ID: 902929679

View in Genome Browser
Species Human (GRCh38)
Location 1:19722193-19722215
Sequence TCTTTTGGAACCCTGAGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902929677_902929679 -6 Left 902929677 1:19722176-19722198 CCAGACGATTTCAAACGTCTTTT 0: 1
1: 0
2: 1
3: 7
4: 81
Right 902929679 1:19722193-19722215 TCTTTTGGAACCCTGAGTCTAGG 0: 1
1: 0
2: 0
3: 12
4: 185
902929676_902929679 21 Left 902929676 1:19722149-19722171 CCTGTACAGTGTGGAGGTTTGTT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 902929679 1:19722193-19722215 TCTTTTGGAACCCTGAGTCTAGG 0: 1
1: 0
2: 0
3: 12
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902929679 Original CRISPR TCTTTTGGAACCCTGAGTCT AGG Intronic
901918624 1:12519771-12519793 CCTTTTGGAGCCCTGAGGCAGGG + Intergenic
902929679 1:19722193-19722215 TCTTTTGGAACCCTGAGTCTAGG + Intronic
903604454 1:24565362-24565384 GATATTGGAACCCAGAGTCTGGG + Intronic
905303549 1:37002073-37002095 TCTTTTGCAGTCCTGAGGCTGGG - Intronic
907571442 1:55487705-55487727 TCTCTTGGAACGCTCATTCTTGG + Intergenic
908484664 1:64578783-64578805 TCTCTTGGAACGCTTACTCTTGG - Intronic
909199004 1:72664776-72664798 TCTTTTGGAAGCCTGAAAATTGG + Intergenic
909898390 1:81102963-81102985 TCTTTTAGAATACTGAATCTAGG - Intergenic
910991634 1:93062569-93062591 TCTTTTGGAACACTCTCTCTGGG - Intergenic
911436413 1:97864899-97864921 TGTTTTTGAAGCCTGATTCTAGG + Intronic
912264935 1:108147910-108147932 TCTGTTGGACCACTGACTCTAGG + Intronic
914877496 1:151523066-151523088 TCTCTTGGATCCCTCACTCTGGG - Intronic
917375167 1:174344417-174344439 TCTTTAGGGACCTTGTGTCTAGG + Intronic
917537447 1:175884633-175884655 TCTTTTAGCACCATGAGTGTGGG - Intergenic
919136412 1:193513277-193513299 TCTCTTGGAACACTGATTCAGGG + Intergenic
919673703 1:200361005-200361027 GCTTTTGTACCTCTGAGTCTGGG + Intergenic
920048386 1:203148548-203148570 TGTTTTGTCACCCTGAGCCTTGG + Intronic
923537732 1:234865927-234865949 TCTCTTGGAACACTTACTCTGGG - Intergenic
924328091 1:242915682-242915704 CTTTTTGGGACCCTGAGTCATGG + Intergenic
1062940741 10:1418968-1418990 TCACTTGGAACCCTGGATCTTGG + Intronic
1063216950 10:3933291-3933313 TGTATTGGAACCCAGAGTGTAGG - Intergenic
1067385613 10:45815572-45815594 TCTTTTTGTCCCCTGACTCTTGG + Exonic
1068220323 10:54036324-54036346 TCCTTTGAAACCTTGAATCTAGG - Intronic
1071610159 10:87024566-87024588 TCTTTTTGTCCCCTGACTCTTGG - Exonic
1072745528 10:97936515-97936537 CCTCATGGAACCCTGAGTGTTGG + Intronic
1073074727 10:100816707-100816729 GCTTTTGCAACCCTGAGCTTTGG + Intronic
1075686069 10:124366016-124366038 TCTTTTGGGACTCTAAGTTTTGG - Intergenic
1077848154 11:6047663-6047685 TCTTTTGGACCCTTAAGTTTGGG - Intergenic
1078612199 11:12830399-12830421 TCTTTAGGCAGCTTGAGTCTTGG + Intronic
1080055712 11:27904413-27904435 TCTTTTGGAACATTCACTCTTGG + Intergenic
1081408276 11:42723857-42723879 TATTTTGGAAAACTGAGTCCAGG + Intergenic
1083280837 11:61626563-61626585 TGTTCTGGAGACCTGAGTCTTGG - Intergenic
1089418281 11:118312010-118312032 CATTTAGGAACCCCGAGTCTTGG - Intronic
1089596839 11:119585850-119585872 CCTTTTGAGAGCCTGAGTCTGGG - Intergenic
1089714624 11:120346330-120346352 TATTTTGGAACCCTGGCTCAAGG + Intronic
1090267930 11:125365557-125365579 TCTTTTGGATCCCTGTTTCACGG + Intronic
1094403843 12:30093517-30093539 TCATTTGGATCACTGACTCTAGG + Intergenic
1094467399 12:30768048-30768070 CCTTATGGAACCCAGGGTCTGGG + Intergenic
1097153792 12:56997982-56998004 GCTTTTTGAACCAGGAGTCTGGG + Intergenic
1097181407 12:57174045-57174067 TCTTTGGGGGACCTGAGTCTAGG + Intronic
1102882362 12:116495408-116495430 TCTTTTGGATCACTCATTCTGGG - Intergenic
1103184024 12:118940608-118940630 TCTCTTGGATCACTTAGTCTGGG - Intergenic
1103279072 12:119739788-119739810 ACTTATGGAACACTGAGTCATGG - Intronic
1108688561 13:52842528-52842550 TCTTTCGGAACCCACGGTCTGGG + Intergenic
1110647616 13:77906523-77906545 TCTCTTGGAACACTTATTCTGGG + Intronic
1110770890 13:79344322-79344344 TATTTTTGATCCCTGATTCTAGG - Exonic
1111232957 13:85368345-85368367 TCTTTTGGAAACTTCACTCTGGG - Intergenic
1120903654 14:89599791-89599813 TCATTGAGAACCCTGAGTCTAGG - Intronic
1121619261 14:95334971-95334993 TCTTGTGGGACCCTGCTTCTTGG + Intergenic
1123897160 15:24840617-24840639 TCTTCTGGCACCCAGAGTCAAGG - Intronic
1124028234 15:25986696-25986718 TCTTTTGCAACGCAGTGTCTCGG - Intergenic
1124552722 15:30696449-30696471 GCTTTTCCAGCCCTGAGTCTTGG + Intronic
1124678520 15:31709221-31709243 GCTTTTCCAGCCCTGAGTCTTGG - Intronic
1126402215 15:48283744-48283766 TGTTTTGTAACACTGAATCTAGG + Intronic
1128288806 15:66461007-66461029 TCTAATGGAAACCTGAGGCTGGG + Intronic
1129787367 15:78318769-78318791 TGTATTGGAACCCTGGGTCCAGG + Intergenic
1130053447 15:80502929-80502951 TCTTTTGTAATCCTGTCTCTGGG - Intronic
1131021877 15:89106011-89106033 TCTTTTAAAACCCAGAGTATTGG + Intronic
1133431605 16:5741990-5742012 TCTTTTGGCACCCTGAGACCTGG + Intergenic
1134092729 16:11400089-11400111 TCTTTGGAAATGCTGAGTCTGGG - Intronic
1134283172 16:12836000-12836022 TCTGTTGGAATCCTGAGCCTAGG - Intergenic
1135245992 16:20857610-20857632 TCTTTTTAAAACCTCAGTCTGGG + Exonic
1138217429 16:55216646-55216668 TCTTCTGGAACCCTAAGATTTGG + Intergenic
1139162516 16:64528159-64528181 TCTTTTGGAATTCTTACTCTGGG + Intergenic
1140173904 16:72636467-72636489 GATTTTGGACCCTTGAGTCTTGG - Intergenic
1140973380 16:80035476-80035498 TCAGTTGGAACCTTGAGGCTGGG + Intergenic
1142242391 16:88953501-88953523 ACTCTTGGGACCCTGAGTGTGGG + Intronic
1142416333 16:89945049-89945071 TCCTTCTGACCCCTGAGTCTTGG + Intergenic
1144039008 17:11391904-11391926 TCTTCTGCCACTCTGAGTCTTGG + Intronic
1144256057 17:13469878-13469900 TCTTCAGAAACCCTGTGTCTGGG - Intergenic
1148612018 17:48970950-48970972 TCCCTGGGAACCCTGAGTCTGGG + Intergenic
1149306042 17:55347425-55347447 TCCTTGAGAACCCTAAGTCTGGG + Intergenic
1150519142 17:65848257-65848279 TCTTTTGAAACCCTGTTTCTGGG + Intronic
1150921570 17:69489496-69489518 TCTTTTGACACCCTGAGTTATGG + Intronic
1150926887 17:69541724-69541746 TCTTTTGTAAAACTGATTCTTGG + Exonic
1151645817 17:75430790-75430812 TCTTGTTGGACCCTGAGTTTAGG - Intergenic
1152378314 17:79929802-79929824 ACTTTTGGGACTCTGAGGCTCGG + Intergenic
1152626674 17:81390798-81390820 TCCTCTGGAACACTGATTCTGGG + Intergenic
1153874263 18:9352557-9352579 CTGTTTGCAACCCTGAGTCTCGG - Intronic
1154327561 18:13402544-13402566 TCTTTTGGGATGCTGAATCTGGG + Intronic
1155427790 18:25724311-25724333 TCTTTTGAAACACTCATTCTTGG + Intergenic
1156858304 18:41808540-41808562 TCTTTTGCACCCATCAGTCTTGG + Intergenic
1157023251 18:43812397-43812419 TCTGTTGCAACCCAGTGTCTCGG + Intergenic
1158503502 18:58025205-58025227 GCTTTTGAGAACCTGAGTCTAGG + Intergenic
1164645600 19:29856761-29856783 TCCTTTGGGACCCTGAGGCCTGG - Intergenic
926731306 2:16037747-16037769 CCTTTTTGTGCCCTGAGTCTTGG + Intergenic
927570259 2:24153144-24153166 CTTTTTGGGTCCCTGAGTCTGGG - Intronic
933115488 2:78464637-78464659 TCTTCTGTAAACCAGAGTCTGGG + Intergenic
933254690 2:80067739-80067761 TCTTCTGGATCCCTCACTCTGGG + Intronic
935209729 2:100928914-100928936 TCTTTTGGGAGACAGAGTCTTGG + Intronic
937354553 2:121190009-121190031 TCTCTGGGACACCTGAGTCTTGG - Intergenic
938952639 2:136269534-136269556 TCTTTAGGAATGCTGAGTATTGG + Intergenic
941635770 2:167933524-167933546 TCTTTTAAAACCCTCATTCTGGG + Intergenic
942661907 2:178274335-178274357 TCTCTTGCAAACTTGAGTCTTGG + Intronic
943645616 2:190406264-190406286 TGTTTGGGACCCCAGAGTCTGGG + Intergenic
944479083 2:200136646-200136668 TCTTCTGCAACCCGAAGTCTTGG - Intergenic
946050085 2:216855275-216855297 ACTTCTGGAACACTGAGTTTAGG + Intergenic
946940186 2:224762019-224762041 GCTTTTAGAACCCTGAATGTTGG - Intergenic
948545814 2:238727962-238727984 TCCTTTGGAAGCATGAGGCTGGG + Intergenic
1168899109 20:1345200-1345222 TCTTTTGGATCACTGGATCTGGG + Intronic
1168932796 20:1637528-1637550 AATTTGGGAACCCTGAGTCATGG - Intronic
1169310444 20:4533820-4533842 TCTTTTGGAAAACTCAGTTTTGG - Intergenic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1172033259 20:31995913-31995935 TCTTTTGGGACACTGAGGATGGG - Intronic
1172684974 20:36746541-36746563 TAATTCGGAGCCCTGAGTCTTGG - Intergenic
1173028540 20:39332658-39332680 TCTCTTGGAACACTCATTCTTGG + Intergenic
1175300279 20:57938029-57938051 TCTTGTGGATGCCTGAGTGTTGG - Intergenic
1178580687 21:33835628-33835650 TCTTTTGAAACACTGATTTTAGG + Intronic
1179442238 21:41403420-41403442 TCATTTGGAACCATGAGGCCAGG + Intronic
1182353838 22:29713321-29713343 CCTGATGGGACCCTGAGTCTAGG + Intergenic
1182642586 22:31780408-31780430 TCTTTTGGATGCCTGAGTGGAGG + Intronic
949262214 3:2115957-2115979 ACTTTGGGAACCATGAGTCTTGG + Intronic
950032608 3:9862587-9862609 TCCTTTGGATCCCTGGGTTTTGG - Intergenic
950413786 3:12856580-12856602 TCCTTTGGAGCCCTGGGTTTTGG - Intronic
950417301 3:12875966-12875988 TCCTTTGGAGCCCTGGGTTTTGG - Intergenic
950636786 3:14321172-14321194 TCTTTGGGAAGCCTGGGGCTGGG + Intergenic
951546992 3:23836439-23836461 TCTGTTGGAGCCCTTAGTCTAGG + Intronic
951858912 3:27228703-27228725 TCTTGTGCAAGCCTGAATCTGGG - Intronic
952254991 3:31687506-31687528 CCACTTGGAACCCTGAGTCACGG + Intronic
952836576 3:37607486-37607508 TCTTCTGGAATCCAGTGTCTGGG + Intronic
954129336 3:48552127-48552149 TCATTGGGAACTCTGAGCCTCGG + Intronic
954574032 3:51665025-51665047 TCTGTAGGAGCCCTAAGTCTGGG + Exonic
955518233 3:59749297-59749319 TCTGCTGCAACCCTGTGTCTCGG - Intronic
958439681 3:94140760-94140782 TCTTTTGGAATCCTTAGGCTAGG + Intergenic
961406129 3:126680946-126680968 TCTTTTGCTTCCCTGTGTCTTGG - Intergenic
961713920 3:128846200-128846222 TCCTTTGGAGCCCTGGGTTTTGG + Intergenic
961870171 3:129981721-129981743 TCTTTCTGAACCCTTACTCTGGG + Intergenic
962235161 3:133701030-133701052 TCTTTTTGGATCCTGAGTCGCGG - Intergenic
962303878 3:134268887-134268909 TCTTTTGGAAACCCCAGTTTTGG + Intergenic
962684179 3:137830603-137830625 TCTATTGGAACCTAGAGGCTTGG - Intergenic
963439741 3:145323166-145323188 GATTTTGGAACATTGAGTCTAGG - Intergenic
963543352 3:146623599-146623621 TCTATTGGTACCCTGACTGTAGG - Intergenic
964668976 3:159204509-159204531 TCTTTTGGAGCACTGGCTCTGGG - Intronic
967123775 3:186406886-186406908 TATTTGGGAACCTTGTGTCTTGG - Intergenic
968058171 3:195708912-195708934 TCTTTTGGTTCCCTGACTTTGGG - Intergenic
968962577 4:3752977-3752999 TCCCCTGGAACCCTGAGGCTCGG + Intergenic
970749922 4:19346344-19346366 TCTTTTGGGACCCTCACTTTTGG + Intergenic
971486517 4:27166173-27166195 TCTTTTGGAACACTCATTTTGGG - Intergenic
971933312 4:33114894-33114916 GCTTTTGGGACACTGAGTCACGG - Intergenic
972466749 4:39364949-39364971 TATTTTGGAAGCTTGAGACTTGG - Intronic
972982687 4:44725421-44725443 TCTTTTGAAACACTGTGTCTAGG - Intronic
974039501 4:56845579-56845601 TTTCTAGGACCCCTGAGTCTGGG + Intergenic
975376789 4:73655296-73655318 TTATATGGAACCCTGAGCCTTGG - Intergenic
976008569 4:80459788-80459810 TCTTTTGGAAGCCACAGTCAAGG - Intronic
979267486 4:118720238-118720260 TCTTTTGGAAGCCTGTAACTTGG + Intergenic
980121685 4:128734389-128734411 TCTTTTGGACACCTGATTTTAGG - Intergenic
983189351 4:164738586-164738608 TATTTTGGAACACTTACTCTGGG - Intergenic
984046455 4:174805390-174805412 TCTTTTGGATCACTGACTCTGGG + Intronic
986437163 5:7745672-7745694 TGTTTTGGAAACCTGAGACATGG - Intronic
986872288 5:12063808-12063830 TCTTTTGAAACCTTTAGTCTGGG + Intergenic
987911646 5:24154778-24154800 TCTTTTGGAACCATGAGCTGTGG - Intronic
990752943 5:59038607-59038629 TACTTAGGAACCCTGTGTCTTGG + Intronic
1005491563 6:26352228-26352250 TCTTTTGGTCCCCTAAGTCAGGG - Intergenic
1007102478 6:39259173-39259195 TCTTTTGCAGCCCTGTTTCTGGG + Intergenic
1008371264 6:50733870-50733892 ACTTTCAGAACCCTGAGTGTTGG - Intronic
1010574679 6:77516309-77516331 TTGTTTGGAACCCTAAGTTTTGG - Intergenic
1012205221 6:96452994-96453016 TTTTTTGGAAGCCAAAGTCTGGG + Intergenic
1014549918 6:122778694-122778716 TCTTGGGGAACCCTGAGCCAGGG + Intergenic
1017657235 6:156641711-156641733 TCTCTTGCAACACTCAGTCTGGG - Intergenic
1018252032 6:161881120-161881142 TCTGTGGGAACCCTGAGTATGGG - Intronic
1018811366 6:167300555-167300577 ACTTCTGAAACCCTCAGTCTGGG - Intronic
1022972311 7:35529477-35529499 TAGTTTGTGACCCTGAGTCTAGG - Intergenic
1022990395 7:35701567-35701589 TCTTTTGGATCTCTCATTCTGGG - Intergenic
1023529906 7:41141867-41141889 TCTTTTGGGACACTGAATATAGG + Intergenic
1023601254 7:41883909-41883931 TCCTGTGGAACCCAGAGGCTGGG + Intergenic
1024988239 7:55214081-55214103 TCTTTTAGAACCCAGTCTCTAGG - Intronic
1028034651 7:85966426-85966448 TCTGTGGGAACGCAGAGTCTAGG - Intergenic
1028680580 7:93525121-93525143 TTTTTTGTTTCCCTGAGTCTAGG - Intronic
1029795232 7:102887617-102887639 TCTTCAGGAAACCTCAGTCTTGG + Intronic
1031647055 7:124239443-124239465 TCTTTTGGAACACTTATTTTAGG + Intergenic
1031647478 7:124244462-124244484 TCTTTTGGAACACTTATTTTGGG + Intergenic
1032682172 7:134196025-134196047 TCTATTGCTACCCTGTGTCTTGG - Intronic
1035140836 7:156758940-156758962 TCTTTGGTAACCCTGCTTCTTGG - Intronic
1039174132 8:34784048-34784070 TCTCTTGGATCCTTGCGTCTTGG - Intergenic
1039779991 8:40775621-40775643 TCTAGTGGATCCCTGACTCTTGG - Intronic
1040362723 8:46683161-46683183 TCTTGTGCAAGCCTGAATCTGGG + Intergenic
1041451891 8:58014277-58014299 GCTTTAGGAACCCTGGATCTGGG + Intronic
1047178614 8:122566269-122566291 TCTATTGGAACCCTTGCTCTTGG - Intergenic
1050842123 9:10164003-10164025 TCTTTTTGAATTCTGGGTCTAGG - Intronic
1051689639 9:19696474-19696496 TGTTTGGTATCCCTGAGTCTGGG + Intronic
1052126663 9:24784241-24784263 TTTTTTTGCAGCCTGAGTCTTGG + Intergenic
1053739479 9:41124661-41124683 GCTTCTGTAACCCTGAGGCTGGG - Intergenic
1054688869 9:68306659-68306681 GCTTCTGTAACCCTGAGGCTGGG + Intergenic
1056041817 9:82676105-82676127 TCTGTTGAAACCCTGGGTTTAGG - Intergenic
1061399182 9:130359194-130359216 TGTTTTAGAGCCCTTAGTCTAGG + Intronic
1203497826 Un_GL000224v1:169205-169227 TGTTCTGGAATCCTGAGTGTGGG + Intergenic
1203510378 Un_KI270741v1:111455-111477 TGTTCTGGAATCCTGAGTGTGGG + Intergenic
1186375571 X:8995533-8995555 TCTTTTGGAACACCTATTCTTGG + Intergenic
1190057516 X:47190477-47190499 TTTTTTGGCCACCTGAGTCTCGG + Intergenic
1191966945 X:66769043-66769065 TATTTTGTAGCCCAGAGTCTAGG + Intergenic
1192021894 X:67402803-67402825 CCTTTTGCAAGCATGAGTCTGGG + Intergenic
1192314606 X:70042151-70042173 TCTGCTGGCAGCCTGAGTCTAGG - Intronic
1192689002 X:73340747-73340769 TTTTTTGGAATGCTGATTCTGGG + Intergenic
1195114443 X:101682853-101682875 ACTCATGGACCCCTGAGTCTGGG - Intergenic
1195646389 X:107235474-107235496 TCTTTTGGATCCTTTACTCTGGG + Intronic
1195860500 X:109377832-109377854 TCTTTTGCAACCATTAGTTTTGG - Intronic
1196127845 X:112118457-112118479 TCTTTTGGATTCCTAACTCTAGG - Intergenic
1197281486 X:124541933-124541955 TCTCTTGGAACACTCACTCTTGG + Intronic