ID: 902930816

View in Genome Browser
Species Human (GRCh38)
Location 1:19730254-19730276
Sequence TCAACGTATGTTTCCTCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902930816_902930819 -1 Left 902930816 1:19730254-19730276 CCTACTGAGGAAACATACGTTGA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 902930819 1:19730276-19730298 ATATGGAGCTCCCTCGACCTGGG 0: 1
1: 0
2: 0
3: 1
4: 59
902930816_902930823 26 Left 902930816 1:19730254-19730276 CCTACTGAGGAAACATACGTTGA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 902930823 1:19730303-19730325 TACAACAACCAGAGTTCCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 88
902930816_902930818 -2 Left 902930816 1:19730254-19730276 CCTACTGAGGAAACATACGTTGA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 902930818 1:19730275-19730297 GATATGGAGCTCCCTCGACCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
902930816_902930824 27 Left 902930816 1:19730254-19730276 CCTACTGAGGAAACATACGTTGA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 902930824 1:19730304-19730326 ACAACAACCAGAGTTCCCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902930816 Original CRISPR TCAACGTATGTTTCCTCAGT AGG (reversed) Intronic
902930816 1:19730254-19730276 TCAACGTATGTTTCCTCAGTAGG - Intronic
917686569 1:177422558-177422580 TCAAAATATGTTTCCTGATTGGG + Intergenic
918455563 1:184709162-184709184 TCAACCTATGTTTCCTTCTTTGG - Intronic
921766375 1:218977140-218977162 ACAAGGTATGTTTCCATAGTAGG + Intergenic
922084917 1:222337291-222337313 TCAAGGTATTTTTCATCTGTTGG - Intergenic
922314446 1:224430167-224430189 TTAACTAAAGTTTCCTCAGTTGG - Intronic
1064695966 10:17965542-17965564 TGAAAGTACGCTTCCTCAGTTGG + Exonic
1065696732 10:28387520-28387542 TGAACTTATGTTTCCTAAATTGG - Intergenic
1086564471 11:88210000-88210022 TCAACTTCTGGTTGCTCAGTAGG + Intergenic
1092206232 12:6615777-6615799 TCAAAGTCTGTCTCCTCGGTAGG - Intergenic
1099986829 12:89675994-89676016 TCATCAAATGTTTCCTCATTGGG + Intronic
1107230376 13:38102627-38102649 TCTACGTCTGCTTCCTCTGTGGG + Intergenic
1109841729 13:67925553-67925575 TGAAAGTATGTTTCCTCCATTGG + Intergenic
1112670504 13:101631000-101631022 TCAACATATGTCTGATCAGTTGG - Intronic
1113091810 13:106624759-106624781 TGAACTTCTGTTTCCTCAGAGGG - Intergenic
1114840503 14:26257348-26257370 TCCAAGTATGTTTCCCTAGTAGG - Intergenic
1116099237 14:40410994-40411016 TCAACATATAGTTCCTCAATTGG - Intergenic
1116855447 14:49948406-49948428 TCAACTTATGCTTCCTCCTTTGG - Intergenic
1125691953 15:41602923-41602945 ATAACGTCTGTTCCCTCAGTGGG + Intergenic
1130740185 15:86590909-86590931 TCAATGTATATTTTCTCATTTGG - Intronic
1133790515 16:9006114-9006136 TCACCGTATGTTTTCTAGGTTGG - Intergenic
1140493478 16:75361821-75361843 TCAACGTCTGTTTCCTCTTTGGG + Intronic
1143601548 17:7949304-7949326 TCCACGTGCATTTCCTCAGTGGG + Intronic
1150472658 17:65450362-65450384 TCAGCCTATGTTTCTTCATTTGG + Intergenic
1150914275 17:69421125-69421147 TGAAAGTATTTTTCATCAGTAGG + Intronic
1153209412 18:2743739-2743761 TCAATGTACTTTTCCTCACTAGG + Exonic
1155316552 18:24577623-24577645 TCAACGTAGGACTCCTTAGTGGG + Intergenic
1156887394 18:42151158-42151180 TCAACAGATGTTTCAACAGTTGG + Intergenic
1159267463 18:66101153-66101175 TGAACGTGTGTTTCCCCTGTAGG + Intergenic
1160304099 18:77715913-77715935 TCAAAGTGTGTTTCCTAAGGAGG + Intergenic
1160381097 18:78456774-78456796 TCTCTGTATGTTTCCACAGTGGG - Intergenic
1168256382 19:55167883-55167905 TCAACCTTCGTTTCCCCAGTAGG - Intergenic
933766342 2:85712000-85712022 TCAAAATGTGTTTCCTCAGATGG + Intergenic
935318766 2:101864503-101864525 TCAATTTATTTTTCCTCATTTGG + Intronic
935615690 2:105078897-105078919 TTAAAGCATGTTTCCTCAGTGGG + Intronic
937623406 2:124016271-124016293 TCAACGTATGTTTTTTCTTTAGG - Intergenic
938819714 2:134944326-134944348 TCAACTAATGTTTCTTCAATAGG - Intronic
940337214 2:152541987-152542009 TCAAAGTATGGTTCCTCTTTTGG + Intronic
947444553 2:230154099-230154121 TCAACATATGTTTCTTGAATTGG - Intergenic
1168771328 20:418830-418852 TCAGCGTTAGTTTCCTGAGTTGG - Intronic
1169008629 20:2231042-2231064 TCAGCCTTTGTTTCCTCGGTTGG + Intergenic
1169388509 20:5170664-5170686 TCAGAGGATGCTTCCTCAGTAGG + Intronic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1175142676 20:56872576-56872598 TGAACCAATGTTTCCACAGTTGG + Intergenic
1177119648 21:17124187-17124209 TAAACGAATGTTTTCTAAGTTGG - Intergenic
1177183083 21:17764627-17764649 TCAATATGTGTTTCTTCAGTAGG + Intergenic
949382485 3:3461587-3461609 TCAACGTGTGATTCCTCTGGAGG + Intergenic
954013267 3:47662477-47662499 TCAAGGTATGGGTCCTCAATGGG + Exonic
955791591 3:62593670-62593692 TACATGTATGTTTCCTCTGTTGG + Intronic
958931127 3:100209254-100209276 TAAACATATGTCTCCTAAGTTGG - Intergenic
960397377 3:117153896-117153918 TCAACCTAAGTATCCTCAGGTGG - Intergenic
965413330 3:168360366-168360388 TCAACATATGTTTGGTCAATTGG - Intergenic
965859190 3:173126869-173126891 CCAACATATGTTTCTTCATTTGG - Intronic
971098802 4:23439173-23439195 TAAAAGTCTGTTGCCTCAGTTGG + Intergenic
971143289 4:23948156-23948178 TCAACAAATGTTTACTGAGTAGG + Intergenic
974440479 4:61909325-61909347 TCAAAGTAAGTTTCCTCAGGAGG + Intronic
974939754 4:68452422-68452444 TCAACATATGTTTTCTCATTTGG + Intronic
977215023 4:94272270-94272292 CCAACGTATGTATTGTCAGTGGG + Intronic
980155126 4:129095177-129095199 TCAACATAAGTTTCATCATTAGG + Intronic
981944552 4:150326012-150326034 TCAACCTGTGTTTTCACAGTGGG + Intronic
983740725 4:171129524-171129546 TCAAAGTAAGTTTCATCACTTGG + Intergenic
987193819 5:15505126-15505148 TCAAGATATGTTTCCTGAGGTGG - Intronic
988731920 5:33981029-33981051 TCCACGTGTGTCTCCTCACTCGG - Intronic
989304335 5:39935023-39935045 TCCAAGTATGCTTCCTCAATGGG + Intergenic
994249728 5:97521813-97521835 TCACCTTGTGTTTCCACAGTTGG - Intergenic
1006247835 6:32756029-32756051 TCAAGGTATGTTCCTTCACTTGG + Intergenic
1015064294 6:129004597-129004619 TCAACGTGTGTTTACTGAGAAGG - Intronic
1024622653 7:51175564-51175586 ACAACATTTATTTCCTCAGTGGG + Intronic
1024801149 7:53080949-53080971 TACACTTATGTTTCCTCAATAGG - Intergenic
1028582025 7:92418430-92418452 GCTGCTTATGTTTCCTCAGTGGG - Intergenic
1030692033 7:112546026-112546048 TCAAAGTATGTTTTCTAACTTGG + Intergenic
1033899053 7:146113758-146113780 TGAACATATGTCTCCTTAGTTGG - Intergenic
1042081123 8:65052436-65052458 TAAATGTGTGTTTCCTCATTAGG + Intergenic
1047986527 8:130240619-130240641 TCTAAGTATGTATCCGCAGTTGG + Intronic
1051021194 9:12545362-12545384 TCAATGAATGTTTCCTAACTTGG + Intergenic
1057466766 9:95321289-95321311 TCAACTTACATTTCCTCAGTTGG - Intergenic
1059243172 9:112826005-112826027 TGAACTTATGTTTCATCAATCGG - Intronic
1189122114 X:38405886-38405908 TTAATGTATGTTTCATCTGTGGG - Intronic
1189566019 X:42241951-42241973 TCAAAATATGTTTTCTCAGAAGG - Intergenic
1193069595 X:77294233-77294255 TCACTGCATGTTTCCTCTGTGGG - Intergenic
1195596329 X:106694641-106694663 GCAATATAAGTTTCCTCAGTGGG + Intronic