ID: 902929467 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:19720519-19720541 |
| Sequence | GGACCCAGAGAAAAACAAAT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 390 | |||
| Summary | {0: 1, 1: 1, 2: 2, 3: 45, 4: 341} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 902929467_902929470 | 16 | Left | 902929467 | 1:19720519-19720541 | CCTATTTGTTTTTCTCTGGGTCC | 0: 1 1: 1 2: 2 3: 45 4: 341 |
||
| Right | 902929470 | 1:19720558-19720580 | CCCATAAGTTGTTGCTTTAGTGG | 0: 1 1: 0 2: 0 3: 5 4: 102 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 902929467 | Original CRISPR | GGACCCAGAGAAAAACAAAT AGG (reversed) | Intronic | ||