG + Intronic
1159306814 18:66653657-66653679 TACAGGCACCCTGCTGCCTCAGG + Intergenic
1160802133 19:975015-975037 CAGAGGCTCCTCCCTGCCTCAGG + Exonic
1161195384 19:2983543-2983565 AACAGGCACCGTCCTGCCTCAGG - Intronic
1161634206 19:5377118-5377140 CCCAGGCACTGTCCTGCCTCAGG - Intergenic
1162491021 19:10991720-10991742 CACAGGCACATTCCAGCCCCAGG - Intronic
1162869702 19:13576196-13576218 ACCAGGCACATTCCTGCCTCAGG + Intronic
1163391835 19:17035923-17035945 CACGAGCTCCTTCCTGCCACAGG - Intergenic
1163675360 19:18653135-18653157 CACATGCATCCTCCAGGCTCAGG - Intronic
1164577916 19:29416961-29416983 CACCAGTGCCTTCCTGCCTCGGG + Intergenic
1164707847 19:30333506-30333528 CATCTTCACCTTCCTGCCTGCGG + Intronic
1165350831 19:35274466-35274488 CAAGTGCACCTCCCTCCCTCAGG - Intronic
1165740743 19:38203839-38203861 CACATGCACGGCCCAGCCTCAGG + Intronic
1165757238 19:38301051-38301073 CACAGGCACATTCCTGCCTCAGG + Intronic
1166279734 19:41783788-41783810 CTCAGGGTCCTTCCTGCCTCTGG - Intergenic
1167122969 19:47529924-47529946 CACAAGCTCCTTACTCCCTCAGG + Intronic
1167210542 19:48131408-48131430 CACATGCACCTTGCTGCATGTGG + Intronic
1167426576 19:49432724-49432746 CACCGGCTCCTCCCTGCCTCGGG + Intronic
1167487893 19:49773848-49773870 TACAAGCACAATCCTGCCTCAGG - Intronic
1167654785 19:50756446-50756468 TCCAGGCACCGTCCTGCCTCAGG + Intergenic
1167656466 19:50767525-50767547 TCCAGGCACCGTCCTGCCTCAGG + Intergenic
1168234585 19:55054085-55054107 CACCTGCACCTGCCTCCCTAGGG + Intronic
927487384 2:23497746-23497768 CACATGCACGCACCAGCCTCAGG - Intronic
928586285 2:32761588-32761610 GCCAGGCACATTCCTGCCTCAGG + Intronic
931258866 2:60599336-60599358 CACAGGCACCTGCCTGCACCTGG - Intergenic
932686435 2:73874620-73874642 CACATAGAACTTTCTGCCTCTGG - Intergenic
932962449 2:76429894-76429916 CTCATGCACCTTACTCCCCCTGG - Intergenic
933006441 2:77001446-77001468 CACATGCACATACTTGCCTTAGG - Intronic
933274944 2:80273677-80273699 CACAGACACACTCCTGCCTCAGG + Intronic
933349579 2:81136710-81136732 CACATGGACCTGCCTGACCCAGG + Intergenic
933970222 2:87463951-87463973 CACATGAACTTTCCTGCGTGGGG + Intergenic
935673585 2:105575821-105575843 CATATGGCCCTGCCTGCCTCTGG - Intergenic
935902433 2:107806835-107806857 CACATTCCCCTTCCTCACTCAGG - Intergenic
936323559 2:111486545-111486567 CACATGAACTTTCCTGCGTGGGG - Intergenic
936543178 2:113368602-113368624 CTCACCCACCTTCCAGCCTCTGG - Intergenic
937244140 2:120481744-120481766 AACATGCACGTTCCTGGCCCTGG - Intergenic
938072611 2:128316539-128316561 CAGATGCACGTTCCTGCTGCAGG - Intronic
939449113 2:142349480-142349502 TACATTCAGCTTCCTGGCTCTGG - Intergenic
939681848 2:145145767-145145789 CACATCCACTGGCCTGCCTCAGG - Intergenic
939978865 2:148754615-148754637 AAAATGGACCTTGCTGCCTCTGG + Intronic
942129343 2:172863003-172863025 CACAGGCACCATCCTGTCTCAGG - Intronic
944621113 2:201516983-201517005 CCCGTGTACCTCCCTGCCTCCGG + Intronic
944852938 2:203738586-203738608 CACAGGCATGTTCCTACCTCAGG + Exonic
945978207 2:216287043-216287065 CTCATCCACCTTCCATCCTCTGG + Intronic
947335459 2:229078011-229078033 CACATGCTCCTTCATGCTTGTGG - Intronic
947378811 2:229524933-229524955 CACATCCATCTCCCTGTCTCAGG - Intronic
948040314 2:234896356-234896378 CAGATGCATCTTCTTGTCTCTGG - Intergenic
948730061 2:239957143-239957165 CACATGCACAACCCTGCATCAGG + Intronic
948770568 2:240249514-240249536 CACAGGCCTCTGCCTGCCTCAGG + Intergenic
948917462 2:241042137-241042159 CTCATGCTCCCTCCTGCCTCAGG - Intronic
1168842223 20:916846-916868 CCGCTGCACCTTCCTCCCTCTGG + Intergenic
1168845409 20:941165-941187 GACAAGCTCCTTCCAGCCTCAGG - Intergenic
1168966722 20:1903116-1903138 TACAAGCTCATTCCTGCCTCAGG - Intronic
1168980430 20:1998894-1998916 ACCAAGCACATTCCTGCCTCGGG + Intergenic
1169116155 20:3067331-3067353 GCCAGGCACATTCCTGCCTCAGG + Intergenic
1169531154 20:6486527-6486549 CATGTGCACCTTTCTGCCTGAGG - Intergenic
1171409907 20:24939305-24939327 CATCTGCACTATCCTGCCTCAGG - Intergenic
1171436020 20:25125289-25125311 CACCTGCACTGTCCTGCCTCAGG + Intergenic
1171442798 20:25178995-25179017 CTCCAGCACCCTCCTGCCTCAGG + Intergenic
1172889685 20:38255195-38255217 CTCTTCCATCTTCCTGCCTCAGG + Intronic
1173640779 20:44600485-44600507 CACATGCACCACCCAGGCTCCGG - Intronic
1174051401 20:47769940-47769962 CTCAGGCATCTTCCTACCTCAGG - Intronic
1174083812 20:47990381-47990403 CACAAGCACCATCCTGCCTCAGG - Intergenic
1174238029 20:49110203-49110225 CGCATGCTCCTTCCAGCCCCTGG - Intergenic
1174399462 20:50268113-50268135 CACCTCAACTTTCCTGCCTCTGG - Intergenic
1174544807 20:51317423-51317445 CACATGCACCTTCCAGCCCATGG + Intergenic
1174670726 20:52305446-52305468 CCCATGCTCCTTCCTGCCTCAGG + Intergenic
1174723752 20:52840104-52840126 CACATCCACATTCCTGGCCCAGG + Intergenic
1174872835 20:54199507-54199529 TACACGCTCCCTCCTGCCTCAGG - Intergenic
1175032669 20:55971224-55971246 GACATGCTTCTTCCTGCCTCAGG - Intergenic
1176140518 20:63542816-63542838 CACATGCTCATTACTGCCCCTGG + Intronic
1178112850 21:29386369-29386391 CACTTAAATCTTCCTGCCTCAGG + Intronic
1179291491 21:40021770-40021792 CACAAGCTCCTCCTTGCCTCTGG + Intronic
1179302497 21:40124900-40124922 CCCTGGCAACTTCCTGCCTCTGG + Intronic
1180065685 21:45411090-45411112 CCCATGCCCCTCCCTGCCACAGG - Intronic
1180883547 22:19223793-19223815 CAGATCCAGCTTCCTGCCCCTGG + Intronic
1181237646 22:21457390-21457412 CATCTGCACCTTACTTCCTCAGG - Intergenic
1181406956 22:22691842-22691864 CCCATGCCCCTTCCTGCTCCTGG - Intergenic
1181480207 22:23194005-23194027 CACAACCACCTCCGTGCCTCAGG - Intronic
1181548475 22:23620010-23620032 CACCTGCTCTTTTCTGCCTCTGG - Intronic
1181673448 22:24436867-24436889 CACATGCTCATTCCTTCCTCAGG - Intronic
1181867188 22:25868156-25868178 CACCTGCACCTTCCTGTGTGAGG + Intronic
1181953437 22:26571226-26571248 CACAAGCACCCTCCCTCCTCTGG + Intronic
1182994141 22:34797439-34797461 AGCATGCTCCTTCCTGCCTCTGG - Intergenic
1183240037 22:36650841-36650863 CACAGGCACACTCCTGCCTCGGG + Intronic
1183267333 22:36836747-36836769 CACGTCCACCATCCTGCATCTGG - Intergenic
1184168309 22:42743559-42743581 CACCAGAGCCTTCCTGCCTCAGG - Intergenic
1184210365 22:43031747-43031769 GTCATGCCCCTCCCTGCCTCAGG - Intergenic
950196320 3:11011510-11011532 GCCAGGCTCCTTCCTGCCTCAGG + Intronic
950498111 3:13346569-13346591 CACATGCACAGAGCTGCCTCTGG - Intronic
950668633 3:14512147-14512169 TGCCTGCCCCTTCCTGCCTCTGG - Intronic
950821801 3:15767962-15767984 CACATGTGCCTTCCAGCCTGTGG - Intronic
950861188 3:16148988-16149010 CACATCCACCCTGCTGTCTCTGG + Intergenic
953442072 3:42926927-42926949 AGCATGCTCCCTCCTGCCTCAGG - Intronic
953899085 3:46828952-46828974 CACATGCACCTTCTTTCCATAGG + Intergenic
954874815 3:53795050-53795072 CACAGGCAGCTCCATGCCTCCGG - Intronic
955001381 3:54930736-54930758 CACTTGATCCTCCCTGCCTCCGG - Intronic
955353083 3:58208446-58208468 CAAAAGCACCTACCTACCTCAGG - Intronic
955766999 3:62355285-62355307 GCCAAGCACATTCCTGCCTCGGG - Intergenic
956082360 3:65571148-65571170 CAAATGCACCTGCCTGCATTAGG + Intronic
957974874 3:87430244-87430266 CACAAGCACATCACTGCCTCAGG + Intergenic
960013766 3:112862082-112862104 CACATACACTTCCCAGCCTCTGG + Intergenic
960152219 3:114261956-114261978 CACCTTCCCCATCCTGCCTCAGG - Intergenic
960262847 3:115588129-115588151 AACATGCACACTCCTGCCTTGGG + Intergenic
960287402 3:115844998-115845020 CAAATGCACTTCCCTGCCTTGGG - Intronic
961175548 3:124832121-124832143 CACATGCAACTTTCTTCCCCTGG + Intronic
961402435 3:126656622-126656644 CACATGCACAGAGCTGCCTCTGG + Intergenic
961530134 3:127535651-127535673 CACAGCCACCTTCCTCCCTTTGG + Intergenic
961551609 3:127673048-127673070 CACATCCCCCTTCCTGCAGCTGG - Exonic
961744758 3:129057418-129057440 CTCCAGCACTTTCCTGCCTCAGG - Intergenic
961824497 3:129592041-129592063 CACAAGCTCGTTCCTGCCTCAGG + Intronic
961830775 3:129622007-129622029 GCCGTGCTCCTTCCTGCCTCTGG - Intergenic
961864605 3:129944603-129944625 ACCATGCCCATTCCTGCCTCAGG - Intergenic
962315763 3:134358591-134358613 CACCTCCACCTGCCTGCCACCGG - Exonic
962331867 3:134485720-134485742 CAGCTGCGGCTTCCTGCCTCAGG + Exonic
962443752 3:135447376-135447398 CTCAAGCTCCTTCCTGTCTCAGG - Intergenic
962448918 3:135495004-135495026 TACATCCACCTTCCTCCTTCAGG + Intergenic
962453283 3:135539848-135539870 CCCAGGCACTCTCCTGCCTCAGG - Intergenic
962932798 3:140053127-140053149 CACAAGCATCCTCCTGCCTGAGG + Intronic
963869409 3:150398835-150398857 CCAATGTACCCTCCTGCCTCAGG - Intergenic
964746845 3:160020487-160020509 CAAAGGCACGCTCCTGCCTCAGG + Intronic
965863703 3:173178823-173178845 CACATCCACACTCCAGCCTCAGG - Intergenic
966661233 3:182417349-182417371 CACCTTCACCATCCTACCTCAGG + Intergenic
967230017 3:187328915-187328937 CACAGGTACATCCCTGCCTCTGG - Intergenic
968172760 3:196523645-196523667 AACATGGACGTTGCTGCCTCAGG + Intergenic
969251903 4:5973670-5973692 CACGGCCACCTTCCTGGCTCCGG - Exonic
969350409 4:6594972-6594994 CACATGCAGTTTCCTGCCTCTGG + Intronic
969455331 4:7296975-7296997 CACCAGCATCTTCCGGCCTCTGG + Intronic
969689327 4:8695475-8695497 CACATGCACCCTCCTTCCTCTGG - Intergenic
969917150 4:10502039-10502061 CTCCTGCAGCTTTCTGCCTCTGG + Intronic
970643923 4:18097850-18097872 CACATGCTCTCTTCTGCCTCAGG - Intergenic
971173638 4:24260208-24260230 GACATGCACATTCTTGCCTCCGG - Intergenic
972276839 4:37565499-37565521 CACAGACACCTTCCTCCCCCAGG + Intronic
972335215 4:38101836-38101858 CACATGCACCCTTGTGCCTGAGG + Intronic
973608015 4:52606980-52607002 CACACTCATCTCCCTGCCTCTGG - Intronic
974207767 4:58728657-58728679 CACATTCACCTTCCTCCCACTGG - Intergenic
975006041 4:69287546-69287568 CTCTTTCACCTTCCTGCTTCAGG - Intronic
975858507 4:78650627-78650649 GCCAGGCACTTTCCTGCCTCAGG + Intergenic
977240632 4:94564406-94564428 CACTGGTACATTCCTGCCTCAGG + Intronic
977303794 4:95298489-95298511 CACCAGCACACTCCTGCCTCAGG + Intronic
977452542 4:97217458-97217480 CACAGGCATATTCCTGCTTCAGG - Intronic
978716195 4:111846036-111846058 GTCATGCACCCTCCTTCCTCTGG - Intergenic
982400924 4:154966926-154966948 ACAATTCACCTTCCTGCCTCAGG + Intergenic
983463852 4:168061525-168061547 CTCTTGCATCTTCCAGCCTCTGG + Intergenic
983905012 4:173172740-173172762 CTCATGCTACCTCCTGCCTCAGG - Intronic
986045204 5:4030203-4030225 CCCCTGCACCTTCTTGCCACTGG + Intergenic
986269493 5:6218480-6218502 CACATTCACCTCCCAGCCTCTGG + Intergenic
986482321 5:8202155-8202177 CACATACATCCTCCTGCTTCAGG + Intergenic
989231386 5:39091190-39091212 CACATGTACTTCCCAGCCTCTGG - Intergenic
989450725 5:41583559-41583581 AACATGCAGTTTCCTGCCTTGGG - Intergenic
991292723 5:65048369-65048391 CACTTGCACCCTCCTGCCAGGGG + Intergenic
991994139 5:72370623-72370645 CACCAGCACATTCCTGCTTCAGG + Intergenic
994560753 5:101367846-101367868 CACAGACACCATACTGCCTCTGG + Intergenic
995060869 5:107810455-107810477 CACCTGCACCCTCCTCCTTCAGG - Intergenic
997181936 5:131838558-131838580 CACATACACCTTCCTGAACCAGG - Intronic
998514144 5:142737479-142737501 CCCCAGCACCTTCCTGCCTTGGG - Intergenic
998876269 5:146602986-146603008 CCCATCCACTTTACTGCCTCTGG - Intronic
999102991 5:149042685-149042707 CACACTCACCTTCCTGTATCAGG + Exonic
999143358 5:149377238-149377260 AGCATGCTCCTTCCTGCCACAGG + Intronic
999325391 5:150640554-150640576 CAGATTCATCTTCCTCCCTCCGG - Intronic
999405645 5:151304399-151304421 CCCAGGCACTCTCCTGCCTCAGG - Intergenic
999776379 5:154815701-154815723 CACATATACCTTCCTGCCACAGG - Exonic
1001108696 5:168877357-168877379 CCCAAGCTCCTTCCTGCCCCAGG - Intronic
1001216747 5:169863635-169863657 TGCATGCACCTTTCTGCCTGTGG - Intronic
1002060948 5:176625727-176625749 CACCTGCTCCAACCTGCCTCAGG + Intronic
1002078374 5:176723290-176723312 CAGAGGCACCTTCCTGAGTCTGG - Intergenic
1002304206 5:178273851-178273873 CAGATGCACCTACCTGGCTTGGG + Intronic
1002505868 5:179678820-179678842 CACCTGCGCCTTCCAGCCCCAGG + Exonic
1002710996 5:181195004-181195026 CACAGTCACTCTCCTGCCTCGGG + Exonic
1003118902 6:3304182-3304204 CACACACACCCTCCTGCCTCAGG - Intronic
1004017453 6:11745023-11745045 CACTTTCTCCTTCCTGCCTCTGG + Intronic
1004822465 6:19382523-19382545 AACATTAACCTTCCTACCTCAGG + Intergenic
1005559767 6:27026537-27026559 CCCAAGCTCATTCCTGCCTCAGG + Intergenic
1006798399 6:36744866-36744888 CTCATCCACCTTCTGGCCTCTGG - Intronic
1007170610 6:39860650-39860672 CAAATCCACCCTCCTGCTTCAGG - Intronic
1007606917 6:43124010-43124032 CACATGGAGCTGGCTGCCTCCGG + Intronic
1008671437 6:53773165-53773187 CACACCCAGCTTCCTTCCTCAGG + Intergenic
1010042069 6:71396731-71396753 AATATGCACCTTACTCCCTCTGG - Intergenic
1011696041 6:89913677-89913699 CACATACCCTTTCCAGCCTCTGG + Intergenic
1011769757 6:90662624-90662646 AACATGCACCTTCCTAGCTGAGG - Intergenic
1012249826 6:96967858-96967880 GCCAAGCTCCTTCCTGCCTCAGG - Intronic
1015149207 6:130019799-130019821 CCAAAGCACTTTCCTGCCTCGGG - Intronic
1017100136 6:150841848-150841870 CACATGCACCCTCCTGAGTTTGG + Exonic
1017752715 6:157503252-157503274 CACATGGACCCACCTGCTTCTGG - Intronic
1019190936 6:170250253-170250275 CATGTCCACCCTCCTGCCTCTGG + Intergenic
1020787841 7:12592071-12592093 CACATGGACTGTCCTCCCTCAGG - Intronic
1021121118 7:16796871-16796893 CACATGCTCCTTCCTGCCACTGG - Intronic
1021253231 7:18357754-18357776 GCCATGCTCCTTCCTGACTCAGG - Intronic
1021588534 7:22236481-22236503 CACAAGCATCTTCCTGCTCCTGG + Intronic
1021804690 7:24343399-24343421 CTCATGGCCCTGCCTGCCTCAGG + Intergenic
1022517853 7:30987240-30987262 CACACCCACCTGCCAGCCTCTGG - Intronic
1024107560 7:46108480-46108502 CACTTGCCGATTCCTGCCTCGGG - Intergenic
1028937654 7:96484246-96484268 TACATTCTCCTTCCTGCCTGTGG + Intronic
1030087956 7:105833148-105833170 CATGTTCCCCTTCCTGCCTCAGG + Intronic
1030898495 7:115091605-115091627 CATATTTACCTTCCAGCCTCAGG - Intergenic
1032292158 7:130598238-130598260 CACCTGCACAGTACTGCCTCAGG + Intronic
1034758736 7:153650508-153650530 CATCTGCCCCTCCCTGCCTCAGG + Intergenic
1036013267 8:4751913-4751935 TACATGGATCTTCCTGACTCTGG - Intronic
1036498711 8:9294289-9294311 CGCCTGCACCTTCCTCTCTCTGG + Intergenic
1036773212 8:11592783-11592805 CAAATGCCCCGTCCTGCCTGTGG - Intergenic
1036786611 8:11692211-11692233 CAGTTCCACCTTCCTCCCTCTGG - Intronic
1037740213 8:21602817-21602839 CACATATACCTCCCTGCCTGAGG + Intergenic
1038335439 8:26641857-26641879 CAGCTGCCCCCTCCTGCCTCAGG - Intronic
1039306193 8:36265961-36265983 CAGATGCACCTGACTGGCTCTGG - Intergenic
1039750717 8:40475908-40475930 GACATGCATCCTCCTGCCACAGG + Intergenic
1041275944 8:56157430-56157452 CACCTGGACCCTCCTCCCTCAGG - Intergenic
1041516001 8:58699677-58699699 ACCAGGCTCCTTCCTGCCTCAGG - Intergenic
1041787755 8:61654493-61654515 CACCTTGACCTTCCTGCCGCAGG - Intronic
1042634879 8:70862983-70863005 CTCATGCTCCCTCCTGCCACAGG - Intergenic
1042875625 8:73437985-73438007 GACAAGCTCCCTCCTGCCTCAGG + Intronic
1042953403 8:74223961-74223983 CACAGGCCCCTTCCTGCATGAGG - Intergenic
1043043351 8:75290039-75290061 TACATGCACCCTACTCCCTCTGG - Intergenic
1043346755 8:79307086-79307108 CACATGGACCAGCCTGCCACTGG + Intergenic
1043601270 8:81941210-81941232 CACATTCACCTTGCAGCCTAGGG + Intergenic
1045358728 8:101412668-101412690 CTCATGAACCTTCCTACCTGTGG - Intergenic
1045917647 8:107491613-107491635 GACAGGCTCATTCCTGCCTCAGG - Intronic
1046987988 8:120411713-120411735 CTAATGCATATTCCTGCCTCAGG + Intronic
1047825761 8:128572955-128572977 CACAAGCACTCTCCTGCCTCAGG - Intergenic
1048019914 8:130528460-130528482 CTCATGCACTTTCCTATCTCAGG + Intergenic
1048162231 8:132032023-132032045 CAGATTCACCTTCCTGCACCTGG - Exonic
1048456561 8:134583726-134583748 CAAGTGCTCTTTCCTGCCTCTGG + Intronic
1048721170 8:137327154-137327176 CATATGCCTCTTCCTGTCTCTGG + Intergenic
1049069761 8:140347270-140347292 CCCAGCCACCTGCCTGCCTCAGG + Intronic
1051681358 9:19611196-19611218 CCCAAGCACACTCCTGCCTCAGG - Intronic
1053416698 9:37951377-37951399 AACATGGACCTTCATGTCTCAGG - Intronic
1054743661 9:68833361-68833383 ACCAAGCTCCTTCCTGCCTCAGG - Intronic
1055648162 9:78380289-78380311 CACAAGCTTCTTCCTGACTCTGG - Intergenic
1056212977 9:84382187-84382209 GACAGCCACCCTCCTGCCTCCGG - Intergenic
1056799355 9:89680885-89680907 CACTAGCACCTTCCAACCTCGGG - Intergenic
1057137865 9:92706721-92706743 CACAAGCACATGGCTGCCTCAGG - Intergenic
1057945538 9:99324826-99324848 AACAAGCTCCTTCCTGCCTCAGG - Intergenic
1057981183 9:99665426-99665448 CCCAAGTACTTTCCTGCCTCGGG - Intergenic
1059612572 9:115915101-115915123 GACAGGCATCCTCCTGCCTCAGG + Intergenic
1059854338 9:118378876-118378898 AACATAAAGCTTCCTGCCTCTGG + Intergenic
1059906500 9:118992317-118992339 CTCATGTACTTTCCTGCCTCTGG - Intergenic
1060393747 9:123300960-123300982 CAGATTCACCTTGCTGCCTTAGG - Intergenic
1061009398 9:127946217-127946239 CCCAGGCCCCTTCCAGCCTCGGG - Intronic
1061078552 9:128356324-128356346 CCCAAGCTCCTTCCTGCTTCGGG - Intronic
1061091999 9:128431771-128431793 CCTAAACACCTTCCTGCCTCAGG - Intronic
1061301653 9:129709176-129709198 CACAAGCACCTTCCCACCTCTGG - Intronic
1061328561 9:129878626-129878648 CAGGAGCAGCTTCCTGCCTCTGG - Intronic
1061396593 9:130347011-130347033 GAAATGCTCCTTCCAGCCTCGGG + Intronic
1061724021 9:132571606-132571628 CACGTGCTCATTCCTGCATCTGG - Intronic
1062086000 9:134648848-134648870 AGGATGCACCTTCCTGGCTCAGG - Intronic
1062172081 9:135140433-135140455 CACATGCTCTGTCCTGCCTGGGG + Intergenic
1062176605 9:135166702-135166724 CACTTGCACCTTCTTGCCGCTGG - Intergenic
1185449898 X:276381-276403 CACACTCACCTTCCAGCCGCTGG - Intronic
1185722428 X:2393534-2393556 CACAGGGACCTCCCTGTCTCCGG + Intronic
1186351281 X:8742246-8742268 CACACGCACAATCCTGCCTCAGG + Intergenic
1186846938 X:13540318-13540340 CACATGCCACTGCCTGGCTCGGG - Intergenic
1187204343 X:17168110-17168132 CACATGTATCTTTCTGCCTCAGG + Intergenic
1187791060 X:22950875-22950897 CACATGTACGTCTCTGCCTCAGG + Intergenic
1189301849 X:39957991-39958013 ACCAGGCACATTCCTGCCTCAGG - Intergenic
1189363483 X:40370668-40370690 CAAGTCCACCTTCCTGCTTCTGG - Intergenic
1190216086 X:48480350-48480372 AGCAAGCACCCTCCTGCCTCAGG - Intronic
1190237960 X:48631938-48631960 CTCAGGCACCTTCTGGCCTCCGG + Intergenic
1191134575 X:57049707-57049729 CAAATGCTGCTGCCTGCCTCTGG - Intergenic
1191697261 X:64003056-64003078 CACAGGTGCCTTCCTGCCTTGGG - Intergenic
1191976761 X:66881230-66881252 AACATGTACCCTCCTGCCCCTGG + Intergenic
1192173639 X:68872449-68872471 CACAGGCTCCTTCCCTCCTCTGG - Intergenic
1192197051 X:69035387-69035409 CCCAAGCTCCCTCCTGCCTCTGG + Intergenic
1196841676 X:119865069-119865091 TTTATGCACTTTCCTGCCTCAGG + Intergenic
1197493904 X:127153839-127153861 CACATAAACCTTCCTCCATCTGG - Intergenic
1200337284 X:155363629-155363651 CTCTTGCAATTTCCTGCCTCTGG - Intergenic
1200349186 X:155477598-155477620 CTCTTGCAATTTCCTGCCTCTGG + Intergenic