ID: 902929109

View in Genome Browser
Species Human (GRCh38)
Location 1:19717798-19717820
Sequence AACCAAATGCTGCATCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902929109_902929111 3 Left 902929109 1:19717798-19717820 CCCTTGAGATGCAGCATTTGGTT 0: 1
1: 0
2: 3
3: 15
4: 203
Right 902929111 1:19717824-19717846 TTATTCACCTGCTTTAAGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 142
902929109_902929114 24 Left 902929109 1:19717798-19717820 CCCTTGAGATGCAGCATTTGGTT 0: 1
1: 0
2: 3
3: 15
4: 203
Right 902929114 1:19717845-19717867 GGCATCTTATTTTCTTAACTAGG 0: 1
1: 0
2: 0
3: 16
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902929109 Original CRISPR AACCAAATGCTGCATCTCAA GGG (reversed) Intronic
900433795 1:2616910-2616932 CACCAGATGCTGCAGATCAAGGG + Intronic
901369026 1:8780376-8780398 GATCAAATGCTGCATCCCAGTGG + Intronic
902929109 1:19717798-19717820 AACCAAATGCTGCATCTCAAGGG - Intronic
907533819 1:55129070-55129092 AACCATCAGCTGCCTCTCAAAGG + Intronic
909339984 1:74520775-74520797 ACCCACATGTTGCAACTCAAAGG - Intronic
910003670 1:82367839-82367861 AACCAGAAGCTGTTTCTCAAAGG + Intergenic
912885422 1:113467014-113467036 AACCTAATGATACATCTTAAGGG - Intronic
914730457 1:150364997-150365019 AACCAAATGCTGCGGCTCCGTGG - Intronic
915787689 1:158634061-158634083 AACCCAATCCTGCATTTAAAAGG + Intronic
916627642 1:166575585-166575607 AAGCATTTGCTGCATTTCAAAGG - Intergenic
917165882 1:172112589-172112611 AACCAATTCCTGAATGTCAAAGG + Intronic
918193139 1:182195746-182195768 AACCAAATGCAGGAACTCAGTGG - Intergenic
918676841 1:187296961-187296983 AACAAAAAGTTGCATCTCATTGG + Intergenic
918683142 1:187380067-187380089 AACCAAATTCTGTTGCTCAAAGG + Intergenic
920459209 1:206126119-206126141 AACCAAAAGTTGGATCTTAAGGG + Intergenic
921664481 1:217851447-217851469 AATCAAATGCTGTTTCTAAAAGG - Intronic
922919362 1:229288569-229288591 AACTAAATGCATCTTCTCAATGG + Intronic
924841459 1:247713993-247714015 AACCATAGGCTGCATGTCAAGGG - Intergenic
1065619866 10:27569860-27569882 ACCCAATTACTGCAACTCAAAGG + Intergenic
1067479276 10:46584804-46584826 AACCCAAAGCTGCATCTCCTTGG + Intronic
1067615463 10:47756997-47757019 AACCCAAAGCTGCATCTCCTTGG - Intergenic
1067821255 10:49532677-49532699 ACCCAAACCCTGCAGCTCAAGGG + Exonic
1068069435 10:52178068-52178090 AATGTAATGATGCATCTCAAGGG - Intronic
1068741546 10:60478743-60478765 AACCAAATGGAGCATCTTAGTGG + Intronic
1069093576 10:64230435-64230457 AACCTAACGGTGCACCTCAAAGG + Intergenic
1069649347 10:70033317-70033339 AGCAAAAGGCTGTATCTCAAGGG + Intergenic
1070211445 10:74327103-74327125 AACCTAATGTTGCGCCTCAAGGG - Intronic
1070640035 10:78161675-78161697 AACCAAATGCTGTAACTGGATGG + Intergenic
1071006986 10:80894759-80894781 AAACAAATACTACATCTTAAAGG + Intergenic
1072363197 10:94680880-94680902 AACAAAATACTGAATCTCCAAGG + Intergenic
1072424863 10:95321381-95321403 AACCATATGCTGCAGCTACACGG + Intronic
1072787258 10:98292726-98292748 AATGACATGGTGCATCTCAAAGG + Intergenic
1075947453 10:126448443-126448465 AACCTACTGCTACACCTCAAGGG + Intronic
1075964069 10:126595333-126595355 AAGCACATTCTGCATCTCAGTGG - Intronic
1076041742 10:127255612-127255634 AACAAAATGCTGCATCTAGTGGG - Intronic
1078630710 11:13001309-13001331 AACCCACTACTGTATCTCAAGGG - Intergenic
1081757021 11:45552091-45552113 CACGAAATGCTACAGCTCAAAGG + Intergenic
1082074088 11:47962813-47962835 AACCAAATCCTAATTCTCAAAGG - Intergenic
1089808594 11:121113696-121113718 AGCCAATGGCTGCACCTCAAGGG + Exonic
1094029603 12:25995934-25995956 AACTAGATGCTGGATCTCGAAGG + Intronic
1097301767 12:58026718-58026740 AAAAAAATGCAGCATCTCTAGGG + Intergenic
1097673293 12:62567984-62568006 CATTAAATGCTGTATCTCAATGG - Intronic
1100669359 12:96793937-96793959 AAACAAATGCTGAATCTACAAGG - Intronic
1100906751 12:99309532-99309554 AATCAAGTGGTGCATCTTAATGG + Intronic
1100920784 12:99484069-99484091 AACCTTATGTTGTATCTCAAGGG - Intronic
1102109510 12:110354216-110354238 AACAAAATGCTGCATATAGATGG + Intergenic
1103553451 12:121751824-121751846 AACCAACTGCTGCTGCTGAAAGG - Intronic
1105237414 13:18571230-18571252 ACACACATTCTGCATCTCAAAGG + Intergenic
1105892434 13:24691081-24691103 AACAAAGTGCTCGATCTCAATGG - Exonic
1106075061 13:26452127-26452149 AACCTAATGATACATCTTAAAGG + Intergenic
1106920490 13:34558062-34558084 AACCAAAAATAGCATCTCAATGG - Intergenic
1106927149 13:34624816-34624838 AAGCAAAAACTGCTTCTCAAAGG + Intergenic
1108978224 13:56476421-56476443 AATCAAATTCTGTATTTCAAAGG + Intergenic
1109155881 13:58908425-58908447 AAACAAATTCTACTTCTCAATGG + Intergenic
1110910347 13:80953541-80953563 AACCAAATACTGCATGTTAGTGG + Intergenic
1112171695 13:96979075-96979097 AACCAAATGCTGGATTTAATAGG + Intergenic
1114072376 14:19123758-19123780 AATCAAATGCTGCATCTTAAAGG - Intergenic
1114089883 14:19276215-19276237 AATCAAATGCTGCATCTTAAAGG + Intergenic
1115880857 14:37916568-37916590 AGCCAAATGATGCTTCTTAATGG - Intronic
1117482770 14:56165099-56165121 AATCTAATGATGCATCTTAAAGG - Intronic
1120472309 14:84941030-84941052 AACCAAAAGTTGCCTCTAAAAGG - Intergenic
1120936975 14:89906649-89906671 AACAAAATCTTTCATCTCAAAGG - Intronic
1121332395 14:93057894-93057916 CACCACATGCTGTCTCTCAAGGG + Intronic
1121930200 14:97965102-97965124 AATCAGATGCGGCATCTCCAGGG - Intronic
1123195624 14:106613404-106613426 CACCTATTGCTGCATCACAAGGG - Intergenic
1124972809 15:34506326-34506348 AAAAAAATGCTGGATCTCACTGG - Intergenic
1126469687 15:48995207-48995229 AGTGAAATGCCGCATCTCAAAGG - Intronic
1127894822 15:63287978-63288000 ATCCAAATGATGCAGCTAAAAGG + Intronic
1130179453 15:81610289-81610311 AATCAAATGCTGCACCTAATGGG + Intergenic
1131314921 15:91327550-91327572 AACCTAATAATGCATCTTAAGGG - Intergenic
1133832410 16:9335609-9335631 AACAAAATGAGGCATCTCAAAGG - Intergenic
1134399783 16:13899264-13899286 AACAAAATGGTGCACATCAATGG - Intergenic
1137819964 16:51434897-51434919 TACCAAATGAGGCTTCTCAACGG - Intergenic
1140735261 16:77892540-77892562 AACCAAATCCTTCCTCTCCAGGG - Intronic
1144390278 17:14786743-14786765 AACCAAAAGTTGCATCTAAAGGG + Intergenic
1145247173 17:21276902-21276924 AACCAAATTCTGCATGTCGAGGG - Intergenic
1150170027 17:62984531-62984553 AACTTAAGGATGCATCTCAAAGG - Intergenic
1155353656 18:24930151-24930173 AACCAAAGCCTGCATAGCAACGG + Intergenic
1155457019 18:26028528-26028550 ACCCAAATGTCCCATCTCAATGG + Intronic
1155857357 18:30850225-30850247 AGCCAAATGGTCTATCTCAATGG - Intergenic
1156665769 18:39404734-39404756 AAACATATGCTGCAGCTCAGTGG + Intergenic
1158115332 18:53989412-53989434 AACCAAATACCGAAACTCAATGG + Intergenic
1158324974 18:56303764-56303786 CACCAAATCCTGCCTCTCATTGG - Intergenic
1159141918 18:64407237-64407259 AAGAACATGCTGCATCTCTAAGG + Intergenic
1160141436 18:76327301-76327323 AACCAATTTCTGCATTTCAGTGG - Intergenic
1164023860 19:21332388-21332410 AAACAGATTCTGGATCTCAATGG + Intergenic
1164049441 19:21571660-21571682 AAACAGATTCTGTATCTCAATGG + Intergenic
1164182380 19:22831123-22831145 AAACAGATTCTGTATCTCAATGG - Intergenic
925796448 2:7549875-7549897 AGCCAAATGTATCATCTCAAGGG - Intergenic
925947263 2:8877235-8877257 AAGCTTATGCTGCATCTCACTGG - Intronic
927730200 2:25464349-25464371 AACAAAAGGCAGCATGTCAAAGG + Intronic
928282974 2:29964862-29964884 AACAAAATACTGCATGTAAATGG - Intergenic
929634691 2:43506172-43506194 AACTAACTGCTTCATCTCCAGGG - Intronic
930337322 2:50065650-50065672 AACAAAATACTGCTTCTCACTGG - Intronic
931915704 2:66952710-66952732 AACCAAATGGTAAATCTCAGAGG - Intergenic
935676628 2:105600029-105600051 TAACAAATGCTGGATCTTAATGG + Intergenic
935924839 2:108056117-108056139 GACCAACTGCTGAATCTGAAGGG + Intergenic
938512360 2:131963268-131963290 ACACACATTCTGCATCTCAAAGG - Intergenic
939435404 2:142170535-142170557 AAAGAATAGCTGCATCTCAATGG + Intergenic
939679914 2:145117567-145117589 AATGCAATGCTACATCTCAATGG + Intergenic
943483363 2:188450009-188450031 AACCAAATGCTTCATACCTATGG + Intronic
944031183 2:195236635-195236657 AACCAAATTCAGCATCAGAAAGG + Intergenic
944064576 2:195605267-195605289 AACCATATGCGGCATCTTCAAGG - Intronic
945008869 2:205440550-205440572 AACCAAATGGTCCAGCTCGAGGG - Exonic
948123016 2:235544696-235544718 AAACCAATGCTGCCTCTCACAGG + Intronic
948678474 2:239613066-239613088 AACCAATGGCTAAATCTCAAAGG - Intergenic
1169498085 20:6133729-6133751 CACCAACTGCTGTATCTCATTGG - Intergenic
1170187385 20:13606057-13606079 CACCAAACTCAGCATCTCAAAGG - Intronic
1174774807 20:53333877-53333899 GACAAAAGCCTGCATCTCAAGGG + Intronic
1174871363 20:54185897-54185919 AATCAAATGCCGGATGTCAATGG + Intergenic
1176258021 20:64163078-64163100 AACCAAAAGCTTCACCCCAAAGG - Intronic
1176781403 21:13199508-13199530 ACACACATTCTGCATCTCAAAGG + Intergenic
1177198445 21:17927765-17927787 GACCAAATGCTCCAACTCTATGG - Intronic
1177364911 21:20122259-20122281 AAACAAATGCTTCATATGAAAGG - Intergenic
1177389857 21:20454008-20454030 AACTAACTGCTGTATCTCCAGGG - Intergenic
1177497298 21:21906228-21906250 CCCTAAATGCTGCATCTCAAAGG - Intergenic
1177979099 21:27888657-27888679 ACACACATTCTGCATCTCAAAGG + Intergenic
1180490821 22:15846132-15846154 AATCAAATGCTGCATCTTAAAGG - Intergenic
1182164279 22:28156872-28156894 AATCTAATGATGCATCTTAAAGG + Intronic
1182500278 22:30741640-30741662 AACCCACTGCAGCATCTGAAGGG - Intronic
1183644656 22:39117522-39117544 AACCGAAGGCTTCTTCTCAAAGG + Intergenic
949857249 3:8472966-8472988 AACCAAATTCTGCATTTCTCAGG - Intergenic
950502438 3:13372942-13372964 GACCTCATGCTTCATCTCAAGGG + Intronic
950714202 3:14836273-14836295 AACCAGATGCAGCATCTACAAGG - Intronic
951625626 3:24659852-24659874 AACCTAACAATGCATCTCAAGGG - Intergenic
952167062 3:30761866-30761888 ACACAAATGCTGCATTTCACAGG + Intronic
952261667 3:31746372-31746394 GACCAGATGCTGCATGCCAATGG + Intronic
952614297 3:35250810-35250832 AAATAAATGCTGCATAGCAAAGG + Intergenic
954990410 3:54836186-54836208 AATCACATGCTGTATTTCAAGGG + Intronic
955133566 3:56193824-56193846 GCCCAAATGCTGGATCTCATAGG + Intronic
955491455 3:59487344-59487366 CCCCAAATGCTTCATATCAAAGG + Intergenic
955766859 3:62353974-62353996 ATCCAAAAGCTGCATTTCAAGGG - Intergenic
957433557 3:80145916-80145938 AACCTAATGATGCATCTTAAAGG - Intergenic
961533595 3:127555583-127555605 AAACAAATACAGCATCACAAAGG + Intergenic
961833194 3:129635267-129635289 TACCAAAGGCTGCATCTCCCTGG - Intergenic
962888585 3:139651601-139651623 AACCAAAGGGTGTATCTCAAAGG + Intronic
962926378 3:139997430-139997452 AACCAAATTTTGCAGCTCCATGG + Intronic
963788739 3:149561667-149561689 AACCAAGTACAGTATCTCAACGG + Intronic
963806702 3:149729835-149729857 AACCAATTGCTGCATTTAAGAGG - Intronic
965978787 3:174660558-174660580 AACAATATGCTGCATCTCTGAGG + Intronic
966694370 3:182775040-182775062 AACCTAAAGATGCATCTCAAGGG - Intergenic
966802086 3:183773805-183773827 AACCAAATGATTCAACCCAATGG - Intronic
971587957 4:28429857-28429879 AACCAAATTATGCACCACAAGGG - Intergenic
973165768 4:47076076-47076098 AGACAAAAGCTGCATCTCATTGG - Intronic
974469948 4:62305831-62305853 AACTTAATGATGCATCTTAATGG + Intergenic
974670067 4:65018485-65018507 AAGTAAATGTTGCATCTAAATGG + Intergenic
975275193 4:72489611-72489633 AACCTAACACTACATCTCAATGG + Intronic
980245216 4:130230166-130230188 AGCCAAAAGCTGTTTCTCAAAGG + Intergenic
983142633 4:164171735-164171757 ATCCAAATGCCTCATCTCATTGG + Intronic
983502823 4:168519190-168519212 AATCACGTGCTTCATCTCAAAGG - Intronic
983755938 4:171335947-171335969 AACCTAACACTGCATCTTAAAGG + Intergenic
987459628 5:18192629-18192651 AACCATATGCTCCCTCTGAAGGG + Intergenic
987474906 5:18379002-18379024 AAGGAAATGCTCCCTCTCAATGG + Intergenic
989589817 5:43102908-43102930 ACACAGATGCTGCATCCCAATGG - Intronic
990781158 5:59365017-59365039 AACCAAAAACTGAAACTCAAGGG + Intronic
993292636 5:86095133-86095155 GAACAAATCCTGAATCTCAATGG + Intergenic
994249734 5:97521843-97521865 CACCCAATGCAGCATCCCAAGGG - Intergenic
995710004 5:115025733-115025755 AACCAAATGCAGGAAGTCAATGG + Intergenic
998781159 5:145658374-145658396 CATCACATGTTGCATCTCAATGG - Intronic
999394541 5:151218908-151218930 CACCAAAGGTTGTATCTCAAAGG + Intronic
999837537 5:155390749-155390771 AAGCAAATGTTGACTCTCAAAGG - Intergenic
1001017948 5:168158471-168158493 AACCAAATCTTGGATCTCATGGG + Intronic
1001136291 5:169105245-169105267 AACCAAATGATGTGTCTCCAGGG - Intronic
1003288295 6:4754484-4754506 ACCCAAATGATACAGCTCAACGG - Intronic
1004747969 6:18531383-18531405 AACCAAGTTCTTTATCTCAAAGG + Intergenic
1005278415 6:24244533-24244555 AAACAAATTCTGCATCTGGAAGG + Intronic
1005369064 6:25111356-25111378 AACGAAATCCTGCATTTTAAAGG + Intergenic
1005485401 6:26294657-26294679 AGCCAAATGCTTTATATCAAAGG + Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1009593556 6:65706859-65706881 CCCCAAATCCTGTATCTCAAAGG + Intronic
1011948104 6:92932834-92932856 AAAAAAATGATGAATCTCAAAGG + Intergenic
1012030215 6:94050727-94050749 AGCAAATAGCTGCATCTCAATGG + Intergenic
1015175716 6:130305956-130305978 AACCAAAAGCTGGCTCTCACTGG - Intronic
1018356604 6:163023955-163023977 AACAAAATGCAGAATCTCTAGGG - Intronic
1021217055 7:17929367-17929389 AAGCAACTGCTGCATATAAAGGG + Intronic
1023694048 7:42826330-42826352 ATTCAGATGCTGCATCTCTAAGG + Intergenic
1023726193 7:43144638-43144660 CACAAAATGCAGCATATCAAAGG - Intronic
1024550234 7:50556655-50556677 AATCAAATCCATCATCTCAAGGG + Intronic
1025848338 7:65220120-65220142 AAACAGATTCTGGATCTCAATGG + Intergenic
1025864809 7:65371532-65371554 AAACAGATTCTGGATCTCAATGG - Intergenic
1027391652 7:77709709-77709731 AACCAAATGCTGAAACTTAGTGG - Intronic
1028238616 7:88391673-88391695 AACTATATGCTACATCTCATTGG + Intergenic
1030058234 7:105601881-105601903 AACCAAATGCTGCTGCAAAATGG - Intergenic
1031791093 7:126105829-126105851 AACCAAATGTCCCACCTCAAGGG + Intergenic
1032325829 7:130927335-130927357 AGACAAAAGCTGCATCTCCAAGG - Intergenic
1032967822 7:137121387-137121409 AACCACATGCTGGCTCTTAATGG + Intergenic
1035709911 8:1705301-1705323 AAACAAAAGCTGCATCTCCCAGG - Exonic
1037707519 8:21327615-21327637 ATCCAAAATCTGCATCTCAAAGG - Intergenic
1038023976 8:23572889-23572911 CGCCAAATGCTGCCTATCAAGGG - Exonic
1039422245 8:37452962-37452984 AATCAATTTCTGCCTCTCAAGGG + Intergenic
1040787970 8:51189169-51189191 AACCAAATGCAGCAAATCTAAGG - Intergenic
1041186543 8:55306833-55306855 CACCAATTGCTCCATCTCCAAGG - Intronic
1043544415 8:81299336-81299358 AATCAAATTCTGAAGCTCAAGGG + Intergenic
1043661253 8:82745046-82745068 AACCAACTAGTGGATCTCAAGGG + Intergenic
1043868704 8:85404797-85404819 AAGCAGATGCTGCATGTCAAAGG + Intronic
1044488397 8:92781809-92781831 TACTAAATGCTGCATTTCACAGG + Intergenic
1049916759 9:325049-325071 AACCAAATGCTGTATGTTAGTGG - Intronic
1051366001 9:16321893-16321915 AACCAAATGCTCCACCTCCTGGG + Intergenic
1051500210 9:17768533-17768555 CACCACATGCTGGATCTTAAAGG - Intronic
1053370538 9:37557956-37557978 GACCAACTGCTGCATCTGAAAGG + Intronic
1055776611 9:79772908-79772930 AACCAAATTCTGAATATCCATGG - Intergenic
1056999589 9:91495299-91495321 AACGAAATGCTTCCTCTCACAGG + Intergenic
1057436353 9:95044539-95044561 AAGCAAATTCTGCATCTGGAAGG + Intronic
1057823202 9:98350314-98350336 AACCTAATGATGCACCTCAAGGG - Intronic
1057903377 9:98966329-98966351 AACCCAATGCTGCACCCCCATGG + Intronic
1058242047 9:102576387-102576409 CACCAAAGGCTGCATCTCCCTGG - Intergenic
1059578338 9:115516466-115516488 AACCATATACAACATCTCAATGG - Intergenic
1059639350 9:116201565-116201587 AACAGAATTCTGCATCTCGAGGG + Intronic
1187300738 X:18047090-18047112 AAACAAATGCTGGATTTCAAAGG - Intergenic
1187546955 X:20265111-20265133 AACTAAATGCTGCTCTTCAATGG - Intronic
1187581071 X:20608093-20608115 AATCAAAAGAAGCATCTCAAGGG - Intergenic
1188817565 X:34734011-34734033 AACAAAATGCTGAATTTGAAAGG - Intergenic
1189584340 X:42442622-42442644 AACAAAATGGTGCATGTCTAAGG - Intergenic
1192766086 X:74140811-74140833 AACCAAATGGTGACTCTCAGTGG + Intergenic
1194226220 X:91261910-91261932 AACCAAATCCAGCATCACATCGG - Intergenic
1194673216 X:96761325-96761347 AAACCAATGCTGCCTCTCAATGG - Intronic
1194929662 X:99870647-99870669 AACCTAATAATGCATCTTAAAGG + Intergenic
1195375234 X:104220344-104220366 TACCAAAGGCTGCATCTCCCTGG - Intergenic
1195759461 X:108230222-108230244 CACCAAATACTGCATCTCCGGGG - Intronic
1198154332 X:133943871-133943893 AAACAGATGTTCCATCTCAATGG + Intronic
1198985964 X:142454200-142454222 AAACATATACTGCTTCTCAATGG + Intergenic
1200883887 Y:8250125-8250147 AAACAATTACTGCATCTTAATGG + Intergenic