ID: 902929470

View in Genome Browser
Species Human (GRCh38)
Location 1:19720558-19720580
Sequence CCCATAAGTTGTTGCTTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902929464_902929470 22 Left 902929464 1:19720513-19720535 CCTGTTCCTATTTGTTTTTCTCT 0: 1
1: 0
2: 5
3: 89
4: 1226
Right 902929470 1:19720558-19720580 CCCATAAGTTGTTGCTTTAGTGG 0: 1
1: 0
2: 0
3: 5
4: 102
902929468_902929470 -5 Left 902929468 1:19720540-19720562 CCTAATGTTTTATATTTGCCCAT 0: 1
1: 0
2: 6
3: 24
4: 397
Right 902929470 1:19720558-19720580 CCCATAAGTTGTTGCTTTAGTGG 0: 1
1: 0
2: 0
3: 5
4: 102
902929467_902929470 16 Left 902929467 1:19720519-19720541 CCTATTTGTTTTTCTCTGGGTCC 0: 1
1: 1
2: 2
3: 45
4: 341
Right 902929470 1:19720558-19720580 CCCATAAGTTGTTGCTTTAGTGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902929470 Original CRISPR CCCATAAGTTGTTGCTTTAG TGG Intronic