ID: 902929699

View in Genome Browser
Species Human (GRCh38)
Location 1:19722399-19722421
Sequence CTCAGTATGTACTATGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1936
Summary {0: 1, 1: 0, 2: 24, 3: 280, 4: 1631}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902929696_902929699 8 Left 902929696 1:19722368-19722390 CCACCTACTGTACAACAGTCTTA 0: 1
1: 0
2: 1
3: 4
4: 97
Right 902929699 1:19722399-19722421 CTCAGTATGTACTATGTGCCAGG 0: 1
1: 0
2: 24
3: 280
4: 1631
902929697_902929699 5 Left 902929697 1:19722371-19722393 CCTACTGTACAACAGTCTTAGCC 0: 1
1: 0
2: 0
3: 3
4: 106
Right 902929699 1:19722399-19722421 CTCAGTATGTACTATGTGCCAGG 0: 1
1: 0
2: 24
3: 280
4: 1631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902929699 Original CRISPR CTCAGTATGTACTATGTGCC AGG Intronic
900009029 1:89128-89150 CTGAGCACCTACTATGTGCCAGG - Intergenic
900573205 1:3370117-3370139 CTAAGCACCTACTATGTGCCAGG + Intronic
901117349 1:6858002-6858024 TTGAGCATTTACTATGTGCCAGG - Intronic
901119369 1:6877937-6877959 CTGAGTATCTACTATGTGCAAGG - Intronic
901158884 1:7159926-7159948 CTGAAAGTGTACTATGTGCCAGG - Intronic
901233401 1:7653775-7653797 TTAAGCATCTACTATGTGCCAGG + Intronic
901290337 1:8119215-8119237 TTGAGTGTTTACTATGTGCCAGG + Intergenic
901300462 1:8196624-8196646 TTGAGTATCTACTATATGCCAGG + Intergenic
901300788 1:8198765-8198787 TTGAGTATCTACTGTGTGCCAGG - Intergenic
901333155 1:8425850-8425872 CTAAGTACCTACTATATGCCAGG + Intronic
901539826 1:9908848-9908870 GTGAGCATTTACTATGTGCCAGG - Intronic
901590867 1:10341359-10341381 CTGACTATGGCCTATGTGCCAGG - Intronic
901600757 1:10421777-10421799 GTAGGTATTTACTATGTGCCAGG - Intergenic
901689901 1:10965981-10966003 CTGAGTACCTACTGTGTGCCAGG + Intronic
901878940 1:12182721-12182743 CTAAGCAACTACTATGTGCCAGG - Intronic
901885581 1:12220631-12220653 CTGAGCACCTACTATGTGCCTGG - Intergenic
902178746 1:14671334-14671356 CTGAGCACCTACTATGTGCCAGG - Intronic
902230619 1:15025076-15025098 CTGAGCACTTACTATGTGCCAGG + Intronic
902409416 1:16204405-16204427 CTCAGTACCTACTCTGTGCAAGG - Intronic
902526670 1:17063274-17063296 CTGAGCATCAACTATGTGCCAGG + Intergenic
902614599 1:17616913-17616935 CTGAGTATTTATTGTGTGCCAGG + Intronic
902631962 1:17710090-17710112 TTCAGCACCTACTATGTGCCAGG + Intergenic
902723440 1:18319990-18320012 CTGAGTACCTACTATGTACCAGG - Intronic
902730769 1:18367293-18367315 GATAGTATGTACTATGTGCCAGG + Intronic
902897114 1:19486158-19486180 TTCAGCACCTACTATGTGCCAGG + Intergenic
902929699 1:19722399-19722421 CTCAGTATGTACTATGTGCCAGG + Intronic
902988930 1:20172540-20172562 CTGAGCATGTACTATCTGCCAGG + Intronic
903141078 1:21339573-21339595 ATGAGCATCTACTATGTGCCTGG - Intronic
903144898 1:21365045-21365067 CTGAGCACCTACTATGTGCCAGG - Intergenic
903183363 1:21616390-21616412 CTGAGTATTTACCATGTGCCAGG + Intronic
903268962 1:22176035-22176057 CTGAGCACCTACTATGTGCCGGG - Intergenic
903571066 1:24305671-24305693 TTAAGCACGTACTATGTGCCAGG - Intergenic
903756007 1:25661316-25661338 TCCAGTGTGGACTATGTGCCAGG + Intronic
903818995 1:26086683-26086705 CCCAGCATGTTCTCTGTGCCGGG - Intergenic
903889506 1:26560237-26560259 CTTAGTGTGTGCTGTGTGCCAGG - Intronic
903889816 1:26561862-26561884 TTCAGTATCTACTGTGTGCCAGG + Intronic
904040813 1:27583818-27583840 CTTAGTGGTTACTATGTGCCAGG - Intronic
904313672 1:29646081-29646103 ATGAGCATCTACTATGTGCCAGG - Intergenic
904321473 1:29700276-29700298 CTGTGTACCTACTATGTGCCCGG - Intergenic
904325533 1:29725306-29725328 CTGAGCACCTACTATGTGCCAGG + Intergenic
904334146 1:29786133-29786155 ATGAGTGTTTACTATGTGCCAGG - Intergenic
904338347 1:29812370-29812392 CTGAGCACCTACTATGTGCCAGG - Intergenic
904342587 1:29846463-29846485 CTGAGCACCTACTATGTGCCAGG + Intergenic
904375740 1:30081226-30081248 TTGAGCATTTACTATGTGCCGGG - Intergenic
904380086 1:30104750-30104772 CTGAGCACCTACTATGTGCCAGG + Intergenic
904407636 1:30303572-30303594 CTGAGCACCTACTATGTGCCAGG + Intergenic
904456843 1:30652907-30652929 CTGAGCATCTACTATGTGCTAGG + Intergenic
904461470 1:30683075-30683097 CTGAGCACCTACTATGTGCCAGG + Intergenic
904633450 1:31860920-31860942 TTTAGTGTTTACTATGTGCCAGG + Intergenic
904753103 1:32753571-32753593 CTTAGTGTTTACTATGTGCCAGG - Intronic
904894425 1:33803541-33803563 CCGAGTACCTACTATGTGCCTGG + Intronic
904962884 1:34348730-34348752 CTCAGAACTTACTATGTGCCAGG - Intergenic
904990280 1:34587027-34587049 CTCACTCACTACTATGTGCCAGG - Intergenic
905043704 1:34979812-34979834 CTGAACATTTACTATGTGCCAGG + Intergenic
905099060 1:35502377-35502399 CTGAGCATTTACTATATGCCAGG - Intronic
905364210 1:37440035-37440057 CTGAGGACCTACTATGTGCCAGG - Intergenic
905370636 1:37480930-37480952 CTGAGCATCTACCATGTGCCAGG - Intronic
905442075 1:38001978-38002000 CTGAGTATTTATTATCTGCCAGG - Intronic
905504044 1:38462789-38462811 CTGAGTGCCTACTATGTGCCAGG - Intergenic
905512584 1:38534326-38534348 CTGAGTACCTACTAAGTGCCTGG - Intergenic
905543676 1:38780649-38780671 TTGAGTATCTACTATGTGTCAGG - Intergenic
905774436 1:40659538-40659560 CTGTGTACCTACTATGTGCCGGG + Intronic
905842320 1:41192540-41192562 CTGAGTGTTTACTATGTGCCAGG - Intronic
905937003 1:41832671-41832693 CTAAATATCTACTATGTGCCAGG - Intronic
906072859 1:43029741-43029763 TCAAGTATCTACTATGTGCCAGG - Intergenic
906088102 1:43153180-43153202 CACAGTGTTTACCATGTGCCAGG - Intronic
906135846 1:43500338-43500360 CTGAGTGCCTACTATGTGCCAGG + Intergenic
906488428 1:46248723-46248745 GTGAGTACTTACTATGTGCCAGG + Intronic
906645181 1:47469763-47469785 CTGAGTACCCACTATGTGCCAGG + Intergenic
906674222 1:47681629-47681651 TTGAGCATGTATTATGTGCCAGG - Intergenic
906699252 1:47845890-47845912 CTAAGCACTTACTATGTGCCAGG - Intronic
906822417 1:48943558-48943580 CTCAGAACATACTATGTTCCAGG + Intronic
906824467 1:48963915-48963937 CTGGGTATTTACTATGTGCAAGG + Intronic
906825676 1:48977049-48977071 TTGAGCATCTACTATGTGCCAGG - Intronic
906842533 1:49155366-49155388 TTGAGCATTTACTATGTGCCAGG + Intronic
906919784 1:50050904-50050926 ATCAGTATTTACCATGTGCCTGG - Intronic
906933137 1:50189013-50189035 CTAAACATCTACTATGTGCCAGG - Intronic
906933438 1:50191228-50191250 CTGAGGATCTACTATGAGCCAGG - Intronic
906983099 1:50652869-50652891 CTGAGTGTCTACTATGAGCCAGG + Intronic
907008117 1:50936144-50936166 GTGAGAACGTACTATGTGCCAGG + Intronic
907025812 1:51117158-51117180 TTGAGTATTTACTAAGTGCCAGG - Intronic
907084464 1:51657093-51657115 TTGAGTATTTATTATGTGCCAGG - Intronic
907329994 1:53664555-53664577 CTCAGCTTCTACTATGTGCCAGG + Intronic
907350075 1:53821811-53821833 CTAAATATTTACTGTGTGCCAGG + Intronic
907388426 1:54140745-54140767 TTGAGTACCTACTATGTGCCAGG + Intronic
907391670 1:54162228-54162250 TTGAGTACCTACTATGTGCCAGG + Intronic
907396302 1:54192557-54192579 CTGAGCATCTACCATGTGCCAGG + Intronic
907457610 1:54585518-54585540 CTGAGTGTGTACTATGTGCCAGG + Intronic
907508839 1:54943495-54943517 CCCAGTAGGGACTCTGTGCCAGG - Intergenic
907517751 1:55003739-55003761 CTGAGTAGTTACTATGTGCTGGG + Intronic
907531736 1:55105956-55105978 CTCCGTGCTTACTATGTGCCAGG + Intronic
907545981 1:55260423-55260445 CTGAGAACTTACTATGTGCCAGG + Intergenic
907551150 1:55305751-55305773 CTGAGTACCTACTATGTGCAAGG - Intergenic
907644049 1:56223615-56223637 CTCAGTCCATACTATGTGTCAGG + Intergenic
907659714 1:56380812-56380834 CTGAGTATCTATTATGTGCTTGG + Intergenic
907660377 1:56386932-56386954 CTGAGTATTTCCTATGTGCCAGG - Intergenic
907750839 1:57261650-57261672 CTGAGTGCTTACTATGTGCCAGG - Intronic
907825207 1:58009884-58009906 TTGAGCATTTACTATGTGCCAGG + Intronic
907855070 1:58295225-58295247 CCAAGTACCTACTATGTGCCAGG - Intronic
907922341 1:58925211-58925233 TTAAGTATCTACTATGTGCCCGG - Intergenic
907943917 1:59115352-59115374 CTGAGTGTCTACTCTGTGCCAGG - Intergenic
907944873 1:59126455-59126477 CTCAATATCTACCATATGCCAGG + Intergenic
907957601 1:59245489-59245511 CCAAGTATGTACTATGTGCCAGG - Intergenic
908120970 1:60985565-60985587 ATCAATATTTACCATGTGCCAGG + Intronic
908124379 1:61015507-61015529 TTCAGTATGTACTATATGTGAGG - Intronic
908137142 1:61144756-61144778 CTGAGCATGTACCCTGTGCCAGG - Intronic
908186320 1:61656175-61656197 CTGAATATCTATTATGTGCCAGG + Intergenic
908190246 1:61695970-61695992 TTGAGCATTTACTATGTGCCAGG - Intronic
908332816 1:63087416-63087438 TTGAGTATCTACTATGTACCAGG - Intergenic
908339737 1:63164448-63164470 TTCAATATTTACTATGTGCCAGG - Intergenic
908396134 1:63727424-63727446 CTCAGTACCAACTATGTGTCAGG - Intergenic
908543268 1:65141332-65141354 TTGAGTAATTACTATGTGCCGGG - Intergenic
908631243 1:66110512-66110534 TTTGGTATTTACTATGTGCCAGG - Intronic
908693930 1:66815353-66815375 CTGAGTATTTACTATGTGACGGG - Intronic
908752623 1:67439044-67439066 CTGAGTGTTTACTATGTGCTAGG + Intergenic
908819245 1:68066380-68066402 CTGAGTGTCTACTATGTGCTAGG - Intergenic
908855594 1:68423399-68423421 CTGATTATCTACTGTGTGCCAGG - Intergenic
908952676 1:69580693-69580715 CTAAATATTTACTGTGTGCCAGG + Intronic
909106284 1:71413286-71413308 TTCAGTGTGTGCTATGTGCTAGG + Intronic
909470589 1:76023472-76023494 CTGAACATCTACTATGTGCCAGG - Intergenic
909502335 1:76348909-76348931 CTGAGTATGTACTATGAGCCAGG - Intronic
909514218 1:76489338-76489360 TTGAGTATGTACTATGTGACAGG + Intronic
909547610 1:76865296-76865318 TTGAGTACCTACTATGTGCCAGG - Intergenic
909566311 1:77057108-77057130 CTGAGTACCTACTATATGCCAGG + Intronic
909685242 1:78340555-78340577 CTGAGCATGCACAATGTGCCAGG - Intronic
909893630 1:81037898-81037920 CTCAACATCTACTATGTGCTGGG - Intergenic
910007368 1:82415154-82415176 CTGTGTATCTACTATGTGCTAGG - Intergenic
910078857 1:83315004-83315026 CTGAGTATTCACTATGTGCCAGG - Intergenic
910127196 1:83855700-83855722 CTGAGCACATACTATGTGCCAGG - Intergenic
910334615 1:86113161-86113183 CTGAGTACCTACTATGTGCTAGG + Intronic
910340169 1:86177790-86177812 CTGAGCATGTGCTGTGTGCCAGG - Intergenic
910557375 1:88550669-88550691 CTGAGTATCTACCATGTGTCAGG + Intergenic
910705136 1:90121596-90121618 TTAAGTAATTACTATGTGCCAGG + Intergenic
910719860 1:90274206-90274228 CTGAGTACTTACTATGTACCAGG + Intergenic
910752111 1:90642858-90642880 TTGAGTATTTACTATATGCCAGG - Intergenic
910825174 1:91399110-91399132 CTTACTGAGTACTATGTGCCAGG + Intronic
910892844 1:92035580-92035602 CTAAGCATTTACTATGAGCCAGG + Intronic
910947135 1:92605983-92606005 ATCAGAATGTACTAGGTGCTAGG + Intronic
911053285 1:93690347-93690369 CACAGTGCTTACTATGTGCCTGG + Intronic
911056366 1:93711691-93711713 TTGAGTCTCTACTATGTGCCAGG - Intronic
911089761 1:94009217-94009239 CTGAGTCTTTACTCTGTGCCAGG - Intronic
911216889 1:95204444-95204466 TTCAGTATGCATTATGTACCAGG + Intronic
911222860 1:95268289-95268311 TTAAGAATCTACTATGTGCCAGG - Intergenic
911586551 1:99697765-99697787 CTGAGTATGTATTTTGTACCAGG + Intergenic
911604289 1:99885374-99885396 ATGAGCATTTACTATGTGCCAGG - Intronic
911653623 1:100418170-100418192 AACAGTATATACCATGTGCCAGG - Intronic
911654119 1:100423532-100423554 CTGAGTATATAGTATATGCCAGG - Intronic
911715343 1:101126249-101126271 CTGAGCACCTACTATGTGCCAGG - Intergenic
912026049 1:105174749-105174771 TTCAGTATCTTCTATGTACCAGG + Intergenic
912176417 1:107163368-107163390 TTGAGTATTTACTATATGCCAGG - Intronic
912454105 1:109786438-109786460 CTGAGCATGTGCTGTGTGCCAGG + Intergenic
912469738 1:109898311-109898333 CTTAATATTTACTATGTGCCTGG - Intergenic
912498533 1:110106760-110106782 CTGAGCACCTACTATGTGCCAGG + Intergenic
912688695 1:111787219-111787241 TAGAGTATCTACTATGTGCCAGG + Intronic
912858987 1:113196254-113196276 GTCAATATGTACCAAGTGCCAGG - Intergenic
912902014 1:113661304-113661326 ATAAGTGTGTACTATGTGACAGG + Intronic
912916112 1:113816470-113816492 TTGAGTACTTACTATGTGCCAGG - Intronic
912975803 1:114329210-114329232 CTGAGCATCTACTATATGCCAGG + Intergenic
913003744 1:114607784-114607806 TTGAGTACATACTATGTGCCAGG + Intronic
913202253 1:116504421-116504443 CTGAGCATTTACTATGTTCCAGG - Intergenic
913202344 1:116505030-116505052 CTGAGCATTTACTATGTTCCAGG - Intergenic
913272430 1:117107753-117107775 TTAAGTCTCTACTATGTGCCAGG + Intergenic
913432859 1:118814353-118814375 CTGAGTCTCTACTATGTGCCAGG + Intergenic
913459589 1:119070078-119070100 CTGAGTATTTACTAAGTACCAGG + Intronic
914359691 1:146922904-146922926 ATTAGTAGTTACTATGTGCCAGG - Intergenic
914494060 1:148176990-148177012 ATTAGTAGTTACTATGTGCCAGG + Intergenic
914700743 1:150130823-150130845 TTGAATATATACTATGTGCCAGG + Intronic
914701779 1:150140629-150140651 CTGAGTGTCTACTATGTGCTAGG - Intronic
914800172 1:150955785-150955807 CTAAGTGATTACTATGTGCCAGG - Intronic
914975938 1:152362171-152362193 CTAAGAATGTATTATATGCCAGG - Intergenic
915433845 1:155888123-155888145 TTGAGTGTCTACTATGTGCCAGG + Intergenic
915510473 1:156384363-156384385 TTGAGCATCTACTATGTGCCAGG - Intronic
915737098 1:158091858-158091880 CTGAGCATTTGCTATGTGCCAGG + Intronic
915746381 1:158162490-158162512 CCAAGTATCTACTATGTTCCAGG + Intergenic
915842132 1:159222504-159222526 CTGAGGATTCACTATGTGCCAGG - Intergenic
916189656 1:162166784-162166806 CTGGGTATATACTATGGGCCAGG - Intronic
916411053 1:164547505-164547527 CTGACCATGTACTATATGCCAGG - Intergenic
916795692 1:168165198-168165220 CTCTGTAGGTACAATGGGCCTGG - Intergenic
916806007 1:168261883-168261905 CTGAGTGTTTACTTTGTGCCAGG - Intergenic
916839652 1:168586314-168586336 CTGAGCCTGTACTATGTGCCAGG - Intergenic
916998216 1:170325107-170325129 TTGAGAATTTACTATGTGCCAGG + Intergenic
917019065 1:170566696-170566718 TTGAGTATCTACTATGTGCTAGG - Intergenic
917080997 1:171257050-171257072 CTGAGCACTTACTATGTGCCAGG + Intronic
917098691 1:171424940-171424962 TTGAGTACTTACTATGTGCCAGG - Intergenic
917300805 1:173571955-173571977 CTGAGCATTTACTATGTGCCAGG + Intronic
917707608 1:177649925-177649947 CTCAGGATCTGCTCTGTGCCAGG - Intergenic
917939380 1:179902799-179902821 CTTAGTGTTTACTATGTGCCAGG - Intronic
918061286 1:181063448-181063470 CTGAGTGCCTACTATGTGCCAGG - Intergenic
918183070 1:182102079-182102101 TTGAGTATTTATTATGTGCCAGG + Intergenic
918495318 1:185128843-185128865 CTGAGGATCTACTATGTGCCAGG + Intronic
918594230 1:186274301-186274323 TTGAGCATGTACTATATGCCTGG - Intergenic
918747121 1:188217616-188217638 CTAAGTATCTACTATGTTCTGGG + Intergenic
918992264 1:191712325-191712347 ATTAGTATCTACAATGTGCCAGG - Intergenic
919127467 1:193413194-193413216 GTGAGTATCTACTGTGTGCCAGG + Intergenic
919706792 1:200684059-200684081 TTGAGTATTTTCTATGTGCCAGG + Intergenic
919839392 1:201598012-201598034 CTGAGTGTCTACTACGTGCCAGG + Intergenic
919898042 1:202021864-202021886 CTGAGTATCTACTAGGTGCCAGG + Intergenic
920259851 1:204681649-204681671 CTAAGTACCTACTGTGTGCCTGG - Intronic
920394373 1:205633050-205633072 CTGGGTATCTACTATGTGCTAGG - Intergenic
920418800 1:205816157-205816179 TTAAGTACCTACTATGTGCCAGG - Intergenic
920439488 1:205969785-205969807 TTGAGTATCTACCATGTGCCGGG + Intergenic
920538758 1:206761185-206761207 TTAAGTATTTACTCTGTGCCGGG + Intergenic
920698807 1:208202329-208202351 TTGAATATGTACTGTGTGCCAGG - Intronic
920789706 1:209078183-209078205 CCGAGTATTTACTACGTGCCAGG + Intergenic
920923121 1:210314694-210314716 TTCAGTATGTATTATGGGCCAGG + Intergenic
920991617 1:210945294-210945316 CACAATGTATACTATGTGCCAGG + Intronic
921163550 1:212489765-212489787 CTAAGTACTTGCTATGTGCCAGG - Intergenic
921214169 1:212923250-212923272 TTGAGCATCTACTATGTGCCTGG - Intergenic
921349037 1:214216930-214216952 TTGAGCATGCACTATGTGCCAGG + Intergenic
921429766 1:215052005-215052027 TTAAGTACCTACTATGTGCCAGG + Intronic
921621193 1:217328299-217328321 CTCAACATCTACTATGTTCCAGG + Intergenic
921783267 1:219194655-219194677 CTGAGTATTTGCTCTGTGCCAGG - Intronic
921849994 1:219924737-219924759 TTGAGTATGTACTTTGTCCCTGG - Intronic
922010044 1:221574177-221574199 CTAAGCAGCTACTATGTGCCAGG + Intergenic
922014870 1:221635130-221635152 CTAAGTATGTGTTATGTGCCAGG + Intergenic
922129400 1:222762107-222762129 CTAAATACTTACTATGTGCCAGG + Intergenic
922150299 1:222996592-222996614 GTGAGTATTTACCATGTGCCAGG + Intronic
922515192 1:226202488-226202510 CTCAATATTTATTATGTGTCAGG - Intergenic
922815628 1:228446851-228446873 TTTAGCATCTACTATGTGCCAGG + Intergenic
923117234 1:230953461-230953483 CTAAGCACTTACTATGTGCCAGG + Intronic
923210423 1:231799376-231799398 TTCACTGCGTACTATGTGCCAGG + Intronic
923703089 1:236318419-236318441 TTCAGTATTTTCTGTGTGCCAGG + Intergenic
923805885 1:237257575-237257597 CTGAATATCTACTATGTGCTGGG + Intronic
923831364 1:237561283-237561305 TTTAGTGTTTACTATGTGCCAGG + Intronic
924019658 1:239767665-239767687 CTTAGTATTTATTATGTGCCAGG + Intronic
924128263 1:240878385-240878407 TTGAGCATCTACTATGTGCCAGG - Intronic
924303676 1:242665371-242665393 CTGAGTACTTACAATGTGCCAGG + Intergenic
924861622 1:247929555-247929577 CTGAGTATTGACTGTGTGCCAGG + Intergenic
924954456 1:248913271-248913293 CTCAGCAGATACTATGTGCAGGG - Intronic
1063125374 10:3132317-3132339 CTAAGTACCTACTGTGTGCCAGG - Intronic
1063441141 10:6074328-6074350 TTGAGTACCTACTATGTGCCAGG + Intergenic
1063484981 10:6411302-6411324 CTGAGTGCCTACTATGTGCCAGG - Intergenic
1063606955 10:7531123-7531145 CTTAGTATCTACTCTGTGCCGGG + Intergenic
1063910066 10:10820466-10820488 TTGAGTATCTAATATGTGCCAGG + Intergenic
1063927189 10:10991982-10992004 TTGAGTATCTACTGTGTGCCAGG + Intergenic
1064468317 10:15608591-15608613 GTCAGTATCTTCCATGTGCCAGG + Intronic
1064605773 10:17037077-17037099 TTCAGCATGTATTATTTGCCAGG - Intronic
1064750287 10:18521562-18521584 TTGAGTATATTCTATGTGCCAGG + Intronic
1064904894 10:20335153-20335175 CTGAGCATCTACTATGTGCTGGG - Intergenic
1065141931 10:22726412-22726434 CTGAGCACTTACTATGTGCCAGG - Intergenic
1065167975 10:23000534-23000556 TTCAGCATATATTATGTGCCAGG - Intronic
1065277992 10:24105707-24105729 TTGAGTATCTACTATGTTCCAGG + Intronic
1065688987 10:28314187-28314209 CTGAGCACCTACTATGTGCCAGG + Intronic
1065756848 10:28938477-28938499 TCAAGTATTTACTATGTGCCAGG - Intergenic
1066042211 10:31560831-31560853 CCAAGTATCTACTATGTGACAGG + Intergenic
1066183122 10:32982422-32982444 CTGAATATCTATTATGTGCCAGG - Intronic
1066590179 10:36986131-36986153 CTCAGTATATACTAGGTGTTTGG + Intergenic
1067073840 10:43161103-43161125 CTGAGCATCTACTATGTGCCAGG - Intronic
1067223591 10:44361371-44361393 TTCAGAATGTGCTAAGTGCCTGG + Intergenic
1067799476 10:49349245-49349267 CTGAGCATCTACTATGTTCCAGG - Intergenic
1068520395 10:58071082-58071104 CTCTGTGCCTACTATGTGCCAGG + Intergenic
1068603290 10:58978334-58978356 CTGAGCACTTACTATGTGCCGGG + Intergenic
1068920019 10:62473669-62473691 CACAGCATTTACTATGTGCCAGG - Intronic
1069083065 10:64108709-64108731 CTGAGTATCTACTCTGTGCTTGG + Intergenic
1069281571 10:66661027-66661049 TTCAGTATTTACTATGTACGAGG - Intronic
1069407375 10:68116131-68116153 TTGAGCATCTACTATGTGCCAGG - Intronic
1069409601 10:68139813-68139835 CTGAGTACCTACCATGTGCCAGG + Intronic
1069587504 10:69618214-69618236 CTGAGCATTTACTATGTGCTAGG - Intergenic
1070005976 10:72424429-72424451 CTGAGTATGTACTATGGGCCAGG + Intronic
1070156437 10:73838504-73838526 CTCAGTACTTGCTATATGCCAGG - Intronic
1070289805 10:75106757-75106779 CTGAGTATCCACTACGTGCCTGG - Intronic
1070427233 10:76300931-76300953 CTAAGCATGTACTATGTACTTGG - Intronic
1070708257 10:78657321-78657343 CTGAGCACCTACTATGTGCCGGG - Intergenic
1070758836 10:79010524-79010546 CTGAGCATTTACCATGTGCCAGG - Intergenic
1070829594 10:79410357-79410379 TTGAGTACCTACTATGTGCCAGG - Intronic
1071103412 10:82065546-82065568 TTTAACATGTACTATGTGCCAGG - Intronic
1071137116 10:82465900-82465922 CTGAGTATTTACTGTGTCCCTGG - Intronic
1071295844 10:84218921-84218943 CTGAGGGTTTACTATGTGCCAGG + Intronic
1071502053 10:86211167-86211189 CTGAGTTGCTACTATGTGCCAGG - Intronic
1071734083 10:88278957-88278979 CTGAGTAACTCCTATGTGCCAGG + Intronic
1071822660 10:89294020-89294042 CTGAGAATCTACTATGTGCCAGG - Intronic
1071850697 10:89566890-89566912 CTGAGTACCTACTATGTGCCAGG + Intergenic
1071858159 10:89646182-89646204 CTGAGCATTTACTGTGTGCCAGG - Intergenic
1071948877 10:90680025-90680047 CTCAGTGCCTACTATCTGCCAGG - Intergenic
1072138458 10:92569748-92569770 CTGAGTACCTACTATGTGTCAGG + Intronic
1072142863 10:92605339-92605361 TTGAGTACTTACTATGTGCCAGG - Intronic
1072311315 10:94158030-94158052 CTCAGTACTTACAATGTGCCAGG - Intronic
1072421404 10:95292676-95292698 TACATTAAGTACTATGTGCCAGG - Intergenic
1072459674 10:95607553-95607575 CTGAGCATGTACTATGTACTAGG + Intronic
1072547393 10:96450077-96450099 CTCAGTACCTGCCATGTGCCAGG - Intronic
1072681496 10:97510552-97510574 CTGAGTAGGTAATATGTCCCAGG - Intronic
1072729641 10:97836994-97837016 CTGAGCATTTACTATGTTCCAGG + Intergenic
1073067690 10:100773241-100773263 CTGAGTATCTACTATGTGCTAGG - Intronic
1073188073 10:101629197-101629219 CTGAGCACTTACTATGTGCCAGG + Intronic
1073278827 10:102336497-102336519 CTGAGCGTATACTATGTGCCAGG - Intronic
1073410128 10:103334763-103334785 TTGAGAAAGTACTATGTGCCAGG + Intronic
1073564723 10:104525360-104525382 CTTAGCATCTACTACGTGCCAGG + Intergenic
1073693451 10:105837329-105837351 TTCTGTATTTACTATGTGCCAGG - Intergenic
1073810449 10:107146969-107146991 CTGGGTTTTTACTATGTGCCAGG - Intronic
1073941248 10:108700796-108700818 CACAGTAAGTACTTTGTGACAGG - Intergenic
1074026236 10:109638279-109638301 TTAAGTACTTACTATGTGCCAGG - Intergenic
1074063518 10:109991017-109991039 CTGAGCATGTAATATATGCCAGG + Intergenic
1074446391 10:113524606-113524628 CTGAGCAATTACTATGTGCCAGG + Intergenic
1074528948 10:114283735-114283757 CTGAGCATCTATTATGTGCCAGG - Intronic
1074547242 10:114410435-114410457 CTGAGTACCTACTATGTGCCAGG - Intergenic
1074588977 10:114794397-114794419 CTGAGTACTTATTATGTGCCAGG - Intergenic
1074876876 10:117620603-117620625 TTCAGGGTGTACTATGTGCCAGG - Intergenic
1074883469 10:117676531-117676553 TTGAGTACCTACTATGTGCCAGG - Intergenic
1074944428 10:118267725-118267747 TTCAGCACTTACTATGTGCCAGG + Intergenic
1075147685 10:119896265-119896287 CTCAGGATGCATTCTGTGCCAGG - Intronic
1075203421 10:120425631-120425653 CTGAGTACCTAATATGTGCCAGG - Intergenic
1075209317 10:120477760-120477782 CTGAGTATCTACTATGTGCCAGG - Intronic
1075249427 10:120852181-120852203 CTTAGTATCCACAATGTGCCTGG - Intronic
1075822533 10:125327136-125327158 CTGAGTATCTACTCTGTGCCAGG - Intergenic
1075876921 10:125815270-125815292 CTGAGTGCTTACTATGTGCCTGG + Intronic
1075950444 10:126473023-126473045 TTGAGTAACTACTATGTGCCAGG + Intronic
1076014467 10:127016211-127016233 CTGAGCACCTACTATGTGCCAGG - Intronic
1077264009 11:1640117-1640139 CTGTGTGTGCACTATGTGCCTGG - Intergenic
1077521887 11:3041310-3041332 CTGAGTACCTACCATGTGCCAGG + Intronic
1077652662 11:3987650-3987672 CTGAGTAGTTACTATGTGACAGG - Intronic
1077942509 11:6858436-6858458 CTGAGTACTTACTATATGCCAGG - Intergenic
1078019918 11:7648458-7648480 CTCAGTATGTGATCTTTGCCAGG + Exonic
1078180343 11:9005105-9005127 CTGAGCCTTTACTATGTGCCAGG + Intergenic
1078199182 11:9164684-9164706 CTGGGTACCTACTATGTGCCAGG - Intronic
1078201021 11:9183337-9183359 TTTATTATGTACTATGTGCCTGG - Intronic
1078261552 11:9714420-9714442 CTGAGTACATACTATGTGCCAGG - Intronic
1078281426 11:9905475-9905497 TTGAGTATCTACTATGTGCCAGG + Intronic
1078306771 11:10196180-10196202 CTCAGTATAGACTATATGCCAGG - Intronic
1078728331 11:13953157-13953179 CTGAGCATCTACTATGTGCCAGG + Intergenic
1078800515 11:14640053-14640075 TTCAGTATTTATTATGTGCCCGG - Intronic
1078825464 11:14925823-14925845 CTGAATATCTACTATATGCCAGG + Intronic
1078848923 11:15146109-15146131 CTGAGCATGTGTTATGTGCCAGG - Intronic
1078903743 11:15665532-15665554 TTGAGCATGTACTATGTGCCAGG + Intergenic
1079355850 11:19729916-19729938 CTCAGCACTTACTATGTGCCAGG + Intronic
1079574007 11:21980419-21980441 CTGTGTGTCTACTATGTGCCAGG - Intergenic
1079638587 11:22776118-22776140 GTAAGTACCTACTATGTGCCTGG + Intronic
1079652903 11:22952110-22952132 CTTAGTATCTACTATTGGCCAGG - Intergenic
1079656063 11:22987967-22987989 CACAGCTTGTACTGTGTGCCTGG - Intergenic
1079673619 11:23198861-23198883 CTCAGTAGGTACTCTGTGTGGGG + Intergenic
1079943982 11:26718236-26718258 CATAGTATTTACTATTTGCCAGG + Intronic
1080035493 11:27705832-27705854 CTGAGTATCTACTATCTGTCAGG + Intronic
1080081982 11:28231924-28231946 TTGAGTATGTACTATATGCCAGG - Intronic
1080224728 11:29948039-29948061 TTGAATATGTACTATATGCCAGG + Intergenic
1080226047 11:29961619-29961641 CTGAGTACCAACTATGTGCCAGG + Intergenic
1080228435 11:29987477-29987499 CTGAGCACTTACTATGTGCCAGG + Intergenic
1080274345 11:30487031-30487053 CCAAGCATCTACTATGTGCCAGG + Intronic
1080280123 11:30547382-30547404 AGCAGTATTTACTATGTGCCAGG + Intronic
1080335193 11:31187184-31187206 CTAAGTACCTACTATGTGTCAGG - Intronic
1080360840 11:31511454-31511476 CTGAGAATCTACTAAGTGCCAGG - Intronic
1080429858 11:32188433-32188455 CTCGGCACCTACTATGTGCCAGG + Intergenic
1080647186 11:34195769-34195791 CTGAGTGTTTACTATGTGCTAGG - Intronic
1080747122 11:35118223-35118245 CTAAGTATCTATTATGTCCCTGG + Intergenic
1080759933 11:35238616-35238638 CTGAATATCTACTATATGCCAGG + Intergenic
1080769267 11:35325461-35325483 TTGAGCATCTACTATGTGCCAGG - Intronic
1080803527 11:35631290-35631312 CTGAGTCTTTACTATGTGTCGGG - Intergenic
1080892506 11:36421634-36421656 CTGAGTATCTACTTTGTTCCAGG - Intronic
1081280566 11:41204751-41204773 TTGAGCATTTACTATGTGCCAGG + Intronic
1081323716 11:41720652-41720674 CTGTGTACCTACTATGTGCCTGG - Intergenic
1081417827 11:42836866-42836888 CTGAGTAGTTACTATATGCCAGG - Intergenic
1081533849 11:43983380-43983402 CTGAGCACCTACTATGTGCCTGG + Intergenic
1081631281 11:44691758-44691780 TTGAGCATGTCCTATGTGCCAGG - Intergenic
1081662548 11:44896860-44896882 CTGAGTTGCTACTATGTGCCAGG - Intronic
1081663124 11:44900579-44900601 CTGAGTTCTTACTATGTGCCAGG - Intronic
1081676556 11:44973425-44973447 TTGAGTATTTATTATGTGCCAGG - Intergenic
1081693915 11:45096236-45096258 TTGAGCATTTACTATGTGCCAGG - Intronic
1081715917 11:45250367-45250389 CCCAGTTTCTACCATGTGCCAGG - Intronic
1081730578 11:45369245-45369267 CTGAATACCTACTATGTGCCAGG - Intergenic
1081748901 11:45493855-45493877 CTGAGTGCCTACTATGTGCCAGG - Intergenic
1081759596 11:45568005-45568027 CTGAGCACCTACTATGTGCCAGG - Intergenic
1081829303 11:46093685-46093707 TTGAGCATTTACTATGTGCCTGG - Intronic
1081855214 11:46298832-46298854 TTGAGTAATTACTATGTGCCAGG + Intronic
1082778683 11:57269129-57269151 TTGAGCATTTACTATGTGCCAGG + Intergenic
1082798023 11:57392425-57392447 TTAAGTACCTACTATGTGCCGGG - Intronic
1082812605 11:57487541-57487563 CTGAGAACCTACTATGTGCCAGG + Intronic
1082854460 11:57794170-57794192 ACGAGTATGTACAATGTGCCAGG - Intronic
1083145412 11:60754693-60754715 ATGAGTGTTTACTATGTGCCAGG + Intergenic
1083188630 11:61033723-61033745 TTAAGCATGTATTATGTGCCAGG - Intergenic
1083328898 11:61888012-61888034 CTGAGTGCCTACTATGTGCCAGG - Intronic
1083687180 11:64383520-64383542 CAGAGTACCTACTATGTGCCAGG - Intergenic
1083946758 11:65927932-65927954 CTGAGTACCTACTCTGTGCCGGG + Intergenic
1083969252 11:66063341-66063363 CTAAGTACCTATTATGTGCCAGG - Intronic
1084101578 11:66953071-66953093 CCCAGTGTGTCCTCTGTGCCAGG - Intronic
1084268208 11:68015650-68015672 CTGAGCACCTACTATGTGCCAGG + Intronic
1084551808 11:69848192-69848214 CTGAGCATCTATTATGTGCCAGG + Intergenic
1084561293 11:69906805-69906827 CTGAGCATCTACTATGTGCCAGG + Intergenic
1084730395 11:71069548-71069570 CTGAGCATCTACTATGTTCCAGG + Intronic
1084850781 11:71938256-71938278 TTTAGTGCGTACTATGTGCCAGG + Intronic
1084900192 11:72303749-72303771 CTGGGTATTTACTATGTGCCTGG + Intronic
1085027384 11:73244307-73244329 GTAAGTACCTACTATGTGCCAGG + Intergenic
1085105231 11:73836528-73836550 TGCTGTAAGTACTATGTGCCAGG + Intronic
1085264650 11:75230046-75230068 CTCAGCACTTACCATGTGCCTGG + Intergenic
1085322982 11:75585926-75585948 CTTAGCATGCACTTTGTGCCAGG - Intergenic
1085732626 11:79012417-79012439 CTGAGTACCTACCATGTGCCAGG + Intronic
1086145939 11:83551848-83551870 CATAGTCTCTACTATGTGCCAGG + Intronic
1086180374 11:83943991-83944013 CTGAGTATGTACCATATGGCAGG - Intronic
1086186065 11:84017797-84017819 TTTAGTACCTACTATGTGCCAGG + Intronic
1086202874 11:84224526-84224548 TACACTTTGTACTATGTGCCAGG + Intronic
1086434456 11:86767599-86767621 CTGATTATCTACTATGTGCCAGG - Intergenic
1086497365 11:87418435-87418457 CTTAGTATCTACTATATACCTGG - Intergenic
1086538635 11:87881186-87881208 TTTAGTATCTTCTATGTGCCAGG - Intergenic
1086541805 11:87921721-87921743 CTGAGTGCTTACTATGTGCCAGG - Intergenic
1087000411 11:93413998-93414020 CTAAACATTTACTATGTGCCAGG + Intronic
1087065762 11:94026614-94026636 CTGAGTATTTACTATGCTCCAGG + Intronic
1087150798 11:94857822-94857844 CTGAGCATGTACCATGTACCAGG - Intronic
1087163641 11:94975727-94975749 CTCAGCACCTATTATGTGCCAGG - Exonic
1087262543 11:96026950-96026972 TTAAGTACTTACTATGTGCCAGG - Intronic
1087585933 11:100121672-100121694 TTCAGTATTTACCATGTGCCAGG + Intronic
1087773776 11:102239299-102239321 TTGAGTATCTAATATGTGCCAGG + Intergenic
1087897630 11:103604623-103604645 CTCAGTTTTTAATAAGTGCCGGG + Intergenic
1087949426 11:104202379-104202401 CGCAGTATTTTCTATGTGCCAGG + Intergenic
1088085272 11:105970562-105970584 CTGAGCATTTACTATGTACCAGG - Intronic
1088562388 11:111128499-111128521 CTGAGCTTCTACTATGTGCCAGG - Intergenic
1088568507 11:111198072-111198094 CTGAGTATCTGCCATGTGCCAGG - Intergenic
1088633023 11:111792305-111792327 TTCAGCATTTACTATATGCCAGG - Intronic
1088646117 11:111917903-111917925 CTGAGTGTGTCCCATGTGCCAGG + Intronic
1088668623 11:112119588-112119610 TTAAGTATCTACTATGTACCAGG + Intronic
1088771805 11:113042922-113042944 CTGAGTACTTACTATGTGTCAGG - Intronic
1088794083 11:113252558-113252580 CTGAGTATCTACTAGGTCCCAGG - Intronic
1089033532 11:115359641-115359663 CTGAGTGTCTACTATATGCCTGG + Intronic
1089160244 11:116431869-116431891 CTGAGTATCTCCTATGTGCCAGG + Intergenic
1089179367 11:116570671-116570693 TTGAGTACTTACTATGTGCCAGG - Intergenic
1089361110 11:117887280-117887302 CTGAGCATTTACTATATGCCTGG + Intergenic
1089388229 11:118081785-118081807 CTGAGCATCTACTATGTGCTAGG + Intronic
1089397754 11:118146745-118146767 CTGAGCATCTACTATGTGCCAGG + Intronic
1089399936 11:118158570-118158592 CTGAGTACCTACTCTGTGCCTGG - Intergenic
1089683366 11:120131868-120131890 CTGAGCATCTAGTATGTGCCAGG + Intronic
1089754845 11:120679109-120679131 TTCAGTATTTATTATGTGCCAGG + Intronic
1089794587 11:120970043-120970065 CTGAGTAACTACTATGTGCCTGG - Intronic
1089881715 11:121780388-121780410 TTGAGTATCTACTATGTGCCAGG - Intergenic
1089947711 11:122494878-122494900 CTGAGTGTCTACTATATGCCAGG + Intergenic
1090200106 11:124847910-124847932 CTGAATATCTTCTATGTGCCAGG + Intergenic
1090421184 11:126576050-126576072 CTGAGTGCCTACTATGTGCCTGG - Intronic
1090466801 11:126942295-126942317 CTCAGTGTTTACCGTGTGCCAGG - Intronic
1090749395 11:129732637-129732659 CTGAGTGTCTACTAGGTGCCAGG - Intergenic
1090805744 11:130201086-130201108 CTGAGCACCTACTATGTGCCAGG - Intronic
1090811308 11:130246659-130246681 CTGAGTATTTACCATGTGCCAGG + Intronic
1090821036 11:130341859-130341881 CTGAGTATATGCCATGTGCCAGG - Intergenic
1090903848 11:131056430-131056452 CTGAGTACCTACTATGTGCAGGG + Intergenic
1090930292 11:131291712-131291734 CTGAGCACTTACTATGTGCCAGG + Intergenic
1090945148 11:131422974-131422996 CTGAGCATTTATTATGTGCCAGG + Intronic
1091537820 12:1429952-1429974 CTCAGTGGTTTCTATGTGCCAGG + Intronic
1091629425 12:2148511-2148533 TACAGCATGTATTATGTGCCAGG + Intronic
1091864822 12:3823490-3823512 CTGAGTGTGTACTATGTGCCAGG - Intronic
1091907269 12:4199179-4199201 TTTAGTATGTATTATGTTCCAGG + Intergenic
1092033275 12:5307876-5307898 CTGAGTGTTTACTATATGCCAGG + Intergenic
1092252798 12:6910241-6910263 TTGAGAATGTGCTATGTGCCAGG + Intronic
1092501590 12:9052867-9052889 CTGAGTATCTACCATCTGCCTGG - Intergenic
1092518150 12:9237696-9237718 TTCAGTGTATACTATGTACCAGG + Intergenic
1092912688 12:13161840-13161862 TTCAGTGTTTGCTATGTGCCAGG + Intergenic
1092933803 12:13341387-13341409 TTGAGGATGTACTATGTGCTAGG + Intergenic
1092953583 12:13529666-13529688 CTGAGCATCTACTATATGCCAGG - Intergenic
1092970464 12:13689346-13689368 CTGAGTGCCTACTATGTGCCAGG - Intronic
1093558990 12:20515262-20515284 TTCAGTATCTACTATATGCCAGG - Intronic
1093855884 12:24101559-24101581 TTGAGTATCTACTATGTGTCTGG - Intergenic
1094105329 12:26805394-26805416 CTGAGTATGTACTTGGTGTCAGG - Intronic
1094156601 12:27344004-27344026 TTGAGTATTTACTATGTGCTAGG + Intronic
1094161292 12:27393717-27393739 TTGAGTGTGTACTATGTGCCAGG + Intronic
1094318504 12:29158974-29158996 CTGAGTACCTACTATGTGCCAGG + Intronic
1094458489 12:30666563-30666585 CTCAGCTCTTACTATGTGCCAGG + Intronic
1095204032 12:39418870-39418892 CTAAGCAACTACTATGTGCCAGG + Intronic
1095573809 12:43711763-43711785 TTGAGTACCTACTATGTGCCAGG + Intergenic
1095591883 12:43912615-43912637 CTGAGTGTGTAATATGTACCAGG - Intronic
1095702479 12:45204613-45204635 TTGAGTATCTACTATGTGCCAGG + Intergenic
1095790800 12:46165009-46165031 TTGAGTGTCTACTATGTGCCAGG + Intergenic
1095891395 12:47237568-47237590 TTCAGTATTTATTAAGTGCCAGG - Intergenic
1095914123 12:47458776-47458798 TTGAGTATGTACTATGTGCCAGG - Intergenic
1095970149 12:47896192-47896214 CTGAGCAGGTACTACGTGCCAGG - Intronic
1095990919 12:48034058-48034080 CTGAGTGCTTACTATGTGCCAGG - Intergenic
1096029202 12:48396899-48396921 TTGAGTACTTACTATGTGCCAGG + Intergenic
1096274761 12:50196870-50196892 CTGGGTGTTTACTATGTGCCAGG + Intronic
1096321294 12:50615672-50615694 TTGAGTATGTGCTGTGTGCCAGG + Intronic
1096394198 12:51253278-51253300 CTGAGTGTGTACTCTGTGCCAGG + Intronic
1096416975 12:51423089-51423111 CTAAGTACTTTCTATGTGCCTGG + Intronic
1096495288 12:52036413-52036435 CTCAGTATCTACTGTGTACAAGG + Intronic
1096678222 12:53237187-53237209 CTGAGTATCTGCTATGTGCCAGG + Intergenic
1096684570 12:53279507-53279529 CTGAGTTCTTACTATGTGCCAGG - Intronic
1096696612 12:53353072-53353094 CTAAGCATTTACTGTGTGCCAGG + Intergenic
1096968145 12:55645029-55645051 CTGAATACCTACTATGTGCCAGG + Intergenic
1097021551 12:56024562-56024584 TTGAGTACTTACTATGTGCCAGG - Intronic
1097115749 12:56695596-56695618 TTGAGCATCTACTATGTGCCAGG - Intergenic
1097125772 12:56773755-56773777 TTCAGTATTTGCCATGTGCCAGG - Intronic
1097414495 12:59297581-59297603 CTGAGTATGTGCTTTATGCCAGG + Intergenic
1097636636 12:62130612-62130634 CTGAGTACCTACTATGTGGCAGG + Intronic
1097720410 12:63013810-63013832 CATAATATTTACTATGTGCCAGG + Intergenic
1097829988 12:64214210-64214232 TTCAGCATCTACTATGTGCTAGG + Intronic
1097930153 12:65174691-65174713 CAGAGTGTCTACTATGTGCCCGG + Intronic
1097941047 12:65305957-65305979 CTGAGCATATACTATGTCCCAGG + Intronic
1097975342 12:65679979-65680001 TTAAGTACTTACTATGTGCCAGG + Intergenic
1098243325 12:68489819-68489841 TTAAGTATTTACTATGTGCCTGG + Intergenic
1098280127 12:68854296-68854318 TTCAGTACCTACTATGTGCTAGG + Exonic
1098299679 12:69041147-69041169 TTCAGGACCTACTATGTGCCAGG - Intergenic
1098299686 12:69041651-69041673 TTCAGGACCTACTATGTGCCAGG - Intergenic
1098299689 12:69041836-69041858 CTCAGGACCTACTATGTGCCAGG + Intergenic
1098413468 12:70206373-70206395 TTCAGTATTGACTATGTACCAGG + Intergenic
1098542683 12:71675369-71675391 TTGAGTATATACTATGTCCCAGG - Intronic
1098964148 12:76768128-76768150 TTCAGTATTCACTATATGCCAGG - Intronic
1098973834 12:76881357-76881379 TTCAGTATTTACCATGTGCCAGG - Intergenic
1099045306 12:77709808-77709830 CTAAGTATCTACTCTATGCCAGG - Intergenic
1099150266 12:79102653-79102675 CTGAGTATTTACTTTGTACCAGG - Intronic
1099633924 12:85188122-85188144 CTGAGTGCTTACTATGTGCCAGG - Intronic
1099844776 12:88016091-88016113 CTTAATATGGACTATGTGACAGG + Intronic
1099904195 12:88752647-88752669 TTTAGTATTTACTATGTACCAGG - Intergenic
1100035724 12:90249141-90249163 CTAAGCATCTACTATGTTCCAGG - Intergenic
1100170265 12:91967812-91967834 CTCAGTATCTATGATGGGCCAGG + Intergenic
1100417072 12:94389372-94389394 TTAAGTATCTACTATGTGTCAGG + Intronic
1100467227 12:94857046-94857068 TTAAGTACCTACTATGTGCCAGG + Intergenic
1101072316 12:101088573-101088595 CACAGCATCTACTATGTGCCAGG - Intronic
1101152912 12:101900031-101900053 CTAAGTATGTACTATATGATAGG + Intronic
1101283665 12:103286541-103286563 CTGATTATTTACTATGTGCTAGG - Intronic
1101286036 12:103313653-103313675 TTAAGTATGTCCTATGTGGCAGG - Intronic
1101337710 12:103811093-103811115 CTGAGTACCTACTTTGTGCCAGG + Intronic
1101446694 12:104742053-104742075 CTGAGTGCCTACTATGTGCCAGG + Intronic
1101576454 12:106001635-106001657 TTCAGCACCTACTATGTGCCAGG + Intergenic
1101609344 12:106276321-106276343 CCGAGCATGTACTATGTGCCAGG + Intronic
1101815038 12:108139716-108139738 CTGAGCATTTACTATGTGCTAGG - Intronic
1101830377 12:108252160-108252182 CTGAGCATCTACCATGTGCCAGG + Intergenic
1101854258 12:108429084-108429106 CTGAGTATTTGCTAGGTGCCAGG + Intergenic
1101927169 12:108981755-108981777 CTGAGGATTTATTATGTGCCAGG - Intronic
1101969673 12:109304382-109304404 TTAAGTATCTACTGTGTGCCAGG - Intronic
1102046018 12:109830858-109830880 CTGAGCACCTACTATGTGCCAGG + Intronic
1102053260 12:109878758-109878780 CTGAGCATCTGCTATGTGCCAGG + Intronic
1102100037 12:110271190-110271212 CTGAGCATCTGCTATGTGCCTGG + Intergenic
1102139410 12:110602264-110602286 CTGAGCACCTACTATGTGCCCGG - Intergenic
1102168637 12:110825300-110825322 TTGAGTATGTGCCATGTGCCAGG + Intergenic
1102205114 12:111084983-111085005 TTGAGCATCTACTATGTGCCAGG + Intronic
1102247818 12:111366343-111366365 CTCAGCAGGCACTGTGTGCCTGG - Intronic
1102288055 12:111675483-111675505 CTGAGCATCTAGTATGTGCCAGG + Intronic
1102363286 12:112308082-112308104 CTCAGCATCTCCTATGTGCTAGG - Intronic
1102417334 12:112775362-112775384 CTGTGCATGTACCATGTGCCAGG + Intronic
1102497971 12:113332636-113332658 TTGAGCATCTACTATGTGCCAGG - Intronic
1102512859 12:113427628-113427650 TTCAGCACCTACTATGTGCCAGG - Intronic
1102570899 12:113826368-113826390 TTGAGCATCTACTATGTGCCAGG - Intronic
1102571461 12:113829525-113829547 CCCAGCATATTCTATGTGCCAGG + Intronic
1102625292 12:114230517-114230539 ATGAGTATTTACTATGTGCCTGG + Intergenic
1102711015 12:114926910-114926932 CTGAGTGACTACTATGTGCCAGG + Intergenic
1102763382 12:115409059-115409081 CACAGGATTTACTCTGTGCCAGG + Intergenic
1102884387 12:116510564-116510586 CTGAGCACCTACTATGTGCCAGG - Intergenic
1103112879 12:118296986-118297008 CTCAGTTTCTACTATGTGTATGG + Intronic
1103214617 12:119192007-119192029 CTGAGTACTTTCTATGTGCCAGG - Intronic
1103376728 12:120462262-120462284 CTTACTGTGTACTCTGTGCCTGG + Exonic
1103397640 12:120620234-120620256 AGCAGTATCTACCATGTGCCAGG - Intergenic
1103922774 12:124407783-124407805 CTGAGCATCTACCATGTGCCAGG + Intronic
1103929271 12:124440589-124440611 CTGAGCATCTACTATGTGCCAGG + Intronic
1104010420 12:124926235-124926257 CTGAGTACCTATTATGTGCCAGG - Intergenic
1104066228 12:125309487-125309509 CTGAGCACCTACTATGTGCCAGG + Intronic
1104093622 12:125536605-125536627 CTGAATATCTACCATGTGCCAGG - Intronic
1104390844 12:128389568-128389590 CTGAGCACCTACTATGTGCCAGG - Intronic
1104640560 12:130464372-130464394 CTGAATACCTACTATGTGCCAGG + Intronic
1104640572 12:130464468-130464490 CTGAATACCTACTATGTGCCAGG + Intronic
1105343817 13:19555048-19555070 TTAAATATGTACTATGTTCCAGG + Intergenic
1105620709 13:22063348-22063370 CTGAGCATTTACTATGTGCTAGG + Intergenic
1105982200 13:25529294-25529316 CTCACTATCTGCTATGTGCTAGG + Intronic
1106037574 13:26058083-26058105 TTAAGTGTGTACTATATGCCAGG + Intergenic
1106095863 13:26642808-26642830 TTAAGTAGGTACTATGTGCCAGG - Intronic
1106139815 13:27002805-27002827 CTGAGTGTCTACTGTGTGCCAGG - Intergenic
1106201153 13:27538439-27538461 CTTAGCATCTACTATGTGCCAGG - Intergenic
1106227817 13:27798111-27798133 TTCAGCATCTACTATGCGCCAGG - Intergenic
1106240428 13:27907880-27907902 CTAAATATCTACTCTGTGCCAGG - Intergenic
1106401370 13:29434479-29434501 CTGAGTGCCTACTATGTGCCTGG - Intronic
1106482783 13:30149314-30149336 TTGAGCATCTACTATGTGCCAGG + Intergenic
1106587627 13:31071222-31071244 TTGAGTATTTACCATGTGCCAGG + Intergenic
1106785733 13:33106455-33106477 CTGAGTACCTACTATGTGTCAGG + Intronic
1107438829 13:40405458-40405480 CTGAGCATGTACTATGCACCAGG - Intergenic
1107477326 13:40751333-40751355 TTAAATATGTACTATGTTCCAGG + Intronic
1107505055 13:41025656-41025678 CTCAGCACTTACTATGTGCCAGG + Intronic
1107880906 13:44831219-44831241 CTGAGCACTTACTATGTGCCAGG - Intergenic
1108139936 13:47409818-47409840 CTAAGTGTACACTATGTGCCAGG + Intergenic
1108327757 13:49351048-49351070 CTGAAGATCTACTATGTGCCTGG + Intronic
1108374592 13:49802159-49802181 CTGAGTGTGCACCATGTGCCAGG + Intergenic
1108395360 13:49986164-49986186 ATAAGTATTTACTATCTGCCAGG - Intergenic
1108401666 13:50051295-50051317 TTGAATATCTACTATGTGCCAGG + Intergenic
1108495244 13:51018448-51018470 TTGAGCATTTACTATGTGCCAGG - Intergenic
1108719927 13:53120690-53120712 CTTATTATTTACTATGTGCCAGG + Intergenic
1109381520 13:61567823-61567845 CTCAGTATGTTCCATCTTCCAGG - Intergenic
1110170731 13:72497362-72497384 CTGAGCACCTACTATGTGCCAGG + Intergenic
1110180215 13:72607806-72607828 CTGAGAGTGTATTATGTGCCAGG + Intergenic
1110212343 13:72988270-72988292 CTGAGTATCTACAATGTACCAGG - Intronic
1110542109 13:76718351-76718373 CTGTGTATCTACTACGTGCCTGG + Intergenic
1110702648 13:78566872-78566894 ATGAGAGTGTACTATGTGCCAGG - Intergenic
1111677281 13:91402660-91402682 TTCAGCACTTACTATGTGCCTGG - Intronic
1111871438 13:93838119-93838141 CTGAGCACCTACTATGTGCCAGG + Intronic
1112206711 13:97331185-97331207 CTCAGTGCTTACTATGTGCTAGG + Intronic
1112243002 13:97701071-97701093 CTGAGTACTTGCTATGTGCCAGG + Intergenic
1112288548 13:98125193-98125215 CTGAGCATGTATTATGTGCCAGG - Intergenic
1112307329 13:98286757-98286779 CTCAGTACCTACTTTGTCCCAGG + Intronic
1112400194 13:99070571-99070593 GTGAGTATTTACTGTGTGCCAGG + Intronic
1112704671 13:102053928-102053950 TTGAGTGAGTACTATGTGCCAGG - Intronic
1113081485 13:106525034-106525056 TTGAATATGTACTGTGTGCCTGG - Intronic
1113161856 13:107390981-107391003 CTGAGCATCTACCATGTGCCAGG + Intronic
1113341247 13:109428282-109428304 CTAAGCATCTACTACGTGCCAGG + Intergenic
1114374299 14:22127298-22127320 CTAAGTACTTACTATTTGCCAGG - Intergenic
1114556414 14:23564911-23564933 CTGAGGCTCTACTATGTGCCAGG + Intronic
1115365684 14:32554349-32554371 ATCAGCATCTACTGTGTGCCAGG + Intronic
1115370198 14:32604770-32604792 CTTAGGATTTACTATGTGCTAGG - Intronic
1115424370 14:33239304-33239326 CTGAGGATTTAATATGTGCCAGG + Intronic
1115636452 14:35294644-35294666 CTGAGCATTTACTATGTGGCAGG - Intronic
1115748294 14:36460910-36460932 CTGAGCACTTACTATGTGCCAGG + Intergenic
1116392647 14:44412171-44412193 CTAAGTATTTAATATATGCCAGG + Intergenic
1116779527 14:49221094-49221116 TTCAGTATCTACTATGTGTCAGG + Intergenic
1116914817 14:50514425-50514447 CTTAATACTTACTATGTGCCAGG + Intronic
1116982866 14:51189761-51189783 TTCAACATCTACTATGTGCCAGG + Intergenic
1117118073 14:52536944-52536966 TTGAGAATGTATTATGTGCCAGG - Intronic
1117589216 14:57249100-57249122 TTAAGTACTTACTATGTGCCAGG + Intronic
1117623386 14:57610794-57610816 CTGAGTATCTCCTATGTGCCAGG + Intronic
1117696976 14:58375580-58375602 TTTAGTATCTTCTATGTGCCAGG + Intergenic
1117792070 14:59351533-59351555 CAGAGTGTATACTATGTGCCGGG - Intronic
1118132909 14:62987544-62987566 CTCAGTATGGCCTATGTCCCTGG + Intronic
1118297592 14:64584891-64584913 CTAAGTATGGACTATGTGCCGGG - Intronic
1118320859 14:64752624-64752646 CTGAGCATCTACTATGTGCCAGG - Intronic
1118359219 14:65042074-65042096 TTAAGTACCTACTATGTGCCAGG - Intronic
1118372541 14:65149799-65149821 TTGAGTTTCTACTATGTGCCAGG - Intergenic
1118373296 14:65156077-65156099 CTTAGCATTTACTGTGTGCCAGG + Intergenic
1118456528 14:65949849-65949871 CTAAGCATCTGCTATGTGCCAGG - Intergenic
1118581754 14:67307491-67307513 ATGATTATGTACTCTGTGCCAGG + Intronic
1118810339 14:69268584-69268606 CTGAGCATGTACTATGTGCCAGG + Intronic
1118975874 14:70676209-70676231 CTGAGTACCTACAATGTGCCAGG - Intergenic
1118976519 14:70682333-70682355 CTGAGAATCTGCTATGTGCCAGG - Intergenic
1118989059 14:70781627-70781649 CTGAGCATTTACTTTGTGCCAGG + Intronic
1119078350 14:71667469-71667491 CTGAGTACCTACTATGTGCTAGG - Intronic
1119360501 14:74045145-74045167 TTGAGCATTTACTATGTGCCAGG - Intronic
1119450099 14:74702092-74702114 GACAGTTTGTACCATGTGCCTGG - Intronic
1119554691 14:75544052-75544074 CTGAGTTCATACTATGTGCCAGG + Intronic
1119570665 14:75668445-75668467 CTGAGTCCCTACTATGTGCCAGG - Intronic
1119709308 14:76809814-76809836 CAAAGTATTCACTATGTGCCAGG + Intronic
1119827090 14:77666173-77666195 CTGAGTAACTACTATGTGCCAGG + Intergenic
1119862690 14:77947953-77947975 AACAGCTTGTACTATGTGCCTGG + Intergenic
1119878876 14:78084243-78084265 CTCTCTATGTACCATCTGCCAGG - Intergenic
1119902193 14:78270683-78270705 CTGAATGTTTACTATGTGCCTGG + Intronic
1119912775 14:78365777-78365799 CTGAGTATCTATTATATGCCAGG + Intronic
1120048903 14:79842119-79842141 CTGAGTTATTACTATGTGCCTGG + Intronic
1120180413 14:81337344-81337366 TTGAGCATCTACTATGTGCCAGG + Intronic
1120396346 14:83971639-83971661 CTGAGTATCTAAAATGTGCCAGG - Intergenic
1120653622 14:87163742-87163764 TTGAGCATGTACTATGTGTCAGG + Intergenic
1120715252 14:87834515-87834537 TTGAGCATTTACTATGTGCCAGG + Intergenic
1120761537 14:88289850-88289872 CTGAGTATTTACTATGTGCCAGG - Intronic
1120877367 14:89387361-89387383 CTGAGTGTGTACTATATTCCAGG + Intronic
1120902224 14:89585523-89585545 CTGAGCATCTACTATGGGCCAGG + Intronic
1120931503 14:89853381-89853403 TTGAGTACCTACTATGTGCCAGG + Intronic
1120969718 14:90197245-90197267 CTGAGCATTTACTATGTGCCAGG - Intergenic
1121239759 14:92420559-92420581 ATAAGTACCTACTATGTGCCAGG + Intronic
1121270945 14:92638033-92638055 CTGAGCATCTACTATGTGTCAGG - Intronic
1121306308 14:92909849-92909871 CTGAGCATTTACTATGTGCCAGG - Intergenic
1121553069 14:94816839-94816861 CTGAGCATCTACTATGTGCCAGG + Intergenic
1121613045 14:95294197-95294219 CTAAGCACCTACTATGTGCCAGG + Intronic
1121699952 14:95945026-95945048 CACAGTACTTACTATGTGTCAGG + Intergenic
1121742111 14:96261343-96261365 CTGAGAATGTACTATGTGCCAGG - Intronic
1121841431 14:97137552-97137574 CCGAGTGTTTACTATGTGCCAGG + Intergenic
1122070649 14:99203561-99203583 CTAAGCATCTACTATGTGCTAGG + Intronic
1122107277 14:99467939-99467961 CTCAGTATTTACCCTCTGCCAGG + Intronic
1122109486 14:99487006-99487028 CTGAGCATTTACTATGAGCCAGG - Intronic
1122156580 14:99753699-99753721 CTGAGCACCTACTATGTGCCAGG - Intronic
1122479004 14:102033623-102033645 CTCAGTGTGTATTATTTTCCAGG - Intronic
1122714925 14:103690450-103690472 CTGAGTATCTGCCATGTGCCAGG + Intergenic
1122750911 14:103932277-103932299 CCAAGTATCCACTATGTGCCAGG - Intronic
1124471478 15:29990655-29990677 TTGAGTATATACTATTTGCCAGG + Intergenic
1124828354 15:33122901-33122923 TGCAGCATGTACTATGTGCCAGG + Intronic
1125034072 15:35103661-35103683 TTCATTAAGTACTATCTGCCAGG + Intergenic
1125099741 15:35898314-35898336 TTAAGTACCTACTATGTGCCAGG - Intergenic
1125169532 15:36750477-36750499 TTCAGCATTTACTATGTACCAGG + Intronic
1125246515 15:37647238-37647260 AACAGCATGTACCATGTGCCTGG + Intergenic
1125259328 15:37804505-37804527 CTCTGTATTTACTCAGTGCCTGG + Intergenic
1125401037 15:39303507-39303529 CTTAGAATCTACTATGTTCCAGG + Intergenic
1125985388 15:44046097-44046119 CTGAGTATGTACTCTGTCCAGGG - Intronic
1126258541 15:46657921-46657943 TTGAGTATTTACTGTGTGCCAGG + Intergenic
1126352380 15:47757859-47757881 CTCAGAATTTCCTATGTGCCAGG + Intronic
1126456367 15:48866417-48866439 CTGAGGATCTACTACGTGCCAGG + Intronic
1126893739 15:53235732-53235754 CTCAGTGCCTACTATGTGCAAGG - Intergenic
1127120068 15:55763869-55763891 TTGAGTATTTATTATGTGCCAGG - Intergenic
1127201406 15:56656711-56656733 CTGAGTGCCTACTATGTGCCAGG + Intronic
1127345652 15:58095132-58095154 CCCAGTACGTACTGTGTGCCAGG + Intronic
1127387169 15:58475858-58475880 CTGAGCATTTCCTATGTGCCAGG + Intronic
1127618347 15:60709248-60709270 CTGAGTTTCTACTATGTGCCTGG + Intronic
1127651637 15:61014314-61014336 CTAAGGACCTACTATGTGCCAGG - Intronic
1127699636 15:61485768-61485790 CTGAGTATTTACCATGTGTCAGG + Intergenic
1127700819 15:61498734-61498756 CTAAGTATCTATTATGTGCCAGG - Intergenic
1127722561 15:61717235-61717257 TTGAGTCTCTACTATGTGCCAGG - Intergenic
1127931279 15:63599182-63599204 ATCAGTACCTACTATGTGCCAGG - Intronic
1127934802 15:63626844-63626866 CTGAGTACCTTCTATGTGCCTGG + Intronic
1128137488 15:65274712-65274734 CTAAGCATCTACTTTGTGCCAGG + Intronic
1128173057 15:65530159-65530181 CTGAGTACCTACTGTGTGCCTGG - Intergenic
1128214822 15:65927171-65927193 CTGAGCACTTACTATGTGCCAGG + Intronic
1128367451 15:67014367-67014389 CTGAGCATTTACTATGTACCAGG - Intergenic
1128387083 15:67157542-67157564 TTCAGCATGAACTACGTGCCAGG - Intronic
1128453081 15:67818400-67818422 CTGAGTACCTACTAAGTGCCAGG + Intergenic
1128652649 15:69430376-69430398 TTGAGTACCTACTATGTGCCAGG + Intronic
1128674960 15:69601898-69601920 CTGAGTACTTACTATGTGCCAGG - Intergenic
1128715695 15:69906076-69906098 CTGAGCATGTATTAAGTGCCAGG + Intergenic
1128747990 15:70128153-70128175 CTCAGCACTTACCATGTGCCAGG + Intergenic
1128810901 15:70571943-70571965 TTGAGTATCTACTATGTGCTAGG - Intergenic
1128951225 15:71884775-71884797 TTGAGTATGTACTAGGTGACAGG + Intronic
1129201119 15:74000842-74000864 CTGAGTATTTAATATGTGCCAGG - Intronic
1129243462 15:74265635-74265657 GTGAGTATCTACTATGTGCCAGG - Intronic
1129807786 15:78478901-78478923 TTGAGCATTTACTATGTGCCTGG - Intronic
1129850104 15:78788857-78788879 CTGAGCATCTACTATGTGCCAGG + Intronic
1129856241 15:78827302-78827324 CTGGGCATTTACTATGTGCCAGG - Intronic
1129888550 15:79055890-79055912 CTGAGTACCTACTGTGTGCCAGG + Intronic
1130007573 15:80115195-80115217 TTCAGAGTTTACTATGTGCCAGG - Intronic
1130041573 15:80409550-80409572 CTGAGTAACTACTATGTGCCGGG + Intronic
1130135061 15:81175503-81175525 CTGAGTGTTTACTCTGTGCCAGG - Intronic
1130252161 15:82306718-82306740 CTGAGCATCTACTATGTGCCGGG - Intergenic
1130363490 15:83211469-83211491 ATGAGAATTTACTATGTGCCAGG - Intergenic
1130676700 15:85959155-85959177 CTGAGCATCTACAATGTGCCAGG + Intergenic
1130776714 15:86991932-86991954 AACAGTATCTACTATGTACCTGG - Intronic
1131179877 15:90232533-90232555 CTGAGCATTTACTATGTGCTTGG + Intronic
1131209129 15:90478370-90478392 TTGAGTATTAACTATGTGCCAGG + Intronic
1131680315 15:94715101-94715123 TTTAGCATGTACTATGTGTCAGG + Intergenic
1131897612 15:97050847-97050869 ATAAGTATTTGCTATGTGCCAGG - Intergenic
1131984477 15:98028075-98028097 CTGAGTACATACTCTGTGCCAGG + Intergenic
1132019706 15:98349954-98349976 TTAAGTACCTACTATGTGCCAGG + Intergenic
1132988797 16:2782627-2782649 CTGAGTATGTGCACTGTGCCAGG - Intergenic
1133053641 16:3133902-3133924 CTAAGCATCTACCATGTGCCAGG + Intronic
1133688583 16:8190536-8190558 CTGAGCATCTACTTTGTGCCAGG + Intergenic
1133787230 16:8983019-8983041 CTGAGCACGTACTATGTGCCTGG + Intergenic
1133819597 16:9224790-9224812 TTGAGCATTTACTATGTGCCAGG - Intergenic
1133826065 16:9279298-9279320 CTGAGTATCTACTATGTGCCGGG - Intergenic
1134041732 16:11073789-11073811 TTGAGTGTCTACTATGTGCCAGG - Intronic
1134066661 16:11232877-11232899 CTCAGCATCTGCTATGTTCCAGG + Intergenic
1134639417 16:15817982-15818004 CTGAGCAGCTACTATGTGCCAGG + Intronic
1134676953 16:16097463-16097485 CTGAGTGTCTACTATGTGTCAGG - Intronic
1134801225 16:17086545-17086567 CTCAGTGCCTACTATGTGTCAGG - Intergenic
1134856340 16:17522959-17522981 TTAAGCATATACTATGTGCCAGG + Intergenic
1134877186 16:17711519-17711541 CTGAGTATCAACTATGTGCTTGG + Intergenic
1134882610 16:17758869-17758891 CTAAGCATCTACTATGTTCCAGG + Intergenic
1135009605 16:18863074-18863096 CTGAGCATGTACTATGACCCAGG - Intronic
1135054743 16:19221635-19221657 TTGAGTATCTACTATGTGCTAGG + Intronic
1135063675 16:19291548-19291570 CTCAGCATTCACTGTGTGCCAGG - Intronic
1135150855 16:20004499-20004521 CTGAGTGTCTACTATGAGCCAGG + Intergenic
1135188097 16:20332261-20332283 CTGAGCATGTCATATGTGCCAGG - Intergenic
1135194145 16:20380738-20380760 TTAAGCATCTACTATGTGCCAGG - Intronic
1135586160 16:23672727-23672749 TTAAGCATTTACTATGTGCCAGG - Exonic
1135663406 16:24315983-24316005 TTGAGCATGTACTATGTGCCAGG + Intronic
1136045435 16:27611450-27611472 CTTAGCACTTACTATGTGCCAGG - Intronic
1136100636 16:27992968-27992990 TTGAGAACGTACTATGTGCCAGG + Intronic
1136144448 16:28307934-28307956 CTGAGCATTTACTATATGCCAGG - Intronic
1136349968 16:29700467-29700489 CTGAGCATCTACTGTGTGCCAGG + Intergenic
1136380418 16:29891886-29891908 CTCAGCAGCTTCTATGTGCCAGG - Intronic
1136686456 16:31997418-31997440 CTGAGTATCCACTGTGTGCCAGG - Intergenic
1136787067 16:32940947-32940969 CTGAGTATCCACTGTGTGCCAGG - Intergenic
1137378936 16:47979856-47979878 CTGAGCACTTACTATGTGCCAGG - Intergenic
1137404007 16:48176011-48176033 CTGAGCACCTACTATGTGCCTGG - Intronic
1137425285 16:48374254-48374276 TGGAGTCTGTACTATGTGCCAGG - Intronic
1137497297 16:48980451-48980473 CCAAGTATGCACTATCTGCCAGG + Intergenic
1137498607 16:48993133-48993155 CTGAGTATGTGCTATGTTCCAGG - Intergenic
1137559513 16:49493669-49493691 CTGAGTGTCTACTTTGTGCCAGG - Intronic
1137564741 16:49525884-49525906 TTGAGCATGTACTATGTGCCAGG + Intronic
1137758764 16:50923780-50923802 TTGAGTATCTGCTATGTGCCAGG - Intergenic
1137940112 16:52675761-52675783 TTTAGTACTTACTATGTGCCAGG - Intergenic
1138036325 16:53610447-53610469 CTCACTGTGTGCTATGTGTCAGG + Intronic
1138099118 16:54237695-54237717 CTGAGTGTTTACTATGTGCCAGG + Intergenic
1138127887 16:54453835-54453857 ATCAGTACTTACTATGTGCTGGG + Intergenic
1138158729 16:54732123-54732145 CTGAGTAACTACTATGTGCCAGG - Intergenic
1138210815 16:55161874-55161896 CATAGTGTTTACTATGTGCCAGG - Intergenic
1138275259 16:55729713-55729735 CTGAGAACTTACTATGTGCCAGG - Intergenic
1138341709 16:56293939-56293961 CTAAGCATGAAATATGTGCCAGG - Intronic
1138461103 16:57148320-57148342 TTGAGTTTGTACAATGTGCCAGG - Exonic
1138463668 16:57170613-57170635 CTGAGAATCTACTATATGCCAGG + Intronic
1138511998 16:57514170-57514192 CTCAGCATTTATTATGTGCCAGG + Intronic
1138563224 16:57814471-57814493 TTGAGCACGTACTATGTGCCAGG + Intronic
1138765619 16:59599216-59599238 TTTAGTATCTACTATGTGCAAGG + Intergenic
1139086624 16:63594738-63594760 TTGAGCATCTACTATGTGCCAGG + Intergenic
1139255557 16:65538537-65538559 CTGAGTGCCTACTATGTGCCAGG + Intergenic
1139353171 16:66350663-66350685 CTTGGTATGTTCTATGTGCCAGG - Intergenic
1139356963 16:66372296-66372318 TTGAGCATCTACTATGTGCCAGG - Intronic
1139973856 16:70793286-70793308 CTGAGTACTTACTATTTGCCAGG + Intronic
1140203728 16:72915856-72915878 CTGAGTGCTTACTATGTGCCAGG + Intronic
1140288590 16:73628575-73628597 CTGAGTATCTACTATGGGCAAGG - Intergenic
1140552766 16:75885293-75885315 TTAAGTGTGTACTATGTGCCAGG + Intergenic
1140729602 16:77843967-77843989 CTGAGCATGTACTATGAGCCAGG + Intronic
1140731033 16:77856471-77856493 CTCAGTACTTAATATGTACCAGG + Intronic
1140737423 16:77910840-77910862 TTCAGTATGTGCTATATGCCAGG + Intronic
1140894767 16:79315122-79315144 TTGAGCATCTACTATGTGCCAGG + Intergenic
1141480985 16:84306820-84306842 CTGAGTACTTGCTATGTGCCAGG + Intronic
1141618632 16:85224566-85224588 TTGAGCATCTACTATGTGCCGGG + Intergenic
1141642634 16:85350137-85350159 CCGAGTACCTACTATGTGCCAGG - Intergenic
1141643329 16:85354401-85354423 CTGAGCACCTACTATGTGCCAGG - Intergenic
1141746060 16:85926997-85927019 CTTAGTATGTACTGCGTGCCAGG - Intergenic
1203089304 16_KI270728v1_random:1202617-1202639 CTGAGTATCCACTGTGTGCCAGG - Intergenic
1142489555 17:269468-269490 CTGAGGATTTGCTATGTGCCGGG - Intronic
1142526989 17:550067-550089 ATGAGCATTTACTATGTGCCTGG + Intronic
1143029950 17:3962407-3962429 CTGAGCACTTACTATGTGCCAGG - Intronic
1143423912 17:6817841-6817863 CTGAGCATGTACTATGTGCCAGG - Intronic
1143509243 17:7386454-7386476 CTCTGTATGTAGTCTGTGCTGGG - Intronic
1143704333 17:8686709-8686731 CTCTGTTTGTACTATTGGCCCGG - Intergenic
1143749653 17:9019466-9019488 ATATGCATGTACTATGTGCCTGG + Intergenic
1143766733 17:9142667-9142689 ATCACCGTGTACTATGTGCCAGG + Intronic
1143808080 17:9446246-9446268 GTGAGGATCTACTATGTGCCAGG - Intronic
1144037924 17:11383980-11384002 CTGAGCATTTACTATGTACCAGG + Intronic
1144089063 17:11837291-11837313 ATGAGTACCTACTATGTGCCAGG + Intronic
1144181174 17:12753883-12753905 CTGAGCACCTACTATGTGCCAGG + Intronic
1144273956 17:13646915-13646937 CTGAGCATTTACTGTGTGCCAGG + Intergenic
1145813555 17:27779909-27779931 CTGAGCACCTACTATGTGCCAGG + Intronic
1146152146 17:30483360-30483382 ATGAGCATCTACTATGTGCCAGG + Intronic
1146331995 17:31935280-31935302 CTGAGTGCTTACTATGTGCCAGG - Intergenic
1146475560 17:33159899-33159921 CTGAGCATTTTCTATGTGCCAGG - Intronic
1146481530 17:33208783-33208805 CTGAGCATCTGCTATGTGCCAGG - Intronic
1146568466 17:33933393-33933415 CTGAGTATCCAGTATGTGCCAGG - Intronic
1147023941 17:37564219-37564241 TTCAGAAAATACTATGTGCCAGG - Intronic
1147304437 17:39553576-39553598 CTCAGCATGTGCTCTGTGCTGGG - Intronic
1147357859 17:39911647-39911669 CTCAGTACCTACTGTGTGCTTGG + Intronic
1147359059 17:39919968-39919990 TTGAGTATTTACTATATGCCAGG + Intergenic
1147361835 17:39935698-39935720 CTGAGCATGTACTGTGTACCAGG - Intergenic
1147628161 17:41913317-41913339 CTGAGCATCTACCATGTGCCAGG + Intronic
1147790493 17:43011648-43011670 CTAAGTACTTACTATATGCCAGG - Intronic
1147848346 17:43421310-43421332 CATAGTGTCTACTATGTGCCTGG - Intergenic
1147924220 17:43936684-43936706 CTGAGTATCTGCTAAGTGCCAGG + Intergenic
1148024868 17:44579933-44579955 TTGAGTATCTACTATGTACCAGG - Intergenic
1148336953 17:46848370-46848392 CTGAGTACCTACTATGTGCTGGG + Intronic
1148546275 17:48521590-48521612 CTGAGCATCTACTATGTTCCAGG + Intergenic
1148740961 17:49892187-49892209 TTGAGCATCTACTATGTGCCAGG + Intergenic
1148765440 17:50036049-50036071 CTCAGTATGGTCTGTGTGCTGGG - Intergenic
1148784370 17:50138452-50138474 GTCTGTGGGTACTATGTGCCTGG + Intronic
1148812159 17:50300290-50300312 CTGAGCATCTGCTATGTGCCAGG - Intergenic
1148871538 17:50661308-50661330 CTGTGCATATACTATGTGCCGGG + Intronic
1148961788 17:51399419-51399441 TTAAGTATGTACTGTGTGCCAGG + Intergenic
1149146788 17:53504170-53504192 TTCAGTATTTACTATGTACATGG + Intergenic
1149835982 17:59912999-59913021 CTGAGTACCTATTATGTGCCAGG - Intronic
1150173668 17:63026312-63026334 CTAAGTACTTGCTATGTGCCGGG - Intronic
1150194315 17:63279293-63279315 CTGAGCATTTACTATGTACCAGG + Intronic
1150503122 17:65670051-65670073 TTCAGCACCTACTATGTGCCAGG - Intronic
1150510012 17:65741214-65741236 CTCATCACGTACTATGTTCCAGG - Intronic
1150526357 17:65926861-65926883 TTGAGTACTTACTATGTGCCAGG - Intronic
1150559640 17:66283422-66283444 TTGAGCATCTACTATGTGCCAGG + Intergenic
1150809337 17:68344484-68344506 CTCAGCATTTATTATGTGCTAGG + Intronic
1150840558 17:68601729-68601751 CTGAGCACCTACTATGTGCCAGG - Intergenic
1151086392 17:71385977-71385999 TTGAGTATCTACCATGTGCCAGG - Intergenic
1151177300 17:72299399-72299421 TTAAATATGTACTCTGTGCCAGG - Intergenic
1151305233 17:73258815-73258837 CTGAGCACTTACTATGTGCCAGG - Intronic
1151424607 17:74022789-74022811 TTGAGTATGTACTACGTGCCAGG - Intergenic
1151434959 17:74089413-74089435 CGGAGTATCTACCATGTGCCAGG + Intergenic
1151773457 17:76180502-76180524 CTGAGTATCTACTATGTGCCAGG + Intronic
1152332297 17:79680261-79680283 CTGAGCATCTACTATGTGACAGG - Intergenic
1152979593 18:263756-263778 TTGAGCATCTACTATGTGCCTGG - Intronic
1153145025 18:2021584-2021606 TTGAGTACTTACTATGTGCCAGG - Intergenic
1153445712 18:5170522-5170544 ATGAGGATGTACAATGTGCCAGG - Intronic
1153528431 18:6019569-6019591 CTGAGCATCTACTAGGTGCCAGG + Intronic
1153951208 18:10059216-10059238 CTAAGCACCTACTATGTGCCAGG - Intergenic
1154333092 18:13446034-13446056 CTGAGCATGTACTGTGGGCCAGG - Intronic
1154354423 18:13614188-13614210 CTCAGCAGGTAGTGTGTGCCTGG - Intronic
1155116020 18:22767801-22767823 CTCAGTATATAGCATGTGCTAGG + Intergenic
1155150331 18:23117883-23117905 CTGAGTACCTACTATGTGCCAGG + Intergenic
1155565760 18:27132527-27132549 CTGAGCATCTACTATGTGCCAGG + Intronic
1156013852 18:32525950-32525972 CTGAGTATCTACCATGTGCTAGG - Intergenic
1156110512 18:33720253-33720275 CACAGCATCTACTATGTGCCAGG - Intronic
1156385538 18:36601504-36601526 CTGAGCATGTACTATATGCCAGG + Intronic
1156431997 18:37085187-37085209 CTCATTATGTAGTATTGGCCTGG + Intronic
1156539222 18:37893320-37893342 CTCAGCATGTCCTATGTACTGGG + Intergenic
1156676524 18:39532992-39533014 TTGAGCATTTACTATGTGCCAGG + Intergenic
1156676636 18:39534753-39534775 TTCAGTGCCTACTATGTGCCAGG + Intergenic
1157134662 18:45042014-45042036 CTGAGCATGTACTATGTGTCAGG - Intronic
1157238132 18:45983146-45983168 CATAGTCTCTACTATGTGCCAGG + Intergenic
1157468585 18:47969682-47969704 CACAGCACTTACTATGTGCCAGG + Intergenic
1157469388 18:47976968-47976990 TTGAGTACTTACTATGTGCCAGG - Intergenic
1157511702 18:48280002-48280024 TTGAGCATCTACTATGTGCCAGG + Intronic
1157599140 18:48882971-48882993 TTGAGCATGTACTCTGTGCCAGG + Intergenic
1157730827 18:50002722-50002744 TTGAGTTTGTACTTTGTGCCAGG - Intronic
1157743204 18:50111910-50111932 CTGAGTACCTACTATGTGCCAGG + Intronic
1157917906 18:51687043-51687065 TTCAGGATGTTTTATGTGCCTGG + Intergenic
1159125629 18:64220757-64220779 TTAAGTACCTACTATGTGCCAGG + Intergenic
1161090705 19:2358628-2358650 CTGAGTATGTGCTGTGTGCCCGG - Intergenic
1161214242 19:3085334-3085356 CTCAGTGCCTACTGTGTGCCGGG - Intergenic
1161473188 19:4471506-4471528 CTGAGTACCTACTATATGCCAGG - Intergenic
1161666046 19:5577615-5577637 CTAAGCACCTACTATGTGCCAGG - Intergenic
1161864754 19:6825693-6825715 TTGAGCATCTACTATGTGCCAGG - Intronic
1161868975 19:6855934-6855956 GTAAGTATCTACTGTGTGCCAGG + Intronic
1161881537 19:6957791-6957813 TTGAGTATCTACTATGTGCTAGG - Intergenic
1162004120 19:7766364-7766386 CTGAGTGTCTACTGTGTGCCTGG - Intronic
1162173217 19:8807838-8807860 CGGAGTATGTTCTGTGTGCCAGG - Exonic
1162312498 19:9915151-9915173 CTGAGCATCTACTATGTCCCAGG + Intronic
1162571295 19:11475158-11475180 CTGAGCATCTACTGTGTGCCAGG + Intronic
1162752964 19:12840210-12840232 CTCAGTATGGATTATGTGTAGGG - Intronic
1162852779 19:13443957-13443979 TTGAGTACTTACTATGTGCCAGG - Intronic
1163172076 19:15538423-15538445 CTGAGCATCAACTATGTGCCAGG - Intronic
1163201613 19:15773843-15773865 CTGAGTATCTACTATGTGCTAGG + Intergenic
1163342745 19:16720176-16720198 CTGAGCACCTACTATGTGCCAGG + Exonic
1163681088 19:18683169-18683191 CTGAGCACCTACTATGTGCCAGG - Intergenic
1164400821 19:27901046-27901068 CTGAGCATCTACTATGTGCCAGG + Intergenic
1164690537 19:30207704-30207726 CTGAGCATGTACTATGTGCCAGG - Intergenic
1164695657 19:30241716-30241738 CTGAGTGTCTGCTATGTGCCAGG + Intronic
1164708279 19:30336318-30336340 CTGAGCACCTACTATGTGCCAGG - Intronic
1164725918 19:30465546-30465568 CTGAGTCTGTATTATGTGCCAGG - Intronic
1164822457 19:31260637-31260659 TTGAGCATCTACTATGTGCCAGG + Intergenic
1165315474 19:35052788-35052810 CTGAGAACCTACTATGTGCCAGG - Intronic
1165479035 19:36050917-36050939 CTAAGAACCTACTATGTGCCAGG + Intronic
1165715553 19:38043629-38043651 CACAGCATTTACTATGTGCCAGG - Intronic
1165956705 19:39505633-39505655 CTGAGAATTTACTGTGTGCCAGG + Intronic
1165993874 19:39831440-39831462 TTGGGTATTTACTATGTGCCAGG + Intronic
1166842382 19:45705902-45705924 TTGAGCATCTACTATGTGCCAGG + Intergenic
1166883922 19:45947233-45947255 CTGAGTATCTACTGTGTTCCAGG - Intronic
1167254051 19:48416602-48416624 CTGAGCATCTACTATGTGCCAGG + Intronic
1167373068 19:49095875-49095897 TTAAGCATCTACTATGTGCCTGG - Intronic
1167489444 19:49783063-49783085 CTGAGCACATACTATGTGCCAGG + Intronic
1168140834 19:54385759-54385781 CTGAGCATCTATTATGTGCCAGG - Intergenic
1168157508 19:54484299-54484321 CTGAGCATCTATTATGTGCCAGG + Intergenic
1168158078 19:54489200-54489222 TTTATTATGTACTATGTGCTAGG + Intergenic
1168246811 19:55116743-55116765 CTCAGTCTGGTCTATCTGCCTGG - Intronic
1168331054 19:55568988-55569010 CTGAGCCTCTACTATGTGCCAGG - Intergenic
1168379043 19:55904811-55904833 TTGAGTAATTACTATGTGCCAGG - Intronic
1168431445 19:56284363-56284385 CTGAGTATCTAGTCTGTGCCTGG + Intronic
925153415 2:1632890-1632912 CTGAGTATCCACCATGTGCCAGG - Exonic
925216040 2:2096739-2096761 CTGAGGATGGACTGTGTGCCAGG + Intronic
925238745 2:2303001-2303023 CTCATCATCTACTATTTGCCAGG + Intronic
925291089 2:2749181-2749203 CTGAGTATTTACCACGTGCCAGG - Intergenic
925332875 2:3072278-3072300 CTCAGTGTGTCCTCTGGGCCTGG - Intergenic
925363895 2:3298000-3298022 CTCAGTGCCTACTATGTGCCAGG + Intronic
925427845 2:3765651-3765673 CTGAGCATCTGCTATGTGCCAGG + Intronic
925632193 2:5905896-5905918 TTGAGTATCTACCATGTGCCAGG - Intergenic
925798645 2:7574249-7574271 TTCAGCATTTACTATATGCCTGG + Intergenic
926015071 2:9444109-9444131 TTAAGCATTTACTATGTGCCAGG - Intronic
926735654 2:16071408-16071430 CTGAGAATTTTCTATGTGCCAGG + Intergenic
926790845 2:16569879-16569901 TTGAGCATCTACTATGTGCCAGG - Intronic
927450820 2:23207805-23207827 CTGAGCACCTACTATGTGCCAGG - Intergenic
927483100 2:23469741-23469763 CTGAGCATCTACTACGTGCCAGG + Intronic
927652990 2:24923412-24923434 TTGAGTATCTACTAGGTGCCAGG - Intergenic
927655500 2:24942069-24942091 CTGAGCATCTACCATGTGCCAGG - Intergenic
927664492 2:25020860-25020882 CTGAGTGCTTACTATGTGCCAGG - Intergenic
927714716 2:25343897-25343919 CTGAGTGTCTACTATGTGCCAGG + Intergenic
927796992 2:26058036-26058058 CTGAGTATCTACTATGGTCCAGG - Intronic
927900096 2:26812835-26812857 CTCAGCCTTCACTATGTGCCTGG + Intergenic
927934395 2:27067840-27067862 CTGAACATTTACTATGTGCCAGG + Intronic
928070498 2:28210232-28210254 TTCAGTACCTATTATGTGCCTGG + Intronic
928247117 2:29640194-29640216 TTAAGCATTTACTATGTGCCGGG + Intronic
928352306 2:30570419-30570441 CTGAGCATTTACTATGTACCTGG + Intronic
928587023 2:32770200-32770222 CTGAGTATTTACTCAGTGCCAGG + Intronic
928871103 2:35981007-35981029 CTGAGTATCTACTATGTGTCAGG - Intergenic
928895124 2:36252929-36252951 CTAAGTATCTACTCTGTGCCTGG + Intergenic
928923925 2:36556743-36556765 CATAGCATGTACTATGTGCCAGG - Intronic
929059161 2:37905555-37905577 CTGAGCACTTACTATGTGCCTGG - Intergenic
929249300 2:39735224-39735246 CGCAGTATCCACTATATGCCAGG + Intergenic
929263742 2:39895316-39895338 GTCTTTAAGTACTATGTGCCAGG + Intergenic
929450140 2:42031276-42031298 CTGAGCATGTTCTATGTGCCAGG + Intergenic
929745103 2:44649035-44649057 ATTAGTATTTACTATGTGCTAGG - Intronic
929800180 2:45093075-45093097 CTGAGCATCTACTATGTGTCAGG - Intergenic
929839374 2:45441449-45441471 GTGAGTACGTACTATGTACCAGG - Intronic
929841224 2:45466007-45466029 CTGAATATCTACCATGTGCCAGG + Intronic
929970948 2:46575707-46575729 CTAAATATTTACTATGTGTCAGG - Intronic
930230171 2:48835241-48835263 AGCAGCTTGTACTATGTGCCTGG + Intergenic
930259636 2:49130239-49130261 TTAAGTATGTACTGTGTGTCAGG - Intronic
930687805 2:54327814-54327836 CTTAGTGAGTGCTATGTGCCAGG + Intergenic
930701519 2:54462171-54462193 CTAAATACGTACTATGTGCCTGG - Intronic
931058289 2:58497640-58497662 TTGAGTATCTACTAGGTGCCAGG - Intergenic
931073805 2:58686081-58686103 CTCAGGATTTACTATGTCCTAGG - Intergenic
931161222 2:59692711-59692733 ATAAGTACCTACTATGTGCCTGG + Intergenic
931664916 2:64603392-64603414 ATAAGCACGTACTATGTGCCAGG + Intergenic
931859791 2:66342716-66342738 CTGAGTACCTACTATGTGCTAGG - Intergenic
931873058 2:66482188-66482210 CTGAAAATCTACTATGTGCCAGG + Intronic
931935065 2:67187718-67187740 TTAAGTATGTACTATTTGCCAGG + Intergenic
932115379 2:69041999-69042021 CTGAGCATGTACTATGTGTCTGG - Intronic
932119098 2:69081807-69081829 GTGAGTTCGTACTATGTGCCAGG + Intronic
932257238 2:70298441-70298463 TTGAGCATCTACTATGTGCCAGG + Intronic
932399472 2:71469955-71469977 CTGAGTACCTACTACGTGCCTGG + Intronic
932455742 2:71848869-71848891 CTGAGCATGTACTATGTGCCAGG + Intergenic
932674489 2:73766886-73766908 CTCAGTATTCAATAGGTGCCGGG - Exonic
932681216 2:73827475-73827497 CTGAGTGTCTACTATGTGCCAGG - Intergenic
932694075 2:73939474-73939496 ATGAGCATGTACTATGTGCCAGG + Intronic
932746235 2:74335973-74335995 CTGAGTTTTTACTATGTGCTAGG + Intronic
932950465 2:76287228-76287250 CTGAGCATTTACCATGTGCCAGG - Intergenic
932970328 2:76533224-76533246 CTCAGTGTATTCTATGTGTCAGG + Intergenic
933059073 2:77712765-77712787 TTCAGCACCTACTATGTGCCTGG - Intergenic
933212119 2:79582246-79582268 CTGAGTATTTACCTTGTGCCTGG - Intronic
933272629 2:80249487-80249509 TTGAGCATGTACTTTGTGCCTGG + Intronic
933570085 2:84000253-84000275 CTTAGTACCTACTATGTGTCAGG + Intergenic
935043375 2:99456245-99456267 TTGAGTATCTACAATGTGCCAGG + Intronic
935185779 2:100731582-100731604 TGGAGTATGTATTATGTGCCAGG - Intergenic
935350005 2:102144567-102144589 TTGACTATCTACTATGTGCCAGG + Intronic
935398330 2:102634035-102634057 TTGAGTCTGTACTATGTACCAGG - Intronic
935522055 2:104119381-104119403 TTCAGTATTTTCTATCTGCCAGG + Intergenic
935638477 2:105268968-105268990 CCCAGCATGTGCTGTGTGCCAGG - Intronic
935697931 2:105786287-105786309 CTGAGCATGTGCTATGTGCCAGG + Intronic
935844237 2:107147331-107147353 CTGAATGTGTACTGTGTGCCAGG + Intergenic
936060200 2:109290311-109290333 ATAAGTATGTATTACGTGCCTGG - Intronic
936343464 2:111657625-111657647 CTGAGCATTGACTATGTGCCAGG - Intergenic
936400977 2:112164287-112164309 TCCAGTATTCACTATGTGCCAGG + Intronic
936593615 2:113826956-113826978 ATAGGTATATACTATGTGCCAGG + Intergenic
936854490 2:116940168-116940190 TTTAGTATCTACTATGTGCCAGG + Intergenic
936896349 2:117432305-117432327 TTGAATATTTACTATGTGCCAGG + Intergenic
937378067 2:121351450-121351472 CTCAGTAAGTACTAAGCTCCTGG - Intronic
937644936 2:124255859-124255881 TTGAGTACCTACTATGTGCCTGG - Intronic
937703462 2:124890926-124890948 CTGTGTATTTACCATGTGCCAGG + Intronic
938249283 2:129801423-129801445 CTGAGTGTGTACAATGTGCCAGG - Intergenic
938565067 2:132511715-132511737 CTTAATATGTACTACGTGCCAGG + Intronic
938732224 2:134155557-134155579 TCCAGTACTTACTATGTGCCAGG - Intronic
938736495 2:134191122-134191144 CTGGGTGCGTACTATGTGCCAGG - Intronic
938811863 2:134861412-134861434 TTGAGTATTTACTTTGTGCCAGG + Intronic
938946688 2:136218705-136218727 TTGAGTACTTACTATGTGCCAGG + Intergenic
939003545 2:136761795-136761817 ATTAGTGTCTACTATGTGCCTGG - Intergenic
939299332 2:140314706-140314728 TTGAGTATGTACCATGTGACAGG - Intronic
940248030 2:151641052-151641074 TTGAGTATCTACTATGTGTCAGG + Intronic
940324181 2:152407868-152407890 CTGAGTACCTACTGTGTGCCAGG - Intronic
940389518 2:153115679-153115701 TTCAGTACCTACTGTGTGCCAGG - Intergenic
940502768 2:154514970-154514992 CTAAGTATATACTATATGCCAGG - Intergenic
940834353 2:158504300-158504322 CTCAGTGTCCACTATGTGTCAGG - Intronic
940975992 2:159945101-159945123 CTCATTATGAATTATGTGCATGG + Intronic
941463989 2:165803364-165803386 CTGAGTATTAACTCTGTGCCAGG + Intergenic
941557209 2:166996159-166996181 CTGTGTATCTACTATGTACCAGG - Intronic
941585062 2:167348138-167348160 CTGAATATGTGTTATGTGCCAGG - Intergenic
941612619 2:167679797-167679819 TTGAGTATATACTATGAGCCAGG - Intergenic
941686406 2:168453328-168453350 TTGAGTATCTACAATGTGCCGGG + Intergenic
941907147 2:170727882-170727904 TTGAGTATATAGTATGTGCCAGG - Intergenic
941962883 2:171270844-171270866 CTCAGCATCTACTGTATGCCAGG - Intergenic
942720305 2:178944286-178944308 CTGAATAGTTACTATGTGCCAGG - Intronic
942895298 2:181046088-181046110 CTGATTATCTACCATGTGCCAGG - Intronic
942981405 2:182087590-182087612 CTGAGTACCTACTGTGTGCCAGG - Intronic
943176828 2:184486697-184486719 ATTAGGATGTACTGTGTGCCAGG - Intergenic
943765195 2:191653424-191653446 CACAGTGACTACTATGTGCCAGG - Intergenic
943767281 2:191677035-191677057 CTGAGTATGTACTATTTGCTAGG + Intergenic
943809402 2:192165418-192165440 ATGAGTACGTACTATGTGTCAGG - Intronic
944321855 2:198354966-198354988 TTGAGTATTTACTATGTGCCTGG + Intronic
944417370 2:199492343-199492365 TTCAGTATTTACTATGTGACAGG + Intergenic
944679805 2:202066616-202066638 TTGAGCATGTACTATGTGCCTGG + Intergenic
945007052 2:205419757-205419779 CTGAGAGTCTACTATGTGCCTGG - Intronic
945062839 2:205923983-205924005 CTGAGCATGTACTGTGTGCCAGG + Intergenic
945075705 2:206037063-206037085 CTGAGAATGCACTAGGTGCCAGG - Intronic
945947071 2:216004583-216004605 TTGAGCATTTACTATGTGCCAGG - Intronic
946001539 2:216486546-216486568 TTCAGTACTTACTAGGTGCCAGG + Intergenic
946033501 2:216723767-216723789 CTGAGTACCTACTATGTGCCAGG + Intergenic
946132544 2:217618064-217618086 CTGAGTACCTACTATGTGCCAGG + Intronic
946148127 2:217746191-217746213 TTTAGTATTTACTATGTGCCAGG - Intronic
946235185 2:218320141-218320163 GTGAGTATGTAATATGTACCTGG + Intronic
946270813 2:218591940-218591962 CAGAGTACCTACTATGTGCCCGG - Intronic
946282331 2:218674990-218675012 TTGAATATTTACTATGTGCCAGG + Intronic
946342708 2:219081528-219081550 CTGAGAGTCTACTATGTGCCAGG + Intronic
946343757 2:219091035-219091057 ATAAGTATCTACTATGTGCCAGG + Intronic
946477869 2:220026029-220026051 CTCAGTATTTACTGTGTAACGGG - Intergenic
946485110 2:220094097-220094119 TTGAGAATATACTATGTGCCAGG + Intergenic
946627210 2:221626117-221626139 TACAGTATTTACTATATGCCAGG - Intergenic
946778065 2:223164703-223164725 TTTAGCATCTACTATGTGCCAGG + Intronic
946965905 2:225037685-225037707 TTAAGAATGTACGATGTGCCTGG - Intronic
946984303 2:225254969-225254991 CTGAATATCTACTATGTGCAGGG - Intergenic
947073798 2:226319550-226319572 TTGAGTGTCTACTATGTGCCAGG - Intergenic
947163872 2:227241761-227241783 CTGCATATGTACTCTGTGCCAGG + Intronic
947336470 2:229090812-229090834 TTGAACATGTACTATGTGCCAGG + Intronic
947375624 2:229492148-229492170 CTGAATGTGTACTATGTGCCAGG - Intronic
947378024 2:229517213-229517235 TTAAGCATATACTATGTGCCAGG + Intronic
947655058 2:231819825-231819847 CTTACTATGTACTAGGTGCTGGG + Intergenic
947788348 2:232845233-232845255 TTAAGTAGTTACTATGTGCCAGG - Intronic
948278486 2:236728342-236728364 CTGAGCATCTACTATGTGCAAGG + Intergenic
948417836 2:237828000-237828022 CTGAGCACCTACTATGTGCCAGG - Intronic
1168887222 20:1267966-1267988 CTGAGAACCTACTATGTGCCAGG - Intronic
1169100337 20:2942064-2942086 CTCAGTATTTACTATGTGCTAGG - Intronic
1169493877 20:6094613-6094635 CTGAGCATGTACTATGAACCAGG + Intronic
1169510267 20:6256257-6256279 CTGAGCACCTACTATGTGCCAGG - Intergenic
1169735565 20:8834090-8834112 TTGAGCATGTACTATGTGCCAGG + Intronic
1169817406 20:9672327-9672349 CTGAGTATCTAGTATGTGCCAGG - Intronic
1170114651 20:12844234-12844256 TTGAGCATTTACTATGTGCCAGG - Intergenic
1170200339 20:13736545-13736567 TTAAGTATTTACTATGTGTCTGG - Intronic
1170301145 20:14885902-14885924 TTGAGTATCTACAATGTGCCAGG + Intronic
1170587281 20:17744402-17744424 CTGAGCACCTACTATGTGCCTGG + Intergenic
1170605565 20:17873067-17873089 CTAAGCACTTACTATGTGCCAGG + Intergenic
1171118457 20:22547701-22547723 TTCAGTGCCTACTATGTGCCAGG + Intergenic
1171314647 20:24178640-24178662 CTGAGCACTTACTATGTGCCAGG - Intergenic
1171521856 20:25782182-25782204 TACAGTAGTTACTATGTGCCAGG + Intronic
1171554969 20:26073701-26073723 TACAGTAGTTACTATGTGCCAGG - Intergenic
1171852910 20:30321196-30321218 CTGAGTATGTACTATGCACTAGG - Intergenic
1171934313 20:31259072-31259094 TTGAGCATCTACTATGTGCCAGG - Intronic
1172020481 20:31910309-31910331 CTGAGCATGTACCATGTGCCAGG + Intronic
1172113226 20:32559718-32559740 CTCAGTACCTACTAAGTGCCAGG - Intronic
1172147255 20:32765149-32765171 CTCAATTAGTAGTATGTGCCTGG - Intronic
1172438703 20:34949772-34949794 TTGAGTATTTAGTATGTGCCAGG - Intronic
1172606182 20:36215748-36215770 ATTAGTCTGTACTATCTGCCTGG + Intronic
1172718302 20:36980324-36980346 TTCAGCATTTTCTATGTGCCAGG + Intergenic
1172801297 20:37578119-37578141 CTGAGCACCTACTATGTGCCAGG + Intergenic
1172803224 20:37592887-37592909 CTGAGAATTTACTCTGTGCCAGG + Intergenic
1172830703 20:37831760-37831782 CTGAGTACCAACTATGTGCCAGG - Intronic
1172836617 20:37877408-37877430 CTGAGCATCTACTGTGTGCCAGG + Intergenic
1172844473 20:37921492-37921514 CTGAGCATCTACTATGTGCATGG + Intronic
1172880564 20:38197043-38197065 CTGAGTACCTGCTATGTGCCAGG + Intergenic
1173056056 20:39613888-39613910 CTGAGTGCCTACTATGTGCCAGG - Intergenic
1173059446 20:39647625-39647647 CTGAGTATTTACTATGTGCTGGG - Intergenic
1173202926 20:40967221-40967243 CTGAGCATCTACTGTGTGCCAGG - Intergenic
1173278762 20:41608050-41608072 CTGAGTGCTTACTATGTGCCAGG - Intronic
1173354206 20:42271564-42271586 CTGAGTACCTACTATGTGTCAGG - Intronic
1173446610 20:43124678-43124700 CTGAGTGCCTACTATGTGCCAGG + Intronic
1173498714 20:43536927-43536949 CTGAGCATCTACTATGGGCCAGG + Intronic
1173531045 20:43769811-43769833 CTGAGCATTTACTATGTACCAGG - Intergenic
1173560437 20:44001382-44001404 CTGAGTACCTACTATGTGCCAGG - Intronic
1173697802 20:45035890-45035912 TTGAAAATGTACTATGTGCCAGG + Intronic
1173789631 20:45819549-45819571 TTCAGTGCTTACTATGTGCCAGG - Intergenic
1173804764 20:45917274-45917296 GTCAGTACCTACTGTGTGCCAGG - Intergenic
1173862443 20:46293040-46293062 CTGAGCATCTACTCTGTGCCAGG - Intronic
1173866502 20:46315920-46315942 TTGAGTACCTACTATGTGCCAGG - Intergenic
1173973264 20:47168595-47168617 CTGAGCACTTACTATGTGCCAGG - Intronic
1174041143 20:47700432-47700454 CTGAGTATTTACTACGTGCAAGG + Intronic
1174074613 20:47924481-47924503 CTGAGCATGTACTATATGCCAGG - Intergenic
1174105939 20:48162100-48162122 CTGAGAATTTACTATGGGCCGGG - Intergenic
1174231879 20:49052230-49052252 CTAAATATGTACTGTGTGCCAGG + Intronic
1174330128 20:49811523-49811545 TTGAGTGTCTACTATGTGCCAGG + Intergenic
1174467094 20:50726009-50726031 TTGAGTATCTATTATGTGCCAGG - Intergenic
1174505015 20:51011762-51011784 CTGAATACCTACTATGTGCCAGG - Intronic
1174518318 20:51110419-51110441 TTGAGCATGTACTATGTGCTGGG - Intergenic
1174558119 20:51411036-51411058 CTGGGTATTTACTCTGTGCCAGG + Intronic
1174580037 20:51564787-51564809 CTCAGTACCTACTAGGTGCCAGG + Intergenic
1174622495 20:51886665-51886687 TTGAGCATCTACTATGTGCCTGG - Intergenic
1174622901 20:51890223-51890245 CTGAGCATGTACTGTGTGCCAGG - Intergenic
1174709396 20:52688884-52688906 CAGAGTACGTACTATGTGCTTGG + Intergenic
1174715736 20:52756361-52756383 CTAAGTTTCTACTATGTGCCTGG + Intergenic
1174763712 20:53231625-53231647 CTGAGCATTTACTACGTGCCTGG + Intronic
1174772662 20:53315668-53315690 CTCAGCATATTCTATGTGCCAGG + Intronic
1174775676 20:53341113-53341135 TTGAGCATCTACTATGTGCCAGG - Intronic
1174830614 20:53808814-53808836 CTGAGCACCTACTATGTGCCAGG - Intergenic
1174866408 20:54140550-54140572 TTGAGCATCTACTATGTGCCGGG + Intergenic
1174870854 20:54180648-54180670 TTGAGCATCTACTATGTGCCAGG + Intergenic
1175102267 20:56587819-56587841 CTGAGCACCTACTATGTGCCAGG + Intergenic
1175192503 20:57221057-57221079 CTGAGCACCTACTATGTGCCAGG + Intronic
1175202643 20:57288793-57288815 CTCAGCATTTGCTCTGTGCCGGG + Intergenic
1175373476 20:58508701-58508723 CTGAGTACCTACTATGTGCCAGG + Intronic
1175379732 20:58554531-58554553 CTAAGCATGCACCATGTGCCTGG + Intergenic
1175388072 20:58610017-58610039 CTGAGTGTTTACTGTGTGCCAGG - Intergenic
1175740020 20:61413661-61413683 CTGAGCATCTACTATGTGCAAGG - Intronic
1176991401 21:15501557-15501579 TTGAGTACCTACTATGTGCCTGG + Intergenic
1177125782 21:17191812-17191834 CTCAGCTTGTGCTATGGGCCTGG - Intergenic
1177297351 21:19193386-19193408 CAAATTATATACTATGTGCCAGG + Intergenic
1177504680 21:22004943-22004965 CGCAGTGCTTACTATGTGCCAGG - Intergenic
1177756801 21:25358259-25358281 CTGAGTACCTACTGTGTGCCAGG - Intergenic
1178137583 21:29645097-29645119 CTGATAATTTACTATGTGCCAGG + Intronic
1178269860 21:31179490-31179512 TTAAGTATTTACTATGTGCCAGG - Intronic
1178335059 21:31735131-31735153 TTGAGCATGTACTTTGTGCCAGG + Intergenic
1178703115 21:34850930-34850952 TTGAGTATGTATTGTGTGCCAGG + Intronic
1178952565 21:36997191-36997213 TTGAGCATGTACTGTGTGCCAGG - Intergenic
1179419092 21:41221854-41221876 GTCAGTGTCTACTGTGTGCCTGG + Intronic
1179722376 21:43323020-43323042 ATGAGCATGTACTATGTGCCAGG - Intergenic
1180152699 21:45959821-45959843 CTCAGGATGGACTCTGTGTCTGG - Intergenic
1180539484 22:16429805-16429827 CTGAATATCTACTCTGTGCCAGG - Intergenic
1181079877 22:20406810-20406832 CTCAGCACATACTACGTGCCTGG + Exonic
1181117417 22:20641406-20641428 CACAGTACACACTATGTGCCAGG + Intergenic
1181365249 22:22371516-22371538 CTGAATACCTACTATGTGCCAGG + Intergenic
1181546882 22:23607240-23607262 CTGAGTGTGTCCTGTGTGCCAGG + Intergenic
1181726834 22:24817223-24817245 CTGGGGATGTACTATGTGCCAGG + Intronic
1181768042 22:25106000-25106022 CTGAGCACTTACTATGTGCCAGG - Intronic
1181776112 22:25161167-25161189 CTGAGCACTTACTATGTGCCAGG + Intronic
1181841627 22:25667912-25667934 CTGACCATGTACGATGTGCCAGG + Intronic
1181906803 22:26204175-26204197 TTGAGTATCTACAATGTGCCAGG + Intronic
1181920116 22:26313996-26314018 CTAAGCATCTACTATGTGCCGGG + Intronic
1181945463 22:26513600-26513622 CTGAGTACATACTATGTGTCAGG - Intergenic
1181968806 22:26674836-26674858 CTAAGGATCTACTATGTGCCAGG + Intergenic
1181986523 22:26803725-26803747 TTGAGTATGTGCTATGTGCCAGG + Intergenic
1182001338 22:26922226-26922248 CTGAGTACCTACTATGTACCTGG + Intergenic
1182060577 22:27394285-27394307 CTGAACATTTACTATGTGCCTGG - Intergenic
1182104568 22:27680276-27680298 TTGAGCATCTACTATGTGCCAGG - Intergenic
1182125782 22:27815030-27815052 CTGAGCACTTACTATGTGCCAGG + Intergenic
1182125963 22:27816027-27816049 CTGAGCACCTACTATGTGCCAGG + Intergenic
1182360738 22:29745036-29745058 CTGAGCATGTCCTGTGTGCCAGG + Intronic
1182592765 22:31394794-31394816 TTCAGTTTGTATTATATGCCAGG - Intergenic
1182671265 22:31997868-31997890 ATGAGCATCTACTATGTGCCAGG + Intergenic
1182753861 22:32662688-32662710 TTGAGTATTTATTATGTGCCAGG - Intronic
1182770463 22:32792067-32792089 GTGAGAATTTACTATGTGCCAGG + Intronic
1182776635 22:32836252-32836274 CTGAGCACTTACTATGTGCCAGG - Intronic
1182830275 22:33299422-33299444 GTGAGCATGTACTATGTGTCAGG - Intronic
1183099404 22:35574707-35574729 CTGAGTACCTACTATGTGCCAGG - Intergenic
1183235303 22:36612378-36612400 TTAAGCATCTACTATGTGCCAGG - Intronic
1183242113 22:36665426-36665448 CTGAGCATTTACTATGTGCCAGG - Intronic
1183329824 22:37213380-37213402 CTGAGCACCTACTATGTGCCAGG + Intergenic
1183391294 22:37546828-37546850 CTGAGCACCTACTATGTGCCAGG - Intergenic
1183516742 22:38271274-38271296 CTGAGCATCTACTATGTGCCAGG - Intronic
1183675442 22:39296732-39296754 CTGAGCATCTACTATATGCCAGG - Intergenic
1184180474 22:42820500-42820522 CTGAGCACCTACTATGTGCCAGG + Intronic
1184341794 22:43890180-43890202 CTGAGCACCTACTATGTGCCAGG - Intronic
1184381878 22:44149811-44149833 CTGAGCAGCTACTATGTGCCAGG - Intronic
1184390029 22:44198415-44198437 CTGAGCATGTACTATATACCAGG + Intronic
1184402893 22:44284259-44284281 CTGAGGACCTACTATGTGCCAGG + Intronic
1184406396 22:44303170-44303192 CTGAGCATCTACTATGTGCCCGG + Intronic
1184557001 22:45238997-45239019 CTGAGCACTTACTATGTGCCGGG - Intronic
1184579299 22:45403373-45403395 TTGAGTATCTACTATGAGCCAGG + Intronic
1184672607 22:46023283-46023305 CTAAGCACTTACTATGTGCCCGG + Intergenic
1184801212 22:46761329-46761351 CTTAGTACTTACTATGTGCAAGG - Intergenic
949237966 3:1833717-1833739 ATCAAGATGTTCTATGTGCCAGG + Intergenic
949293331 3:2491169-2491191 CTGAGTACGTACTATGTGCTGGG - Intronic
949373842 3:3365094-3365116 TTGAGCATTTACTATGTGCCAGG - Intergenic
949384506 3:3485304-3485326 CTCAGTGCCTACAATGTGCCAGG + Intergenic
949425957 3:3916207-3916229 ATGGGTATCTACTATGTGCCAGG + Intronic
949480716 3:4492281-4492303 CTGAGTGTTTACTAGGTGCCAGG - Intergenic
949672818 3:6419148-6419170 TTGAGTATTTACAATGTGCCAGG - Intergenic
949725192 3:7035915-7035937 TTGAGCATATACTATGTGCCAGG + Intronic
949793370 3:7818289-7818311 CTGAGTGTCTATTATGTGCCAGG + Intergenic
949824991 3:8156030-8156052 GTGAGCATGTACTATGTGCAGGG - Intergenic
949904075 3:8843821-8843843 CTGAGCATCTACTAAGTGCCAGG - Intronic
949948186 3:9206958-9206980 CTGAGCATCTACTATGTGCCAGG - Intronic
950151480 3:10690954-10690976 TTCAGCACCTACTATGTGCCAGG - Intronic
950269181 3:11599880-11599902 CTGAGTACTTACTATCTGCCAGG + Intronic
950580890 3:13861389-13861411 TTGAGCATCTACTATGTGCCAGG + Intronic
950668824 3:14513171-14513193 CTGAGCACCTACTATGTGCCAGG + Intronic
950680648 3:14582927-14582949 CTGAGCAGCTACTATGTGCCAGG - Intergenic
951215454 3:20020492-20020514 TTGAGGATGTACTATTTGCCAGG + Intergenic
951409211 3:22341863-22341885 CTGAGCACCTACTATGTGCCTGG - Intronic
951586296 3:24218609-24218631 GTGAGTATCTACTATGTGCCAGG + Intronic
951595321 3:24312374-24312396 GTTAGTATTTACTCTGTGCCAGG - Intronic
951596829 3:24327531-24327553 CTAAGCACCTACTATGTGCCAGG + Intronic
951605398 3:24428237-24428259 TTGAGTACCTACTATGTGCCTGG + Intronic
951662733 3:25087622-25087644 CTGAGCTTTTACTATGTGCCAGG - Intergenic
951812942 3:26721063-26721085 TTAAGGATTTACTATGTGCCAGG + Intergenic
951826150 3:26871386-26871408 TTAAATATGTACCATGTGCCAGG + Intergenic
952539564 3:34353390-34353412 CTCAGTAATTACTATGTACTTGG - Intergenic
952716930 3:36489259-36489281 TTGAGTATTCACTATGTGCCAGG - Intronic
952850760 3:37726762-37726784 CTCAGGAGCTACTAAGTGCCAGG + Intronic
953329022 3:42036320-42036342 CTGAGTACCTACTATGTACCAGG - Intronic
953368416 3:42366749-42366771 CCGAGTACCTACTATGTGCCAGG + Intergenic
953436938 3:42884956-42884978 TAGAGTATTTACTATGTGCCAGG - Intronic
953596046 3:44315067-44315089 CTAAATATTTACTCTGTGCCAGG - Intronic
953700561 3:45192303-45192325 CAGACTATGGACTATGTGCCAGG - Intergenic
954025398 3:47779106-47779128 CTGAGCATTTACCATGTGCCGGG - Intronic
954075359 3:48174617-48174639 CTCAGTGCCTACTATGTGCCAGG - Intronic
954099202 3:48356405-48356427 CTAAATACCTACTATGTGCCAGG + Intergenic
954235509 3:49254171-49254193 ATGAGCATATACTATGTGCCAGG - Intronic
954734901 3:52698808-52698830 CCTGGTATTTACTATGTGCCAGG + Intronic
954847169 3:53569467-53569489 ATAAGTACCTACTATGTGCCAGG - Intronic
954902415 3:54031227-54031249 CTGAGTATGTGCTATATGCCAGG - Intergenic
954928699 3:54261064-54261086 CTGAGCATCTACTATGCGCCAGG - Intronic
955004063 3:54953138-54953160 CTGAATATTTACTATGTGCCTGG + Intronic
955073265 3:55589507-55589529 TTGAGTATTTACTATGTGCAAGG - Intronic
955088943 3:55730491-55730513 CTGAGCACCTACTATGTGCCTGG + Intronic
955152669 3:56383535-56383557 TTGAGTATCCACTATGTGCCAGG - Intronic
955205294 3:56890271-56890293 CTGAGCATTTACTATGTGCCAGG + Intronic
955229866 3:57089234-57089256 CTGAGCATGGACTATGAGCCAGG + Intergenic
955352396 3:58203437-58203459 TTCAGTACCTACTATGTACCAGG - Intronic
955397793 3:58569410-58569432 CTGAGTACCTACTATGTGCTGGG - Intronic
955413388 3:58670406-58670428 CTGAGCATCTACTATGGGCCAGG - Intergenic
955475191 3:59329157-59329179 CTGAGCATTTACTATATGCCAGG + Intergenic
955597139 3:60603882-60603904 CTGAGCATTTGCTATGTGCCCGG + Intronic
955697946 3:61655436-61655458 CTGAACATCTACTATGTGCCAGG - Intronic
955863459 3:63356715-63356737 CTGAGTACCTAGTATGTGCCAGG - Intronic
955998444 3:64702489-64702511 CTGAGCAGGTACTATATGCCAGG - Intergenic
956082425 3:65572146-65572168 CTGAGCATTTATTATGTGCCAGG + Intronic
956137392 3:66112613-66112635 CTGAGCATGTATTATGTGCCAGG - Intergenic
956190585 3:66604043-66604065 CTGAGCACCTACTATGTGCCAGG - Intergenic
956293095 3:67682346-67682368 CTGAGTGTCTACTATGTGACAGG - Intergenic
956323264 3:68022876-68022898 TTAAGTGTTTACTATGTGCCTGG + Intronic
956335321 3:68156753-68156775 CTGAGTATGTGTTCTGTGCCAGG + Intronic
956341175 3:68225582-68225604 CTGAGCACTTACTATGTGCCAGG + Intronic
956511562 3:69999267-69999289 CTAAGTACCTACTAAGTGCCAGG + Intergenic
956724765 3:72147913-72147935 CTGAGTACCTACTATGTGCCAGG - Intergenic
957226077 3:77448634-77448656 CTTAATATATACTCTGTGCCAGG - Intronic
957553278 3:81733866-81733888 TTGAGTATTTACTATGAGCCAGG - Intronic
957573821 3:81984144-81984166 CTCAATTTCTACTATGTGTCAGG - Intergenic
957760901 3:84554957-84554979 TTGTGTATTTACTATGTGCCAGG - Intergenic
958056765 3:88422376-88422398 CTGAGTATTCACTATGTACCAGG - Intergenic
958673522 3:97235249-97235271 CTTAGTGTCTACTATATGCCAGG - Intronic
958685380 3:97386630-97386652 GACAGTTTGTACTGTGTGCCTGG - Intronic
958718573 3:97818238-97818260 CACAGTATTTACTGTGTGGCAGG - Intergenic
959040072 3:101411204-101411226 TTGTGTATTTACTATGTGCCAGG - Intronic
959205238 3:103298462-103298484 CTTAGTATCTAGTAAGTGCCAGG + Intergenic
959539230 3:107521838-107521860 TTCAGCATCTACTATGTGTCAGG - Intergenic
959603103 3:108211065-108211087 ATGAGTATGTACTATGCACCAGG + Intronic
959758149 3:109924628-109924650 GTGAGTACCTACTATGTGCCTGG + Intergenic
959892857 3:111575989-111576011 ATGAGTATTCACTATGTGCCTGG - Intronic
960005821 3:112780233-112780255 TTCAGTATCTACTATGTACCAGG - Intronic
960212347 3:114985214-114985236 ATCAGTGCTTACTATGTGCCAGG - Intronic
960270289 3:115666545-115666567 CTGAGTATGTACAAAGTGTCAGG + Intronic
960290241 3:115875511-115875533 TTGAGTATCTACTATGTGACAGG - Intronic
960363299 3:116740607-116740629 CAGAGGATTTACTATGTGCCAGG + Intronic
961051580 3:123751603-123751625 TTCAGTATCTACCATGTGCCAGG + Intronic
961065081 3:123868448-123868470 CTGAGCACTTACTATGTGCCAGG + Intronic
961361516 3:126371014-126371036 CTGAGTACCTACTATGTGCCTGG + Intergenic
961516402 3:127440150-127440172 CTGAGGACCTACTATGTGCCAGG - Intergenic
961538321 3:127583587-127583609 CTTAGGATCTACTATGTGTCAGG - Intronic
961584434 3:127910520-127910542 CTGAGTACCTACTTTGTGCCAGG + Intergenic
961676086 3:128567652-128567674 CTGAGCATGTGCCATGTGCCAGG - Intergenic
961749473 3:129086914-129086936 CTGAGCATCTACTGTGTGCCTGG + Intergenic
961786541 3:129350457-129350479 TTGAGTATCTACTATGTGCCAGG - Intergenic
961829352 3:129615541-129615563 CTAAGCACCTACTATGTGCCAGG + Intergenic
962005889 3:131349357-131349379 CTCAATGTCTATTATGTGCCAGG - Intronic
962019378 3:131481384-131481406 CTGAGCATTTATTATGTGCCAGG + Intronic
962255471 3:133867310-133867332 CTCAGCCCCTACTATGTGCCTGG - Intronic
962284399 3:134074367-134074389 CTGAGGACTTACTATGTGCCTGG - Intronic
962341946 3:134593301-134593323 CTGAGTACTTACTATGTGCCCGG + Intergenic
962576956 3:136763608-136763630 CCCAGAATGCACCATGTGCCTGG + Intergenic
962607005 3:137040687-137040709 CTGACTACCTACTATGTGCCTGG - Intergenic
962629185 3:137258724-137258746 CTGAATATCTATTATGTGCCAGG - Intergenic
962696319 3:137950882-137950904 TTGAGTATCTACTATGTGCTGGG - Intergenic
962721697 3:138181622-138181644 CTAGGTACCTACTATGTGCCAGG - Intergenic
962859174 3:139382035-139382057 TTGAGCATTTACTATGTGCCAGG + Intronic
962932364 3:140050116-140050138 CTGAGAATATACTGTGTGCCAGG - Intronic
963061107 3:141227563-141227585 TACAGTACCTACTATGTGCCTGG + Intergenic
963082730 3:141409585-141409607 CTTAGTATCAACTACGTGCCAGG + Intronic
963180414 3:142349402-142349424 CTGAGTGTCTTCTATGTGCCAGG + Intronic
963203619 3:142610145-142610167 TTAAGTATCTCCTATGTGCCAGG + Intronic
963237823 3:142972891-142972913 CTAAGTGCCTACTATGTGCCAGG - Intronic
963528688 3:146446940-146446962 AACAGTATGTATTATGGGCCTGG - Intronic
963616271 3:147542207-147542229 CTCAGTATCTACAATGTGTTAGG + Intergenic
963704927 3:148674939-148674961 TTGAGTACCTACTATGTGCCAGG + Intergenic
963720608 3:148857970-148857992 CTGAGCACTTACTATGTGCCAGG + Intronic
963736711 3:149025510-149025532 TTAAGCATTTACTATGTGCCAGG - Intronic
963738255 3:149046613-149046635 CTAAGTATCTATTAAGTGCCAGG + Intronic
963925004 3:150942542-150942564 CTGAGCACCTACTATGTGCCAGG + Intronic
963994919 3:151697259-151697281 CTGAGTGCTTACTATGTGCCAGG + Intergenic
964025031 3:152062680-152062702 CTGAGCATCTACTATGAGCCAGG + Intergenic
964526001 3:157615855-157615877 CTCAGTAGGTACCATGTGTCAGG - Intronic
964687725 3:159415822-159415844 TTGAGTACTTACTATGTGCCAGG - Intronic
964709758 3:159659097-159659119 TCAAGTATGTACTATGTGCCCGG - Intronic
964718411 3:159747104-159747126 CCAAATATCTACTATGTGCCAGG - Intronic
964736920 3:159927212-159927234 CTGAGTACCTATTATGTGCCAGG + Intergenic
964827671 3:160848114-160848136 TTAAATATGTACTATGTGTCGGG - Intronic
964836626 3:160946373-160946395 TGCAGTATTTACTATGTACCAGG - Intronic
964849204 3:161076982-161077004 GTGAGCATCTACTATGTGCCAGG + Exonic
965391058 3:168104503-168104525 TTCAGTGTTTACTATGTACCAGG - Intergenic
965453849 3:168873196-168873218 CTGAGTATCTACTATGTGTCAGG - Intergenic
965533262 3:169798164-169798186 CTGAGTTTGTCCTCTGTGCCTGG - Intronic
965607882 3:170514843-170514865 CTGAGCATTTACTATGTGCATGG + Intronic
965676196 3:171199485-171199507 CTGAGAATTTACCATGTGCCAGG + Intronic
965728130 3:171741945-171741967 CTAAATATGTACTACATGCCAGG + Intronic
965778038 3:172254519-172254541 CTGAGTACCTACTATGTGTCAGG - Intronic
966219189 3:177533755-177533777 CTGACTATTCACTATGTGCCAGG + Intergenic
966241994 3:177764863-177764885 TTCAGTACCTACTATGTGCCAGG + Intergenic
966253270 3:177890715-177890737 TTGAGTATCTACTATGTGCCAGG - Intergenic
966261884 3:177988171-177988193 TTGAGCATGTACTATGTGTCAGG - Intergenic
966322040 3:178711759-178711781 CTGAGAATTTTCTATGTGCCAGG + Intronic
966324051 3:178734484-178734506 CTAAGCACCTACTATGTGCCAGG - Intronic
966339304 3:178907321-178907343 CTTAGTATTTACTATGTCCCAGG + Intergenic
966415808 3:179688251-179688273 CTCAGTAGCTGCTATATGCCAGG + Intronic
966421663 3:179740073-179740095 CTGGGTGTTTACTATGTGCCAGG - Intronic
966437896 3:179908985-179909007 TTCAGTACCTACTATGTGCTGGG - Intronic
966564058 3:181356423-181356445 CTGAGTACTTACTATGTGCTGGG + Intergenic
966681887 3:182650625-182650647 TTCAGTAGCCACTATGTGCCAGG - Intergenic
966949834 3:184806294-184806316 CTGAGTACCTATTATGTGCCAGG - Intergenic
967048312 3:185757815-185757837 CTGAGCATTTGCTATGTGCCTGG - Intronic
967332701 3:188307653-188307675 CTGAGCATCTATTATGTGCCAGG - Intronic
967712966 3:192730174-192730196 CTCAGAGCTTACTATGTGCCAGG + Intronic
967834517 3:193949810-193949832 GTTAGCATGTACTATGTGCCAGG + Intergenic
968007148 3:195250868-195250890 CTGGGCATCTACTATGTGCCAGG - Intronic
968102418 3:195976052-195976074 CTAAGCATCTACTGTGTGCCAGG + Intergenic
968539343 4:1155485-1155507 CACAGAGTGTACTGTGTGCCAGG - Intergenic
968691186 4:1991172-1991194 CTGAGCATGTACTCTGGGCCAGG + Intronic
968752923 4:2399553-2399575 CTGGGTATGTATGATGTGCCAGG - Intronic
968850998 4:3078248-3078270 CTAAACATGTACTATGTGCCTGG + Intronic
969063092 4:4454886-4454908 CTAAGCATTTACCATGTGCCAGG - Intronic
969077550 4:4592257-4592279 TTCAGTGCTTACTATGTGCCAGG - Intergenic
969091814 4:4699795-4699817 CTGAGCATCTAGTATGTGCCAGG + Intergenic
969253464 4:5986891-5986913 CTGCCTATCTACTATGTGCCAGG - Intronic
969255304 4:5997276-5997298 CTGAGCATCTACTATGTGGCAGG + Intergenic
969465430 4:7353524-7353546 CTGAGCATCTACTAAGTGCCAGG - Intronic
970008839 4:11436454-11436476 TTCAGTGTGTACTCTGTGTCAGG - Intergenic
970167066 4:13249956-13249978 CTAAGCATTTACTATGTGTCAGG + Intergenic
970216668 4:13765973-13765995 TTCAGCAGCTACTATGTGCCTGG - Intergenic
970352215 4:15213906-15213928 CTGAGTATAAACTCTGTGCCAGG + Intergenic
970489345 4:16556335-16556357 TTGAGTACTTACTATGTGCCAGG - Intronic
970515257 4:16822846-16822868 CTAAGCACATACTATGTGCCAGG + Intronic
970656546 4:18236737-18236759 CATAGTATTTACTATGTGTCAGG - Intergenic
970769257 4:19590867-19590889 CTGAGTACTTTCTATGTGCCAGG + Intergenic
970811026 4:20094149-20094171 CTGAGTATTTACTATGTGTTGGG + Intergenic
971063810 4:23004297-23004319 CCCAGTATCTATTGTGTGCCTGG + Intergenic
971356333 4:25898387-25898409 CTCAGCACCTGCTATGTGCCAGG - Intronic
971413876 4:26404684-26404706 TTGAGTGTTTACTATGTGCCAGG - Intronic
971457585 4:26859179-26859201 CTGAGTACCTAGTATGTGCCAGG - Intronic
972155638 4:36157695-36157717 GTGAGTATGTACTATGTGTAAGG - Intronic
972167561 4:36306068-36306090 TTAAGTACATACTATGTGCCAGG - Intronic
972296348 4:37743058-37743080 TTGAGTATCTATTATGTGCCAGG + Intergenic
972314687 4:37915123-37915145 TGAAGTATCTACTATGTGCCAGG - Intronic
972428535 4:38958390-38958412 AACAGTATTGACTATGTGCCAGG - Intergenic
972566729 4:40276215-40276237 GTGAGTACCTACTATGTGCCAGG - Intergenic
972575783 4:40350022-40350044 CTCAGTACTTACCATATGCCAGG - Intronic
972585339 4:40432553-40432575 CTGAGAATTTACTGTGTGCCTGG - Intronic
972644805 4:40957140-40957162 CTGAGTGATTACTATGTGCCCGG - Intronic
972812137 4:42601727-42601749 CTGAGTAGCTACTGTGTGCCAGG - Intronic
972869915 4:43285065-43285087 GTGAGTACTTACTATGTGCCAGG + Intergenic
973008112 4:45038878-45038900 CTGGGTATCTACTATGTGGCAGG + Intergenic
973153326 4:46915006-46915028 CTCAATATTTACTAAGGGCCAGG + Intergenic
973318673 4:48787733-48787755 TTCAGTATCTAGTATGTGTCCGG + Intergenic
973632628 4:52833710-52833732 CTGAGCATCTACTATGTACCAGG - Intergenic
973634673 4:52851036-52851058 TTAAGTATGTACCATGTCCCAGG - Intergenic
973662056 4:53118252-53118274 CTGAGCACCTACTATGTGCCAGG - Intronic
973798789 4:54455665-54455687 CTGAGTATATGCTTTGTGCCAGG + Intergenic
973820950 4:54660849-54660871 ATGAGTTTTTACTATGTGCCAGG + Intronic
973880235 4:55264066-55264088 TTAAGTATTTTCTATGTGCCAGG - Intergenic
973931465 4:55796818-55796840 CTGAGCATTTACTAAGTGCCTGG - Intergenic
974796544 4:66758835-66758857 TTGAGTATGTATTATGTGACAGG - Intergenic
975069464 4:70115610-70115632 TTGAGTATCTAGTATGTGCCAGG - Intergenic
975128263 4:70806384-70806406 CTGAATGTTTACTATGTGCCAGG - Intronic
975140070 4:70909543-70909565 ATGAGTGTTTACTATGTGCCAGG + Intronic
975273066 4:72461037-72461059 CTGAGTATGTTCTACATGCCAGG + Intronic
975382806 4:73721876-73721898 CACTGTATTTTCTATGTGCCAGG - Intergenic
975541631 4:75518458-75518480 AATAGTGTGTACTATGTGCCAGG + Intronic
975682274 4:76888605-76888627 GTGAGGATCTACTATGTGCCAGG + Intergenic
975685200 4:76913813-76913835 CTAACCATATACTATGTGCCAGG + Intergenic
976247565 4:83018952-83018974 CTGGGTATCTATTATGTGCCAGG + Intergenic
976275201 4:83269588-83269610 AGTAGTATTTACTATGTGCCAGG - Intronic
976327248 4:83785727-83785749 TTGAGTAGTTACTATGTGCCAGG + Intergenic
976385962 4:84458886-84458908 CTAAGAATTCACTATGTGCCAGG + Intergenic
976437706 4:85037253-85037275 ATAAGTATCCACTATGTGCCAGG - Intergenic
976546081 4:86337142-86337164 TTGAGTATCTACTATGTGCTAGG - Intronic
976618318 4:87100668-87100690 CTGAGCACTTACTATGTGCCAGG - Intronic
976836045 4:89375094-89375116 CTGAGCACTTACTATGTGCCAGG - Intergenic
977236131 4:94509490-94509512 CTAAGTATCTACTAAGTGCTAGG - Intronic
977787777 4:101058836-101058858 TTCAGTATCTACTAAGTACCAGG - Intronic
977914696 4:102578422-102578444 TTGAGTACCTACTATGTGCCAGG + Intronic
978368481 4:108007015-108007037 CTGAGCATCTACTATGTGCCGGG - Intronic
978405855 4:108377976-108377998 CTGAGTACCTACGATGTGCCTGG + Intergenic
979274876 4:118803968-118803990 TTCAGTACCTATTATGTGCCAGG - Intronic
979286391 4:118930131-118930153 CTGAGCATTTATTATGTGCCAGG + Intronic
979507079 4:121510546-121510568 TTAAGTATCTGCTATGTGCCAGG - Intergenic
979660311 4:123245888-123245910 CTGAGTATCTACTATGTGTCAGG - Intronic
979849530 4:125559226-125559248 TTAAGTATGTACTGGGTGCCAGG + Intergenic
979980252 4:127246452-127246474 ATGAGTATTTACCATGTGCCAGG + Intergenic
980077072 4:128305223-128305245 CTGAGCACTTACTATGTGCCAGG + Intergenic
980851810 4:138391817-138391839 TTGAGTTTGTACTATGTGCTTGG - Intergenic
980974168 4:139595165-139595187 TTGAATATTTACTATGTGCCAGG - Intronic
981004165 4:139858060-139858082 CTGAGTATCTACAATGTGACAGG + Intronic
981279130 4:142936818-142936840 CTAAGAATGTACTATGTTCCAGG + Intergenic
981304459 4:143231825-143231847 CTTAGCATCTACTATGTGCTAGG + Intergenic
981405508 4:144362896-144362918 CTGAGTATTCACTATGTGCAAGG - Intergenic
981434709 4:144706971-144706993 TTCCTTATTTACTATGTGCCAGG + Intronic
981595184 4:146412956-146412978 TTGAGTATTTACTGTGTGCCTGG - Intronic
981660711 4:147163418-147163440 CTGAGTATCTACTGTGTGCCAGG + Intergenic
981826733 4:148951271-148951293 CTTAGCATCTACTATGTGGCAGG + Intergenic
981848282 4:149195438-149195460 TTGAGCATCTACTATGTGCCAGG + Intergenic
981869287 4:149467383-149467405 TTGAGTATATACTATGTCCCGGG + Intergenic
982552021 4:156813974-156813996 CACAGCGTTTACTATGTGCCTGG - Intronic
982663812 4:158236233-158236255 TTGAGTATCTACTATGTGTCAGG - Intronic
983437267 4:167731383-167731405 CACAGCTTGTACTGTGTGCCTGG + Intergenic
983545267 4:168956648-168956670 CTAAGTACTTACTATATGCCAGG + Intronic
983910746 4:173236011-173236033 CTGAGTACCTACTATGTACCAGG - Intronic
983970125 4:173861295-173861317 TTCATCATTTACTATGTGCCAGG - Intergenic
984542003 4:181050670-181050692 CTCATTAAATACTAAGTGCCAGG - Intergenic
984551526 4:181165544-181165566 ATGAGTACTTACTATGTGCCAGG + Intergenic
984735281 4:183102368-183102390 CTCAGTGTGTATTGTGTGCTAGG + Intronic
984765761 4:183399222-183399244 TTCAGCATGTACTCTGGGCCAGG + Intergenic
984883043 4:184427003-184427025 CTCAGCACTTACTGTGTGCCAGG - Intronic
984891781 4:184500579-184500601 CTGAGTATAAAGTATGTGCCGGG + Intergenic
985123405 4:186666712-186666734 CTCAGTGTTTACTAAATGCCAGG + Intronic
985387743 4:189464838-189464860 TTAAGCATCTACTATGTGCCAGG - Intergenic
986121593 5:4842711-4842733 TTCTGTATGTGCTATGTGCCAGG + Intergenic
986450269 5:7856541-7856563 CTGAGTATTTACTATTTTCCAGG + Intronic
986642388 5:9884993-9885015 CTGAGTGTCTACTATGTACCAGG + Intergenic
986712831 5:10500220-10500242 CTCACTGTGTTCTATGTACCTGG - Intergenic
986805573 5:11305596-11305618 CTCAGTGTCTGCTATGAGCCAGG + Intronic
986900845 5:12431887-12431909 CTGAGAATGTACTATCTTCCAGG - Intergenic
987002732 5:13676673-13676695 CTGAGTATTTCCAATGTGCCAGG - Intergenic
987270577 5:16304348-16304370 TTGAGCATTTACTATGTGCCAGG + Intergenic
987713098 5:21529586-21529608 CTGAATATCTACTCTGTGCCAGG - Intergenic
988367097 5:30314349-30314371 CTCAGTGTTTACCATGTGCTGGG - Intergenic
988389217 5:30605812-30605834 GTCAATATTTACTCTGTGCCTGG + Intergenic
988829472 5:34973454-34973476 CTGAGCATCTACTGTGTGCCAGG + Intergenic
988994465 5:36701433-36701455 TTGAGTATCTACTATGTGCTAGG - Intergenic
989091272 5:37735124-37735146 CTCAGAATAGACTATTTGCCAGG - Intronic
989196574 5:38722521-38722543 CTGATTATCTACTATGTGCTAGG - Intergenic
989254795 5:39354613-39354635 CTGAGTACCTACTATGTTCCAGG + Intronic
989396353 5:40961304-40961326 CTAAGCATTTACTATGTGTCAGG - Intronic
989448890 5:41563800-41563822 TTGAGTATCTACTATGTTCCAGG + Intergenic
989490454 5:42047045-42047067 TTCAGTAACTACTATGTGCCAGG + Intergenic
989786309 5:45335715-45335737 CTGTGTACTTACTATGTGCCAGG + Intronic
990010964 5:50996966-50996988 TTGAGTATGTACTGTGTTCCAGG - Intergenic
990150186 5:52809190-52809212 CTAAGTACCTACTATGTGACAGG + Intronic
990363604 5:55047059-55047081 TTGAGTATCTACCATGTGCCAGG - Intergenic
990474246 5:56146221-56146243 CTCAGCATCTATAATGTGCCTGG - Intronic
990504318 5:56429728-56429750 CTGAGCACCTACTATGTGCCAGG + Intergenic
990560306 5:56977369-56977391 CTAAGCATTTACTAAGTGCCAGG - Intergenic
990670424 5:58123381-58123403 CTGAGTGCCTACTATGTGCCTGG + Intergenic
990737617 5:58881091-58881113 CTAGGTATCTACTATGTGCCAGG + Intergenic
990749268 5:58995574-58995596 TTGAGCATCTACTATGTGCCAGG - Intronic
990937658 5:61167250-61167272 CTTAGTATGTACCAGGTGCTGGG + Intergenic
991240219 5:64450181-64450203 CTGAGTGCTTACTATGTGCCTGG + Intergenic
991283572 5:64943576-64943598 TTCAATGTCTACTATGTGCCAGG + Intronic
991572831 5:68073748-68073770 CTGAGCATGTGCTATGTGCTGGG - Intergenic
991588081 5:68220009-68220031 CATAGTACTTACTATGTGCCAGG - Intronic
992025614 5:72666156-72666178 CTGAGTGCTTACTATGTGCCAGG + Intergenic
992226605 5:74624980-74625002 CTGAGGACCTACTATGTGCCAGG + Intergenic
992319961 5:75604021-75604043 CTCCGTATCTACTGTGTGCCAGG - Intergenic
992345025 5:75867875-75867897 CTGAGTGCATACTATGTGCCAGG + Intergenic
992401129 5:76412649-76412671 CTGAGTATCTTCTAAGTGCCAGG - Intronic
992713909 5:79490142-79490164 CTGAGTAATTACTGTGTGCCTGG - Intronic
992996850 5:82342902-82342924 CTAAGTGTCTACTATGTTCCAGG + Intronic
993278346 5:85891462-85891484 TTGAGTATTTTCTATGTGCCAGG - Intergenic
993418765 5:87672965-87672987 CTGAGTATATACTATATGCCAGG + Intergenic
993523743 5:88938470-88938492 CTCTGCACCTACTATGTGCCAGG - Intergenic
993619968 5:90156572-90156594 CTGAGAATTTACTATATGCCGGG - Intergenic
993658191 5:90598215-90598237 CTGAGTCTCTACTATCTGCCAGG - Intronic
993861376 5:93140886-93140908 TTCAGTATTGACTATGTGCTAGG - Intergenic
994013988 5:94943556-94943578 CTAAGTACTTATTATGTGCCAGG + Intronic
994102126 5:95904923-95904945 TTGAGCATATACTATGTGCCAGG - Intronic
994263953 5:97692502-97692524 TTGAGCATCTACTATGTGCCAGG + Intergenic
994873972 5:105392092-105392114 CTCAGTTTGTACTACTGGCCCGG + Intergenic
994954800 5:106514252-106514274 CTAAGTATTTATTGTGTGCCAGG - Intergenic
994980595 5:106871359-106871381 TTCAGAATATACTATGTGCCAGG + Intergenic
995016619 5:107317116-107317138 TTGAGTGTTTACTATGTGCCAGG + Intergenic
995066284 5:107866963-107866985 TTGAGTATATACTATGTGCTAGG - Intronic
995067893 5:107883128-107883150 CTGACTACGTTCTATGTGCCAGG + Intronic
995190085 5:109310496-109310518 CTGAGTATTTACAATGTGCCAGG + Intergenic
995314354 5:110751141-110751163 CTGAGTACTTACTATGTGCCAGG + Intronic
995872920 5:116761376-116761398 CAGAATATTTACTATGTGCCAGG + Intergenic
995990444 5:118231895-118231917 CTCAGTACCTACTCTGTACCTGG - Intergenic
996024340 5:118628312-118628334 CACAGTATCTACTACGTGCCTGG + Intergenic
996096977 5:119409294-119409316 CTCATTTAGTACCATGTGCCTGG + Intergenic
996300495 5:121978142-121978164 CTGAGCATTTACTATGTGCCAGG + Intronic
996411075 5:123159916-123159938 CTGAGTACCTACTATGTGTCTGG + Intronic
996439099 5:123469575-123469597 CTGAGTGCCTACTATGTGCCAGG + Intergenic
996672160 5:126130907-126130929 TTGAGTATCTACTATGTGCCAGG + Intergenic
997018725 5:129970296-129970318 TTGAGTACCTACTATGTGCCAGG - Intronic
997165062 5:131652290-131652312 TTAAGTGTCTACTATGTGCCAGG + Intronic
997193967 5:131965314-131965336 CTAAGCATCTCCTATGTGCCCGG + Intronic
997220951 5:132163478-132163500 CTCAGTGTATATTATATGCCAGG - Intergenic
997435378 5:133870329-133870351 CTGAGTACTCACTATGTGCCAGG + Intergenic
997467855 5:134100155-134100177 CTCAGGGAGTACTAAGTGCCAGG + Intergenic
997469950 5:134111998-134112020 CTGAGTGATTACTATGTGCCAGG - Intergenic
997723041 5:136095954-136095976 CTGAGTGTCTACTATGTGCCAGG + Intergenic
997805965 5:136918112-136918134 ATAAGTATCTATTATGTGCCTGG - Intergenic
997824625 5:137095614-137095636 TGCAGTGTGTACTCTGTGCCAGG - Intronic
997838049 5:137212501-137212523 CTGAATATGTACTATGTGTCAGG + Intronic
998006858 5:138662799-138662821 CTGAGCATCTACTATGTGCCAGG - Intronic
998054963 5:139066631-139066653 CTGACCATCTACTATGTGCCAGG + Intronic
998136156 5:139675822-139675844 CTGAGTATCTACTGTGTCCCAGG - Intronic
998146611 5:139732791-139732813 CAGAGCATTTACTATGTGCCAGG - Intergenic
998173248 5:139884758-139884780 TTGAGTATCAACTATGTGCCAGG - Intronic
998229367 5:140350168-140350190 GTAAGTACCTACTATGTGCCAGG - Intergenic
998457534 5:142284789-142284811 CTTGGCATGTACTATGTGCGAGG + Intergenic
998480285 5:142457609-142457631 TTGAGCATTTACTATGTGCCAGG + Intergenic
998599674 5:143572650-143572672 TTCAGTGTTTGCTATGTGCCAGG - Intergenic
998669187 5:144334556-144334578 CTGAGTGTGTGCTATGTGCCAGG + Intronic
998766082 5:145488706-145488728 TTCAGTGTTTACTATGTGCTAGG - Intronic
998796911 5:145830147-145830169 CTGAGTACCTACTATGTTCCAGG + Intronic
998804989 5:145909676-145909698 TTGAGCATCTACTATGTGCCAGG - Intergenic
998884755 5:146682656-146682678 TTAAGTATGTATTATGTGCCAGG - Intronic
998889398 5:146729997-146730019 GACAGTTTGCACTATGTGCCTGG + Intronic
998894970 5:146789566-146789588 CTGAGCATTTACTATGGGCCTGG + Intronic
998954355 5:147423512-147423534 TTGAGTGTGTAGTATGTGCCAGG - Intronic
998984621 5:147742443-147742465 TTAAGCATTTACTATGTGCCAGG + Intronic
998985206 5:147749263-147749285 TTGAATATTTACTATGTGCCAGG + Intronic
999115168 5:149156404-149156426 CTGAGTATTTTCCATGTGCCAGG - Intronic
999129896 5:149274228-149274250 CTCACTGTGCACTATGTGCCAGG - Intronic
999476660 5:151906220-151906242 CTCAGTAGTTTCTCTGTGCCTGG - Intronic
999509174 5:152230041-152230063 CTTAGCACCTACTATGTGCCAGG - Intergenic
999610611 5:153365138-153365160 ATGAGTACGTAGTATGTGCCAGG - Intergenic
999620742 5:153470607-153470629 CTGAGTGCTTACTATGTGCCAGG - Intergenic
999917190 5:156275620-156275642 TTCAGTATGTACTAAGTTCTGGG + Intronic
999938217 5:156511794-156511816 CTGATCATGTACTATGTGCTAGG - Intronic
1000038265 5:157465547-157465569 CTGAGTATTGACTACGTGCCAGG + Intronic
1000133600 5:158323048-158323070 CTAAGCACCTACTATGTGCCAGG + Intergenic
1000148510 5:158476673-158476695 CTCAGCAGCTACTATATGCCAGG - Intergenic
1000250511 5:159490303-159490325 TTGAGTAGCTACTATGTGCCAGG - Intergenic
1000277049 5:159747166-159747188 CTAAGCATATACTATGTGTCAGG + Intergenic
1000280169 5:159775131-159775153 CTGAGTATTTACTGTGTGCCAGG + Intergenic
1000390590 5:160718933-160718955 CCAAGTTTGTGCTATGTGCCGGG - Intronic
1000441898 5:161273376-161273398 CAAAATATGTACTATGTGCAAGG - Intergenic
1000674226 5:164101080-164101102 TTGAGTATTTAATATGTGCCTGG + Intergenic
1000930203 5:167242395-167242417 ATCAGTATTTACTACGTGTCAGG - Intergenic
1001080118 5:168661342-168661364 TTGAGCATCTACTATGTGCCAGG - Intergenic
1001143601 5:169165084-169165106 CTGAGCACCTACTATGTGCCAGG - Intronic
1001240597 5:170067093-170067115 CTTAGGACCTACTATGTGCCAGG + Intronic
1001241721 5:170076355-170076377 TGCAGCATCTACTATGTGCCAGG + Intronic
1001304970 5:170565576-170565598 TTAAGTACCTACTATGTGCCAGG + Intronic
1001314217 5:170631323-170631345 CTGAGCACCTACTATGTGCCAGG - Intronic
1001322876 5:170697394-170697416 CTAAGTATCTAATATGTGCAAGG - Intronic
1001405481 5:171474017-171474039 CTAAGGACCTACTATGTGCCAGG - Intergenic
1001590560 5:172861643-172861665 CTAAGTACCTACTATGTGTCAGG - Intronic
1001662094 5:173401751-173401773 CTGAGCACCTACTATGTGCCAGG + Intergenic
1001855524 5:175007165-175007187 TTATGTATCTACTATGTGCCAGG + Intergenic
1001928366 5:175655878-175655900 TTGAGTATCTACTATGTACCAGG + Intergenic
1001959912 5:175873399-175873421 CTCAGGATCTACCATGTACCAGG + Intronic
1002125673 5:177042117-177042139 CTGAGTCCCTACTATGTGCCAGG - Intronic
1002959358 6:1899187-1899209 CTAATTATTTACCATGTGCCTGG - Intronic
1003565112 6:7216116-7216138 TTGAGTTTGTACTGTGTGCCAGG + Intronic
1003657541 6:8027330-8027352 CTGAGCATGTGCTTTGTGCCAGG + Intronic
1003951323 6:11118457-11118479 TTGAGTATCTACTTTGTGCCAGG + Intronic
1004095331 6:12548526-12548548 CTGAGTGCCTACTATGTGCCTGG - Intergenic
1004637985 6:17487101-17487123 CTGAGCACGTACTATGTGCCAGG + Intronic
1004737299 6:18420377-18420399 CTGAGTGTCTACTATGTGCCAGG + Intronic
1005387285 6:25298150-25298172 CTCATGACTTACTATGTGCCAGG - Intronic
1005432128 6:25769287-25769309 CTGAACATGTACTATGTGCCAGG + Intronic
1006591321 6:35160166-35160188 TTGAGTATTTACCATGTGCCAGG + Intergenic
1006643327 6:35499515-35499537 CACAGTGTTTACTATGTGCCAGG - Intronic
1006662052 6:35655251-35655273 CTGAATACCTACTATGTGCCAGG + Intronic
1007313510 6:40965454-40965476 CTGAGTGCCTACTATGTGCCTGG + Intergenic
1007329283 6:41091858-41091880 CTGAGCACCTACTATGTGCCAGG + Intronic
1007370400 6:41423109-41423131 CTGAGCAGTTACTATGTGCCAGG + Intergenic
1007452933 6:41953891-41953913 CTGAATACTTACTATGTGCCAGG + Intronic
1007817388 6:44534297-44534319 CGGAGCATCTACTATGTGCCAGG + Intergenic
1007954515 6:45904266-45904288 TTGAGTATTTACTATTTGCCAGG - Intronic
1008021464 6:46582867-46582889 CTGAGTGTGTGCTATGTGTCAGG - Intronic
1008071242 6:47101097-47101119 CTGAGTAGCAACTATGTGCCAGG - Intergenic
1008093726 6:47317317-47317339 CTATGTATCTACTGTGTGCCCGG + Intergenic
1008151109 6:47952431-47952453 CTGAGTATATACTTTGTGCCAGG - Intronic
1008360044 6:50606399-50606421 GTCAGTATTTATTAAGTGCCTGG + Intergenic
1008546403 6:52587519-52587541 CTCAGTACCTACTATGTGGCAGG - Intergenic
1008662555 6:53683057-53683079 CTGAGTATCTACCATGTGCCAGG + Intergenic
1008690670 6:53975172-53975194 CTGAGTAACTACTATGTGCCAGG + Intronic
1008823853 6:55667350-55667372 CCAAGTGTGTACTATGTACCAGG + Intergenic
1008974228 6:57405718-57405740 CTGAGTAGCCACTATGTGCCAGG + Intronic
1008986608 6:57551604-57551626 TTGAGTATCTACTATGTCCCAGG + Intronic
1009003621 6:57752329-57752351 CTGAATATCTACTCTGTGCCAGG + Intergenic
1009163117 6:60307241-60307263 CTGAGTACCCACTATGTGCCAGG + Intergenic
1009197631 6:60705760-60705782 CTAAGCATTTACTATGTGTCAGG - Intergenic
1009425616 6:63510574-63510596 TTCAATATCTATTATGTGCCAGG + Intergenic
1009435696 6:63615612-63615634 CACAGTATTTACTATGTGCCAGG - Intergenic
1009790559 6:68396393-68396415 CTCAGTGCCTACTATATGCCTGG + Intergenic
1009855055 6:69251480-69251502 ATGAGTGTGTGCTATGTGCCAGG - Intronic
1010024688 6:71201616-71201638 TTGAGTATCTACTATGTACCAGG - Intergenic
1010260984 6:73816598-73816620 TTGAGTCTCTACTATGTGCCAGG + Intronic
1010473886 6:76262850-76262872 TTCAGCTTGCACTATGTGCCTGG + Intergenic
1010534713 6:77012346-77012368 CTCAGTTTGCACTATTGGCCTGG - Intergenic
1011068018 6:83350195-83350217 CTAAGTACCTACTATGTGCCAGG + Intronic
1011253091 6:85393615-85393637 TTGAGTACTTACTATGTGCCTGG - Intergenic
1011587601 6:88943505-88943527 GTGGGTATGTACTATGTACCAGG + Intronic
1012173937 6:96054868-96054890 TTTAGTATGTAATATGTGTCAGG - Intronic
1012210257 6:96510173-96510195 AACAGCTTGTACTATGTGCCTGG + Intergenic
1012303879 6:97625968-97625990 GTAACTATGTACCATGTGCCAGG + Intergenic
1012341615 6:98132294-98132316 CTGAGTATCTATTATGTGCCAGG + Intergenic
1012999522 6:106008545-106008567 CTGAATATTTACTAAGTGCCTGG + Intergenic
1013144486 6:107374449-107374471 CTAAGGACCTACTATGTGCCAGG + Intronic
1013165848 6:107591288-107591310 CTGAGCACTTACTATGTGCCTGG - Intronic
1013248728 6:108313413-108313435 CTGAGTATTTACTAAGTACCAGG - Intronic
1013520318 6:110926817-110926839 ATGAATATTTACTATGTGCCAGG - Intergenic
1013561249 6:111307693-111307715 TTGAGTAGCTACTATGTGCCAGG + Intronic
1013795320 6:113881422-113881444 CTGAGTGTTTACTATGTGCCAGG - Intergenic
1014149852 6:118042177-118042199 CTGAGAATGCACTATGTTCCAGG + Intronic
1014551508 6:122794231-122794253 TTAAGTATTTTCTATGTGCCAGG - Intronic
1014641274 6:123913934-123913956 CTTAATATTTACTATGTGCCTGG + Intronic
1014863613 6:126501665-126501687 CTCAGTACCTACTATATGACAGG - Intergenic
1015075568 6:129152564-129152586 CTCAGTATTTAGTATGTTTCAGG + Intronic
1015100576 6:129474536-129474558 TTGAGTATCTACTATGTGACAGG + Intronic
1015146411 6:129992563-129992585 CTTAGTATGTACTAGGCGCTAGG + Intergenic
1015911054 6:138168081-138168103 GTGAGTACCTACTATGTGCCAGG + Intronic
1016157388 6:140828322-140828344 CCCAGAATGTAGTATGTTCCTGG + Intergenic
1016406402 6:143735992-143736014 TTGAGTATTTACTATGTGTCAGG + Intronic
1016500082 6:144710653-144710675 CTGAGTGTTTACTATGTGCTAGG - Intronic
1016649786 6:146450054-146450076 CTCAGTAATTAATATGTGCAAGG - Intergenic
1016830604 6:148429859-148429881 CTTAGCATTTACTATCTGCCAGG - Intronic
1016924003 6:149322773-149322795 CTCTATAGTTACTATGTGCCAGG - Intronic
1016966964 6:149727925-149727947 CTGAGTACCTACTATGTGCCAGG + Intronic
1017082063 6:150679653-150679675 TTGAGTATGTACTCTGTGCCAGG + Intronic
1017083824 6:150694735-150694757 TTGAGTACTTACTATGTGCCAGG - Intronic
1017494617 6:154972516-154972538 CTAAGTGTGTACTCTGTGCTGGG - Intronic
1017538404 6:155373276-155373298 CTGAGTATCTATTATGTGCCAGG + Intergenic
1017693061 6:156986627-156986649 CTGAGTAATTACTATGAGCCGGG - Intronic
1018078511 6:160238277-160238299 CACTGTATATACCATGTGCCAGG - Intronic
1018325849 6:162667908-162667930 TTGAGTATTTACTATGTGCCAGG - Intronic
1018407894 6:163506718-163506740 CTAAGTGTCTACAATGTGCCAGG - Intronic
1018590782 6:165419341-165419363 TTAAGTGTTTACTATGTGCCAGG + Intronic
1018886710 6:167944335-167944357 CTGAGCACCTACTATGTGCCGGG - Intronic
1019102413 6:169641898-169641920 CTGAGAATCTACTCTGTGCCAGG + Intronic
1019851401 7:3561585-3561607 CTGAGCATTTACCATGTGCCAGG - Intronic
1019897050 7:3990690-3990712 CTGAGTACGTACTAAGTGCAGGG - Intronic
1020466825 7:8489420-8489442 CTAAGTGTGTATGATGTGCCAGG + Intronic
1021218388 7:17944785-17944807 TTCAGTATCTATTATGGGCCAGG + Intergenic
1021618118 7:22523473-22523495 CTGAGCATCTACTATGTTCCAGG + Intronic
1021640120 7:22728378-22728400 TTAAGTATCTACTGTGTGCCAGG + Intronic
1021640404 7:22730657-22730679 CTAAATATGAACTATGTGCCAGG + Intronic
1021819594 7:24483369-24483391 CTGAGCATGTACTATAGGCCAGG - Intergenic
1021914356 7:25416582-25416604 CTGAGCATCTACTCTGTGCCAGG - Intergenic
1022024383 7:26432524-26432546 ATGAGTCTTTACTATGTGCCAGG - Intergenic
1022081061 7:27021778-27021800 GTAAGTATTTCCTATGTGCCAGG + Intergenic
1022120953 7:27307526-27307548 CTGAGCACGTATTATGTGCCAGG + Intergenic
1022243917 7:28539221-28539243 CTGAGTATTTACTATGTGCCAGG - Intronic
1022516330 7:30977117-30977139 TTCATTACTTACTATGTGCCAGG - Intronic
1022730703 7:33021915-33021937 CTGAGTGCTTACTATGTGCCAGG + Intronic
1022909123 7:34883053-34883075 CTCAGTAGGTACTCTGTGTAGGG + Intergenic
1023001178 7:35809384-35809406 CTCAGTGTTTATTATATGCCAGG - Intronic
1023047526 7:36223556-36223578 CTACGCATCTACTATGTGCCTGG - Intronic
1023072969 7:36455933-36455955 GTGAGCATTTACTATGTGCCAGG + Intergenic
1023128981 7:36983685-36983707 CTGAGCATTTACTGTGTGCCAGG - Intronic
1023288701 7:38646464-38646486 TTCAGTGTCTACTATGTACCAGG + Intergenic
1023491786 7:40750884-40750906 CTGAGTATATACTATGTGCCAGG + Intronic
1023501169 7:40850944-40850966 TTGAGTATTTACTGTGTGCCTGG + Intronic
1023523797 7:41077563-41077585 CTCAATTGTTACTATGTGCCAGG + Intergenic
1023585086 7:41720918-41720940 TTGAGCATGTACTATGTGTCAGG + Intergenic
1023993351 7:45143896-45143918 CTGAGTCTCTACTATGTGCGAGG + Intergenic
1024154523 7:46606608-46606630 CTGAGAATTTGCTATGTGCCAGG - Intergenic
1024348129 7:48334254-48334276 CTGAGTATTTGCTATGTGCCAGG + Intronic
1024457713 7:49628015-49628037 GATAGTATTTACTATGTGCCAGG + Intergenic
1024543438 7:50498066-50498088 TTCAGTATTTACTGTCTGCCAGG + Intronic
1025109602 7:56203036-56203058 CTGAGCACCTACTATGTGCCAGG + Intergenic
1025244072 7:57302993-57303015 CTGAGCACCTACTATGTGCCAGG + Intergenic
1025326344 7:58227558-58227580 CTCAGTATCTTCTTTGTGCTGGG + Intergenic
1025352831 7:58696632-58696654 CTCAGTATCTTCTTTGTGCTGGG + Intergenic
1025381986 7:59213219-59213241 CTCAGTATCTTCTTTGTGCTGGG + Intergenic
1025994800 7:66521197-66521219 TTGAGCATTTACTATGTGCCAGG + Intergenic
1026256746 7:68718808-68718830 CTCAGTGTTTACCATGTGCCAGG - Intergenic
1026268716 7:68818055-68818077 CTGAGTGTGTACTATATGCATGG - Intergenic
1026308304 7:69161582-69161604 CTGAGCACCTACTATGTGCCAGG - Intergenic
1026762230 7:73135456-73135478 CTGAGCATCTACTGTGTGCCAGG + Intergenic
1027038566 7:74944262-74944284 CTGAGCATCTACTGTGTGCCAGG + Intergenic
1027053808 7:75036538-75036560 CTCAGCACGTACTGTATGCCAGG - Intronic
1027084994 7:75257233-75257255 CTGAGCATCTACTGTGTGCCAGG - Intergenic
1027296636 7:76780279-76780301 CTGAGTATTCACTATGTGCCCGG - Intergenic
1027338094 7:77175720-77175742 TACAGCATTTACTATGTGCCAGG + Intronic
1027864924 7:83633252-83633274 CTTAGCAATTACTATGTGCCAGG + Intronic
1028234366 7:88342873-88342895 CTGAGTGTCAACTATGTGCCAGG + Intergenic
1028291906 7:89075729-89075751 GACAGTTTGTACCATGTGCCTGG + Intronic
1028830851 7:95325071-95325093 TTGAGTACCTACTATGTGCCAGG + Intergenic
1028889803 7:95974311-95974333 CTGAGCACTTACTATGTGCCAGG - Intronic
1029190194 7:98766472-98766494 CTGAGCACCTACTATGTGCCAGG - Intergenic
1029475894 7:100784453-100784475 CTGAGTATGGGTTATGTGCCAGG - Intronic
1029817800 7:103114382-103114404 CTCGGTGTCTGCTATGTGCCAGG - Intronic
1029880367 7:103801830-103801852 CTGAGAACTTACTATGTGCCAGG - Intronic
1030010001 7:105156401-105156423 TTCAGTGCTTACTATGTGCCAGG - Intronic
1030062549 7:105634426-105634448 TTCAGTCCTTACTATGTGCCAGG + Intronic
1030088828 7:105839755-105839777 CTGAGCACCTACTATGTGCCAGG + Intronic
1030354822 7:108530288-108530310 CTGAGTGCTTACTATGTGCCTGG + Intronic
1030745328 7:113159275-113159297 CTGAGCATCTACTATATGCCAGG + Intergenic
1030939012 7:115621500-115621522 TTCAGTACATACCATGTGCCAGG - Intergenic
1031058286 7:117018783-117018805 CTGAGTGTTTACTATGTGCCAGG - Intronic
1031323558 7:120364073-120364095 CTGAGTATCTCTTATGTGCCAGG - Intronic
1031807920 7:126329476-126329498 CCCAGTATGGACTCTGTGTCGGG - Intergenic
1031930695 7:127682828-127682850 CTGAGTGCCTACTATGTGCCAGG - Intronic
1032238491 7:130143464-130143486 CTGAGCATCTACTATGTGCTAGG - Intergenic
1032681000 7:134183286-134183308 CTGAGCAATTACTATGTGCCAGG - Intronic
1032753194 7:134863287-134863309 TTGAATATGTACTATGTGGCAGG - Intronic
1032872340 7:135999706-135999728 TTAAGTATGTACTCTGTGCCAGG + Intergenic
1032894747 7:136237860-136237882 CTGAGCACGTTCTATGTGCCAGG + Intergenic
1032940405 7:136782139-136782161 GTGAGTATGTACTCTGTGTCAGG - Intergenic
1033191794 7:139288130-139288152 TTGAGTGTTTACTATGTGCCAGG + Intronic
1033383021 7:140842381-140842403 CTGAGTATTTACTATGTATCAGG - Intronic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1033445379 7:141417094-141417116 CTCAGCACTTACTATGTGCCAGG - Intronic
1033521388 7:142164410-142164432 CTGAGTGTGTATTATGTGACAGG - Intronic
1033674533 7:143527057-143527079 CTGAGTGTTTACTATGTTCCAGG - Intergenic
1033697303 7:143802383-143802405 CTGAGTGTTTACTATGTTCCAGG + Intergenic
1033870455 7:145748489-145748511 TTCAGTTTCTATTATGTGCCAGG - Intergenic
1034003118 7:147438811-147438833 CTCAGTAGGTTGTATGTGTCTGG + Intronic
1034064318 7:148121895-148121917 CTGAGTATCTACTATGTCCCAGG + Intronic
1034102953 7:148466651-148466673 CTGAGCACTTACTATGTGCCAGG - Intergenic
1035116319 7:156527319-156527341 CTGGGCATCTACTATGTGCCAGG + Intergenic
1035198930 7:157247336-157247358 CTTACTAGGTACTAGGTGCCAGG - Intronic
1035622673 8:1045778-1045800 CTGAGCACTTACTATGTGCCAGG - Intergenic
1035915920 8:3622083-3622105 CACAGTCTGCACTATGTGCTGGG + Intronic
1037086677 8:14859870-14859892 CTAAGTGTCTACTATATGCCAGG - Intronic
1037462406 8:19125283-19125305 TTCAGTACCTACTATGAGCCAGG - Intergenic
1037637286 8:20711352-20711374 TTTAGTATCTACTGTGTGCCAGG + Intergenic
1037655528 8:20880748-20880770 CACAGTAGTTACTATGTTCCAGG - Intergenic
1037938191 8:22929141-22929163 TTGAGCATTTACTATGTGCCAGG - Intronic
1038155414 8:24984826-24984848 CTCAGTACCTACCATGTGCCTGG + Intergenic
1038402961 8:27299393-27299415 TTCAGTACTTACTCTGTGCCAGG + Intronic
1038465684 8:27760571-27760593 CTGAATACCTACTATGTGCCAGG + Intronic
1038514763 8:28177842-28177864 CTCAGTATGTACTAGGAGCCTGG - Intronic
1038560558 8:28575416-28575438 CTGATTATCTACTATGTGCCAGG + Intergenic
1038967054 8:32586093-32586115 TTGAGTACCTACTATGTGCCAGG - Intronic
1039031357 8:33313019-33313041 CTGAGTACATACTCTGTGCCAGG + Intergenic
1039036181 8:33361675-33361697 TTGAGCATTTACTATGTGCCAGG - Intergenic
1039440150 8:37589396-37589418 CTGAGCATCTACTACGTGCCAGG - Intergenic
1039795244 8:40907363-40907385 CTCAGAATGTTCTATTGGCCAGG - Intergenic
1039931810 8:41998589-41998611 CTTAGTATATACTAAGTGCAAGG - Intronic
1040046888 8:42973900-42973922 CTGAATATCTACTATGTGCAGGG - Intronic
1041119143 8:54569028-54569050 TTGAGTATTTAGTATGTGCCAGG - Intergenic
1041216766 8:55608501-55608523 TTCAGTCTCTACCATGTGCCAGG - Intergenic
1041313816 8:56541573-56541595 CTGAGTGTGCACTGTGTGCCTGG - Intergenic
1041441969 8:57906975-57906997 CTTAGTATAACCTATGTGCCTGG + Intergenic
1041555897 8:59155189-59155211 TTGAGCATGTATTATGTGCCAGG - Intergenic
1041559363 8:59197214-59197236 TTGAGCATGTACTCTGTGCCAGG - Intergenic
1041567989 8:59302614-59302636 CTAAGCATCTTCTATGTGCCAGG - Intergenic
1041905510 8:63028961-63028983 CCCAGTATGTGCTGTGTGCAAGG - Intronic
1042108804 8:65356910-65356932 CTCTGTATATTCTCTGTGCCTGG + Intergenic
1042182427 8:66104982-66105004 TTTAGTCTGTACTATGTGCTAGG - Intergenic
1042183665 8:66115868-66115890 CTTTGTGTTTACTATGTGCCAGG - Intergenic
1042240585 8:66660229-66660251 CTTGGTACCTACTATGTGCCAGG + Intronic
1042602884 8:70516169-70516191 CTGAGGACCTACTATGTGCCAGG + Intergenic
1042648972 8:71018627-71018649 CTGAGTACGTACTATGTGCCAGG - Intergenic
1042721726 8:71833659-71833681 CTAAGCACTTACTATGTGCCAGG + Intronic
1042830368 8:73020575-73020597 CTGAGTGTATACTATGTGCTAGG - Intronic
1042899186 8:73705051-73705073 TTGAGTATTTACTATGTGGCAGG - Intronic
1043139731 8:76573253-76573275 CTGAGTGTCTACTATGTGCCGGG + Intergenic
1043379186 8:79684512-79684534 TTGAGTACCTACTATGTGCCAGG - Intergenic
1043482918 8:80670894-80670916 CTGAGCACTTACTATGTGCCAGG + Intronic
1043512709 8:80965459-80965481 CTGAGTATTTACTATGTGCCAGG - Intergenic
1043667399 8:82833426-82833448 CTGAATACCTACTATGTGCCAGG - Intergenic
1043687489 8:83106363-83106385 CACAGTATCTACTGTGTGTCAGG - Intergenic
1043787214 8:84418361-84418383 CTGAGTACCTAATATGTGCCAGG - Intronic
1043793937 8:84511373-84511395 TTGAAAATGTACTATGTGCCAGG - Intronic
1044217988 8:89635507-89635529 TTGAGTACTTACTATGTGCCCGG + Intergenic
1044255201 8:90052009-90052031 TTGAATATGTATTATGTGCCAGG + Intronic
1044526947 8:93262976-93262998 TTTAGTACCTACTATGTGCCTGG - Intergenic
1044580440 8:93820704-93820726 CATAGCATTTACTATGTGCCAGG - Intergenic
1044701273 8:94967441-94967463 CTGAGTACCTACTGTGTGCCAGG + Intronic
1044731984 8:95236409-95236431 TTAAGTAATTACTATGTGCCAGG + Intergenic
1044868067 8:96591828-96591850 CTGAGCATCTACTATATGCCAGG + Intronic
1044873117 8:96639588-96639610 CTGACTGTGTATTATGTGCCAGG + Intergenic
1045001993 8:97886525-97886547 TTCAGCATCTCCTATGTGCCAGG - Intronic
1045206802 8:100050850-100050872 CTCAGCAACTATTATGTGCCAGG + Intronic
1045934846 8:107667222-107667244 CTGAGTACCTCCTATGTGCCAGG - Intergenic
1045968823 8:108056683-108056705 TTGAGCATTTACTATGTGCCAGG - Intronic
1046046254 8:108968495-108968517 CCTACTATCTACTATGTGCCAGG - Intergenic
1046089137 8:109478272-109478294 CTGAGTATCCACTATGTGCCAGG + Intronic
1046094568 8:109541576-109541598 TTGAGTACCTACTATGTGCCCGG + Intronic
1046112745 8:109745887-109745909 CTGAGCACCTACTATGTGCCTGG - Intergenic
1046527985 8:115405741-115405763 CTGAGTATTTACTATGTGCTGGG - Intergenic
1046726963 8:117686402-117686424 TTCTGTATCTACTATATGCCAGG - Intergenic
1047007359 8:120634308-120634330 CTGAGAATCTACTATGTGCCAGG + Intronic
1047123256 8:121930314-121930336 CTGAGTATTTACTCTATGCCAGG - Intergenic
1047437986 8:124851166-124851188 TTCAACATTTACTATGTGCCAGG - Intergenic
1047514482 8:125541760-125541782 TTAAGCATGTACTATGTGCTAGG - Intergenic
1047633649 8:126735527-126735549 CTGAGTTTTTACTATGTGCCAGG + Intergenic
1047660643 8:127031931-127031953 CTGAGTACTTACTATGTGCCAGG - Intergenic
1047745417 8:127841158-127841180 CTGAACAGGTACTATGTGCCAGG - Intergenic
1047795230 8:128248458-128248480 CTGAGTGTTTACTGTGTGCCAGG + Intergenic
1047964746 8:130038364-130038386 CTGTGTATATACTATGTGCCAGG - Intergenic
1047985055 8:130224118-130224140 CTGAGCATTCACTATGTGCCAGG - Intronic
1048063035 8:130940067-130940089 TTGAGCATGTACTATGTGCCAGG + Intronic
1048376788 8:133829638-133829660 ATGAGTGTCTACTATGTGCCTGG - Intergenic
1048420666 8:134275164-134275186 CTCAGGTTGTACACTGTGCCTGG - Intergenic
1048429540 8:134357318-134357340 TTAAGCATCTACTATGTGCCTGG + Intergenic
1048602376 8:135931675-135931697 CTGAGCATCTACTATGTGCCAGG - Intergenic
1048694280 8:137007279-137007301 TTCAATATGTACTATGTTGCAGG + Intergenic
1049095027 8:140543676-140543698 CTGAGCATCTACTATGTGCCAGG + Intronic
1050057221 9:1668219-1668241 CTGAGTATCTACTCTGTGTCAGG - Intergenic
1050149459 9:2604886-2604908 CTAAGTTCTTACTATGTGCCTGG + Intergenic
1050211585 9:3264526-3264548 TCCAGTATATACTATGTGCCAGG + Intronic
1050213845 9:3298497-3298519 GTGAGTATCTACTATGTACCAGG + Intronic
1050376945 9:4984302-4984324 CTGAGTGTCTACTAGGTGCCGGG - Intergenic
1051425375 9:16926957-16926979 CTGAGTGTGTAGTAAGTGCCTGG + Intergenic
1051593276 9:18797807-18797829 TTGAGTATGAACAATGTGCCTGG - Intronic
1051648309 9:19293021-19293043 CTCAGTATTTTCTATGTTCCAGG - Intronic
1051667974 9:19483402-19483424 CTGAGCATTTACTATGTGCTAGG + Intergenic
1052016545 9:23475038-23475060 TGGAGTATGTACTATGTGCCAGG - Intergenic
1052279493 9:26716682-26716704 CTGCGTGTCTACTATGTGCCAGG - Intergenic
1052821501 9:33141130-33141152 GTTAGTATGTATCATGTGCCAGG + Intronic
1052983397 9:34466068-34466090 TTAAGCATCTACTATGTGCCAGG - Intronic
1053201966 9:36158520-36158542 TTGAGCATCTACTATGTGCCAGG + Intronic
1053292367 9:36889705-36889727 CTGAGTACCTACTGTGTGCCAGG - Intronic
1053384821 9:37678705-37678727 TTCAGTATCCTCTATGTGCCTGG - Intronic
1053826999 9:42035605-42035627 CTTTGTGTGTACTATGTGTCAGG - Intronic
1054603561 9:67151827-67151849 CTTTGTGTGTACTATGTGTCAGG + Intergenic
1054716405 9:68561329-68561351 CTGAGCACTTACTATGTGCCAGG + Intergenic
1054722955 9:68622136-68622158 CTGAGTATTTACTGTGTCCCAGG - Intergenic
1054784333 9:69196377-69196399 TTGAGCATGTACTATGTGCCAGG + Intronic
1054840546 9:69733832-69733854 TTGAGTATTTAATATGTGCCAGG + Intronic
1054862597 9:69968972-69968994 ATTATTATGTACTGTGTGCCAGG - Intergenic
1054883816 9:70174215-70174237 TTGAGTGTCTACTATGTGCCAGG + Intronic
1055287533 9:74745318-74745340 TTGAGTACCTACTATGTGCCAGG + Intronic
1055472113 9:76622174-76622196 CTGAGCATCTACTATGTACCAGG + Intronic
1055660726 9:78501497-78501519 CTGAGTATGTACCATGTGCTAGG + Intergenic
1055734063 9:79309112-79309134 GTGAGTACTTACTATGTGCCAGG - Intergenic
1055964197 9:81849625-81849647 TTCAGTATCTAATATGTGCCAGG + Intergenic
1056162299 9:83909023-83909045 TTTAGTATCTACTATGTGCCAGG + Intronic
1056358043 9:85822491-85822513 TTTAGTATCTACTATGTGCCAGG - Intergenic
1056457489 9:86774834-86774856 TTAAGCATCTACTATGTGCCAGG - Intergenic
1056509224 9:87286890-87286912 TTAAGTATCTACTATATGCCAGG - Intergenic
1056536145 9:87529515-87529537 CTGAGCATCTACTATGTGTCAGG - Intronic
1057421794 9:94918740-94918762 CTCAGTGTTTGCTACGTGCCAGG - Intronic
1057743350 9:97731819-97731841 TTAAGTACCTACTATGTGCCAGG + Intergenic
1057822002 9:98339710-98339732 TTGAGTATGTACTATGTGCCAGG + Intronic
1057871542 9:98721884-98721906 CTGAGGACCTACTATGTGCCAGG - Intergenic
1057910880 9:99019785-99019807 TTGAGCATGTACTATGTGCTGGG - Intronic
1057981146 9:99665094-99665116 TTGAGTATCTACCATGTGCCAGG + Intergenic
1058160668 9:101567152-101567174 CTGAGCATTTACTAGGTGCCAGG - Intergenic
1058307087 9:103457453-103457475 TTGAGTATGAACTATGTGCTAGG + Intergenic
1058459439 9:105169431-105169453 CTGAGTATTTCATATGTGCCAGG + Intergenic
1058602562 9:106685917-106685939 TTGAGTATGTACAATGTGCATGG + Intergenic
1059014479 9:110499956-110499978 TTCAGTACCTACTATGTGCCAGG + Intronic
1059158947 9:112015573-112015595 ATGAGCATTTACTATGTGCCAGG + Intergenic
1059395931 9:114034105-114034127 CTGAGTATGTAATCTGTGCCAGG - Intronic
1059588304 9:115629954-115629976 CTGAGTCTCTACTATGTCCCAGG - Intergenic
1059655676 9:116355223-116355245 CTGAGTACCTACTAGGTGCCTGG - Intronic
1059669952 9:116482418-116482440 TTGAGTATTCACTATGTGCCAGG - Intronic
1059678037 9:116558885-116558907 TTAAGTATCTACCATGTGCCAGG - Intronic
1059753910 9:117274490-117274512 CCCAGTGTCTATTATGTGCCAGG + Intronic
1059903580 9:118956122-118956144 TTGAGTATGTATTATGTGCTAGG - Intergenic
1060021313 9:120133778-120133800 AACAGTTTGTACTGTGTGCCTGG - Intergenic
1060065983 9:120501507-120501529 CACAGTGTCTGCTATGTGCCAGG - Intronic
1060120864 9:120988198-120988220 CTGAGCATCTACTATGTGCCAGG + Intronic
1060259227 9:122059304-122059326 CTGAGCATTTACTATGTGCCAGG + Intronic
1060403159 9:123360207-123360229 CTGAGTGTGTACTATGTGCTTGG - Intronic
1060476064 9:123987685-123987707 CTGAGCATCTGCTATGTGCCAGG - Intergenic
1060516566 9:124269743-124269765 CTGAGCACCTACTATGTGCCAGG - Intronic
1060518992 9:124283230-124283252 CTGAGCACCTACTATGTGCCAGG - Intronic
1060708811 9:125835165-125835187 TTGAGTGTTTACTATGTGCCAGG + Intronic
1060725394 9:126002718-126002740 CTGAGCACCTACTATGTGCCAGG - Intergenic
1060850947 9:126874947-126874969 CTAAGTATGTATTAAGTGTCAGG - Intronic
1060942888 9:127553454-127553476 CTGAGTATTTGCTGTGTGCCAGG + Intronic
1061073056 9:128323534-128323556 TTGAGCATTTACTATGTGCCAGG - Intronic
1061611747 9:131751237-131751259 CTCAGCACCTACTATGTACCAGG - Intergenic
1061637268 9:131920450-131920472 CTCAACACCTACTATGTGCCAGG + Intronic
1061708729 9:132472809-132472831 CTCAGTGTTTGCTGTGTGCCCGG + Intronic
1186400762 X:9257389-9257411 CTCAGTATGTACCAGGTTCTAGG + Intergenic
1186700346 X:12083596-12083618 GGCAGTTTGTACTGTGTGCCTGG + Intergenic
1186850738 X:13577200-13577222 TTCAGCACCTACTATGTGCCAGG - Intronic
1186925214 X:14326166-14326188 TTGAGTGTCTACTATGTGCCAGG - Intergenic
1187092640 X:16113342-16113364 CTGAGTATTCACTATGTGCCAGG - Intergenic
1187212368 X:17244149-17244171 CTAAGCATCTACTATGTGCCAGG - Intergenic
1187244237 X:17539490-17539512 TTTAGCATCTACTATGTGCCAGG - Intronic
1187276775 X:17823250-17823272 CTGAGTATTTACCATGTGCCAGG - Intronic
1187298327 X:18024423-18024445 ATCAGCACTTACTATGTGCCAGG - Intergenic
1187408707 X:19027708-19027730 CTGAGCACCTACTATGTGCCAGG - Intronic
1187554440 X:20338635-20338657 CTCAGTACCTGCTATGTTCCAGG - Intergenic
1187963603 X:24589036-24589058 TTGAGTATTTACCATGTGCCCGG - Intronic
1188267147 X:28091215-28091237 CTCAACACTTACTATGTGCCAGG - Intergenic
1188307710 X:28578783-28578805 TTCAGTACTTATTATGTGCCAGG - Intergenic
1188415179 X:29924436-29924458 CTAAGAACCTACTATGTGCCTGG + Intronic
1188631773 X:32372257-32372279 ATGAGTATGTCCTATGTGTCAGG + Intronic
1188651609 X:32637281-32637303 TTGAGTGTGTAGTATGTGCCAGG - Intronic
1188749019 X:33883029-33883051 TTGAATATGTACTATGTGTCAGG - Intergenic
1188781843 X:34295244-34295266 GACAGTTTGTACCATGTGCCTGG + Intergenic
1188882812 X:35510978-35511000 CTGAATGTGTACTATGTTCCAGG - Intergenic
1189217138 X:39335963-39335985 CTTAGGATGTGCTATGTGACAGG - Intergenic
1189410328 X:40764794-40764816 CTTAGCATCTACTATATGCCAGG + Intergenic
1189845417 X:45132027-45132049 TTGAGTATTTACTGTGTGCCAGG - Intergenic
1190228545 X:48563736-48563758 CTCAGTACGTTCTATCAGCCAGG + Intergenic
1190476686 X:50835051-50835073 CTGAGAACCTACTATGTGCCAGG - Intergenic
1190625517 X:52334734-52334756 CTGAGTATTTAGTATGTGCTGGG + Intergenic
1190741762 X:53293365-53293387 CTGAGCATGTACCATGTGCCAGG - Intronic
1190935036 X:54992186-54992208 CTGAGCATCTACTATGAGCCAGG + Intronic
1191661960 X:63660743-63660765 CTAAGTACCTACTATGTGCCAGG + Intronic
1191976788 X:66881558-66881580 CTGAGCATGTACTATATGTCAGG + Intergenic
1192226829 X:69234574-69234596 CTAAGCATTTATTATGTGCCAGG + Intergenic
1192273487 X:69606740-69606762 TTGAGTACCTACTATGTGCCAGG - Intergenic
1192359281 X:70428794-70428816 TTAAGTACTTACTATGTGCCAGG - Intronic
1192433909 X:71130557-71130579 CTGAGCATGTGCTTTGTGCCAGG + Intronic
1192542792 X:71989402-71989424 TTAAGCATTTACTATGTGCCAGG + Intergenic
1193037322 X:76966280-76966302 TTGAGTATCTACTAAGTGCCAGG - Intergenic
1193684741 X:84563571-84563593 CTGAGTAACTACTATGTGCAAGG - Intergenic
1193734447 X:85140305-85140327 CTGAGCACTTACTATGTGCCAGG + Intergenic
1193803363 X:85964545-85964567 TTGAGTATTTACTATGTCCCAGG - Intronic
1194279356 X:91929345-91929367 CTGAGTTCTTACTATGTGCCAGG + Intronic
1194366736 X:93022889-93022911 CTCAGTTTGTATGATGTGTCTGG - Intergenic
1194423982 X:93714010-93714032 TTGAGCATTTACTATGTGCCAGG - Intergenic
1194434407 X:93852118-93852140 TTGAGTATTTACTATGTGCCTGG + Intergenic
1194775227 X:97954935-97954957 TTGAATATTTACTATGTGCCAGG + Intergenic
1195053484 X:101120809-101120831 CTGCCAATGTACTATGTGCCAGG + Intronic
1195451104 X:105013988-105014010 CTGAATACGCACTATGTGCCTGG - Intronic
1195490312 X:105461131-105461153 CTGAGTGCTTACTATGTGCCAGG - Intronic
1195604773 X:106792850-106792872 TTGAGTATCTACTATGTGCTGGG - Intronic
1195751921 X:108168569-108168591 TTAAGTATATACTATGTGCCAGG + Intronic
1195779277 X:108442779-108442801 ATGAGTGTTTACTATGTGCCAGG + Intronic
1195885578 X:109634110-109634132 CTGAGCATGTACTATGTGCTAGG + Intronic
1195964757 X:110419865-110419887 TTGGGTATTTACTATGTGCCAGG + Intronic
1195994872 X:110721783-110721805 CTGAGCACCTACTATGTGCCAGG + Intronic
1196025520 X:111037632-111037654 ATCAGCATGTACTATGTAACAGG - Intronic
1196177120 X:112651337-112651359 CTGACTATGACCTATGTGCCAGG - Intronic
1196198769 X:112862283-112862305 CTGAGTACCTACTATGTGCTAGG + Intergenic
1196287996 X:113905002-113905024 TTGAGTACCTACTATGTGCCAGG + Intergenic
1196290825 X:113938991-113939013 ATAAGTATTTACTATGTGACAGG + Intergenic
1196624238 X:117859933-117859955 CTGAGTGGATACTATGTGCCTGG + Intergenic
1196737383 X:118991829-118991851 CTGAGTATCTATTATATGCCAGG - Intronic
1196797151 X:119511574-119511596 TTCAGCACTTACTATGTGCCAGG + Intergenic
1196886116 X:120247161-120247183 TTTAGTATTTACTCTGTGCCAGG - Intergenic
1196910888 X:120483244-120483266 CTGAGTATCTACTATGTACCAGG - Intergenic
1197080469 X:122407604-122407626 TTTGGTATTTACTATGTGCCTGG - Intergenic
1197253174 X:124235701-124235723 CCTAGCATTTACTATGTGCCAGG + Intronic
1197282993 X:124559740-124559762 TTCAGGATTTACTATGTGCCAGG - Intronic
1197604767 X:128572653-128572675 CTGAGTACGTGCTATGTACCAGG + Intergenic
1197903124 X:131394502-131394524 CACAGTATGCACTAGGTGTCTGG - Intronic
1197973834 X:132143928-132143950 TTGAGTGTGTACTGTGTGCCAGG - Intergenic
1198089551 X:133314061-133314083 CTGAGCACCTACTATGTGCCAGG + Intronic
1198089747 X:133316172-133316194 CACAGTATTTAGTATGTGCCAGG + Intronic
1198107955 X:133478908-133478930 TTGAGTGCGTACTATGTGCCAGG - Intergenic
1198139753 X:133790970-133790992 CTCAGTCTGTCCTAAGTGACTGG + Intronic
1198178752 X:134183237-134183259 TTGAGTGTTTACTATGTGCCAGG + Intergenic
1198223737 X:134626371-134626393 CTGAGCATCTACTATGTGCCAGG - Intronic
1198436631 X:136623324-136623346 CGTAGCATTTACTATGTGCCAGG - Intergenic
1198509775 X:137338640-137338662 CTGAGTATTTACTATGCTCCAGG - Intergenic
1198540014 X:137628067-137628089 TTCAGTATTTATTATGTGCAAGG + Intergenic
1198562033 X:137860793-137860815 CTGAGTAGCTATTATGTGCCAGG + Intergenic
1198594468 X:138221370-138221392 TTCAGTACTTACTATGTGCCTGG - Intergenic
1198624955 X:138560716-138560738 TTAAGGATGTACTTTGTGCCAGG - Intergenic
1198977818 X:142356931-142356953 CTGAGAATCTACTCTGTGCCAGG + Intergenic
1199151485 X:144491939-144491961 CTGAGCATTTATTATGTGCCTGG + Intergenic
1199431517 X:147766153-147766175 CTGAATATCTACTATGTGCCTGG + Intergenic
1199616095 X:149657374-149657396 CTGAGCATGTACTGTTTGCCAGG - Intergenic
1199621729 X:149707235-149707257 CTGAGCATGTATTGTGTGCCAGG + Intronic
1199626545 X:149745874-149745896 CTGAGCATGTACTGTTTGCCAGG + Intergenic
1199769818 X:150967970-150967992 CTCAGCTTGTACTTTGTGCCAGG + Intergenic
1200596834 Y:5152839-5152861 CTGAGTTCTTACTATGTGCCAGG + Intronic
1200674962 Y:6139145-6139167 CTCAGTTTGTATGATGTGTCTGG - Intergenic