ID: 902931166

View in Genome Browser
Species Human (GRCh38)
Location 1:19732521-19732543
Sequence TCCTCTCTAGATGATCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931162_902931166 17 Left 902931162 1:19732481-19732503 CCAAAGTCAAGGCACAGGATGAC 0: 1
1: 0
2: 2
3: 14
4: 168
Right 902931166 1:19732521-19732543 TCCTCTCTAGATGATCAATGAGG 0: 1
1: 0
2: 0
3: 11
4: 147
902931163_902931166 -5 Left 902931163 1:19732503-19732525 CCAGCGTCCTTTCTCACCTCCTC 0: 1
1: 0
2: 3
3: 67
4: 598
Right 902931166 1:19732521-19732543 TCCTCTCTAGATGATCAATGAGG 0: 1
1: 0
2: 0
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931166 Original CRISPR TCCTCTCTAGATGATCAATG AGG Intronic
902931166 1:19732521-19732543 TCCTCTCTAGATGATCAATGAGG + Intronic
903058409 1:20652869-20652891 TCCTCACAAAAGGATCAATGCGG + Exonic
904220251 1:28961593-28961615 TTCTCTCTACTTGAACAATGAGG + Intronic
908117426 1:60953681-60953703 TCCCCTCTAGTTTATAAATGAGG - Intronic
908384803 1:63631288-63631310 ACCTCTCAAGATGACGAATGGGG + Intronic
910164232 1:84307362-84307384 TCATCTCTAGCAGTTCAATGTGG + Intronic
911487898 1:98525647-98525669 TCATCTCTAGATGGTTACTGTGG + Intergenic
911853728 1:102851818-102851840 TCCTCTTCAGATATTCAATGTGG + Intergenic
913288599 1:117251104-117251126 TCCTATCTATAGGAACAATGGGG + Intergenic
914247524 1:145897124-145897146 TCCTCTGTAGTTGTTCCATGAGG - Intronic
914889013 1:151606443-151606465 CCCTCTCTAGGTGCTCAGTGTGG - Intergenic
915770289 1:158415126-158415148 TCCTCTCTCAATGCTCACTGAGG - Intergenic
916026313 1:160836644-160836666 CCCTCTCTAGATCATCTTTGAGG + Intronic
920170509 1:204069504-204069526 TCCTATCTATAGGAACAATGGGG - Intergenic
921191855 1:212716732-212716754 TCCTCTCTAGACTATTAATATGG + Intergenic
921798431 1:219374592-219374614 TCCTGTCTATAGGAACAATGAGG - Intergenic
923100705 1:230814207-230814229 TCATCTCTAGAAGTTCAATTTGG + Intergenic
924056875 1:240132748-240132770 TACTCTCTAGATGATCATGGAGG + Intronic
924595760 1:245443473-245443495 TCTCCTCTAGATGAACAGTGAGG - Intronic
924595798 1:245443734-245443756 TCTCCTCTAGATGAACAGTGAGG - Intronic
924595844 1:245444015-245444037 TCTCCTCTAGATGAACAGTGAGG - Intronic
1062845094 10:697453-697475 GCCTCTCTGGATGCTCACTGAGG + Intergenic
1065735255 10:28745608-28745630 TCCTGTCTATAGGAACAATGAGG + Intergenic
1070420913 10:76236311-76236333 TCCTGTCTATAGGAACAATGGGG - Intronic
1071871690 10:89802424-89802446 ACCTGTCAAGATGATCCATGAGG + Intergenic
1071939049 10:90567396-90567418 TCCTCTCTTGTTTATCACTGTGG + Intergenic
1072078383 10:92002086-92002108 TCATCTCTAGAAGTTCAATTTGG - Intronic
1073718038 10:106130782-106130804 GCCTCTCTGGATTATCAATAAGG - Intergenic
1074388508 10:113036811-113036833 TCCTCTCAGGCTGTTCAATGTGG - Intronic
1074714059 10:116202150-116202172 TCCTCTCTAGGAGCTCAATCGGG + Intronic
1079939620 11:26662610-26662632 TTCTTTCTAGTTGATCAATATGG - Exonic
1087551431 11:99655257-99655279 TCCTATCTATAGGAACAATGTGG + Intronic
1087798467 11:102478773-102478795 TCCTATCCAGAGGAACAATGTGG + Intronic
1088102429 11:106170082-106170104 TCCTATCTATAGGAACAATGAGG - Intergenic
1088148280 11:106712333-106712355 TCCTCTATAGAAGTTCAATTTGG + Intronic
1098313607 12:69171376-69171398 TCCTGTCTATAGGAACAATGGGG + Intergenic
1100472935 12:94909889-94909911 TCCTCTCTACTTGAGCAATGAGG - Intronic
1101213098 12:102554113-102554135 TCTTCTTTAGATGAGAAATGAGG - Intergenic
1103220207 12:119238068-119238090 TCATCTCTAGAAGTTCAATTGGG + Intergenic
1104601504 12:130156972-130156994 TCCTCCCCAGATCATCACTGTGG + Intergenic
1107517686 13:41147418-41147440 TCCTATCTATAGGAACAATGGGG - Intergenic
1107529452 13:41268096-41268118 TCCTATCTATAAGAGCAATGGGG + Intergenic
1108253540 13:48589759-48589781 TCCTATCTCTATGAACAATGGGG + Intergenic
1108438045 13:50420726-50420748 TCCTGTCTTTATGTTCAATGTGG - Intronic
1108737053 13:53295142-53295164 TCCTATCTATAGGAACAATGGGG + Intergenic
1108853043 13:54758959-54758981 TGCTCACTAGATGAGCAATAGGG + Intergenic
1116231048 14:42217291-42217313 TCCTCACTAAATTATTAATGTGG + Intergenic
1118086508 14:62424134-62424156 TCCTCTCTAGATGTTCTATTTGG - Intergenic
1126759300 15:51954720-51954742 ACCTCTCTAGGTGATTAAAGAGG - Intronic
1127839132 15:62815030-62815052 TCTTCTCTAGATTAGCAATTTGG - Intronic
1132297619 15:100752898-100752920 TCCTCATTAGAACATCAATGAGG + Intergenic
1134927202 16:18174890-18174912 TTCTCTCTTGATGAACAATTGGG - Intergenic
1135321469 16:21500967-21500989 TCCTGTCTTTTTGATCAATGGGG - Intergenic
1135396788 16:22137876-22137898 TCCTATCTAGAGGAACAACGGGG + Intronic
1135437483 16:22438252-22438274 TCCTGTCTTTTTGATCAATGGGG + Intergenic
1135850545 16:25959321-25959343 TCCTATCTATAGGAACAATGAGG + Intronic
1136332946 16:29594078-29594100 TCCTGTCTTTTTGATCAATGGGG - Intergenic
1136447642 16:30334166-30334188 TCCTATCTTTTTGATCAATGGGG - Intergenic
1137496880 16:48976568-48976590 TCATCTCTAGAAGTTCAATTTGG + Intergenic
1138787433 16:59864109-59864131 TCCTATCTATAGGAACAATGGGG - Intergenic
1139841501 16:69884716-69884738 TCCTCTAAAAATGAACAATGAGG - Intronic
1140203300 16:72912256-72912278 TCCTTTCAAGATAATTAATGAGG - Intronic
1149327097 17:55543130-55543152 TCATCTCTAGAAGATTAATTTGG + Intergenic
1151784653 17:76269607-76269629 TCCTCTCTTTATGACAAATGAGG - Intronic
1153339071 18:3955761-3955783 TTCTCTCTAGATGTTCAATTGGG - Intronic
1153833715 18:8945562-8945584 TCCTGTCTATAGGAACAATGGGG - Intergenic
1155140118 18:23037328-23037350 TCCTATCTACAGGAACAATGGGG - Intergenic
1156618236 18:38814744-38814766 TCCTCTTTAGTTCATTAATGTGG + Intergenic
1160337803 18:78058258-78058280 TCTTTTCTAAATGATCAGTGTGG - Intergenic
1164821566 19:31255146-31255168 TCCACTGTTGATCATCAATGGGG + Intergenic
1165145911 19:33729997-33730019 TCCTGTCTATAGGAGCAATGGGG + Intronic
1165192575 19:34077633-34077655 TCCTGTCTATAGGAGCAATGGGG + Intergenic
1165458331 19:35928190-35928212 TCCTATCTATAGGAACAATGGGG + Intergenic
925430695 2:3790271-3790293 GCCTCTTTAAATGATCAAAGTGG + Intronic
930309522 2:49721419-49721441 TCCTCTTTAGATCAGAAATGAGG + Intergenic
930427666 2:51232972-51232994 TCCTATCTATAAGAACAATGGGG - Intergenic
935380881 2:102449858-102449880 TCCTTCCTACATGAGCAATGAGG + Intronic
935516552 2:104047395-104047417 TCCTCTCTAGTTGCTGATTGTGG + Intergenic
937003927 2:118493878-118493900 TCCTGTCTACAGGAACAATGAGG + Intergenic
938729307 2:134133959-134133981 TCCTGTCTATAGGAACAATGGGG + Intronic
946638066 2:221752393-221752415 ACATCTCTGGATGATCAATTAGG + Intergenic
947987486 2:234461400-234461422 TCCTCTGAAGATTATAAATGAGG + Intergenic
1169859122 20:10132974-10132996 TCCTCTCTCTATGAACACTGGGG - Intergenic
1173289876 20:41705192-41705214 TCCCCTCTTGATGAGCAATTGGG - Intergenic
1174756190 20:53160778-53160800 CCCTTTCTAGATGAACCATGTGG + Intronic
1177826919 21:26094504-26094526 TCCTCTCTGGATGTTTACTGGGG - Intronic
1179599292 21:42465345-42465367 TCCTGTCTAGAGGAACAGTGGGG + Intergenic
1184836246 22:47023191-47023213 TCCTCTCTGTAAGTTCAATGTGG - Intronic
1184896719 22:47411847-47411869 TCATCTCTAGATGTTCAATTTGG - Intergenic
950593255 3:13954681-13954703 TCCACTTGGGATGATCAATGAGG - Intronic
950712495 3:14822598-14822620 TCCACTCGGGATGATCAATGAGG - Intronic
953407897 3:42668721-42668743 TTCTTTCTAAAGGATCAATGAGG + Intergenic
962271179 3:133979050-133979072 TCCTCTCTAGACTATGTATGGGG + Intronic
962379378 3:134885130-134885152 TCATCTCTAGATGTTCTATTTGG - Intronic
967772371 3:193348337-193348359 TCCTCTAGAGATGAGTAATGAGG + Intronic
969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG + Intronic
970614599 4:17756459-17756481 TCCTCCAAAGATGACCAATGAGG - Intronic
971403475 4:26298356-26298378 TCCTCTCTAGATGGTCATTTGGG - Intronic
972280717 4:37599557-37599579 TCCTATCTATAGGAACAATGGGG + Intronic
979694342 4:123595356-123595378 TCATCTATAGTTTATCAATGGGG + Intergenic
983032904 4:162825507-162825529 CCCTTTCAACATGATCAATGAGG + Intergenic
989036887 5:37183265-37183287 TCCTCTTTAAATGATGAATATGG - Exonic
991473206 5:66991760-66991782 GCCACTCTAGATGTTAAATGTGG + Intronic
991562020 5:67963934-67963956 TCCTATCTATAGGATCAGTGAGG + Intergenic
994743254 5:103647297-103647319 TCCTATCTATAGGAACAATGGGG - Intergenic
996665508 5:126055342-126055364 TGCTCTCTAGATGGTCAAGGTGG + Intergenic
1000613574 5:163402334-163402356 TTCTCTCTACATGACCAATATGG - Intergenic
1001616665 5:173048368-173048390 TCCTGTCTATAGGAACAATGGGG + Intergenic
1004433666 6:15569165-15569187 TCCTATCTAGAGGAACAGTGGGG - Intronic
1006704478 6:36006861-36006883 TTCTCTTTAGATGATTAATATGG - Intronic
1007138589 6:39547843-39547865 TCCTCTCTTGATGGACACTGAGG + Intronic
1013482850 6:110567006-110567028 TTCTCTCTATAGGAACAATGAGG - Intergenic
1016631130 6:146233004-146233026 TCCTTTCTTCTTGATCAATGGGG + Intronic
1017444665 6:154496525-154496547 TCCTCTATAGATAACCAATGTGG + Intronic
1020402718 7:7796606-7796628 TCCTATCTATAGGAACAATGGGG - Intronic
1021232292 7:18100588-18100610 TCATCTCTTGAAGTTCAATGGGG + Intronic
1025869101 7:65414222-65414244 TCCTCTCTACATGGTCATTCGGG - Intergenic
1026245527 7:68616221-68616243 TCCTCTCTATAGGAACAATGGGG + Intergenic
1026577550 7:71585571-71585593 CCCTCTTAAGATGACCAATGAGG + Intronic
1028290302 7:89057148-89057170 TCCTGTCTATAGGAACAATGGGG + Intronic
1028473208 7:91226675-91226697 TCCTCTCCAGATGGCAAATGAGG - Intergenic
1029616975 7:101665200-101665222 TCTTCTTTAGCTGAACAATGGGG - Intergenic
1030060413 7:105616973-105616995 TCCTCTCTAAATGAGCCATCTGG - Intronic
1031115856 7:117667699-117667721 TGCTCACTAGATGTTGAATGGGG - Exonic
1031427460 7:121623375-121623397 TCGTGTATAGATGATGAATGAGG + Intergenic
1033831654 7:145261947-145261969 TCATCTCTAGAAGTTCAATTTGG + Intergenic
1034308391 7:150065504-150065526 TGCTCACTAGCTGATCATTGGGG - Intergenic
1036057172 8:5269045-5269067 TCATCTCTAAATGAAGAATGTGG - Intergenic
1037707973 8:21331661-21331683 TCCTGTCTATAGGAACAATGGGG + Intergenic
1038706980 8:29903407-29903429 TCCTATCTATAGGAACAATGGGG + Intergenic
1039200033 8:35081219-35081241 TCCTATCTACAGGAGCAATGGGG - Intergenic
1039753045 8:40495768-40495790 TCCTCTCTGAATAATCTATGTGG - Intergenic
1039929554 8:41972314-41972336 TCATCTCTGGATGCTAAATGTGG + Intronic
1041390111 8:57340225-57340247 TTCTCTCTTGAAGACCAATGTGG - Intergenic
1046095332 8:109552314-109552336 TCATCTCTGGATGATCACTGGGG + Intronic
1046265598 8:111825358-111825380 TCCTATCTATAGGAACAATGGGG - Intergenic
1046794038 8:118351243-118351265 TCCTCTCAAAATGATCACAGGGG + Intronic
1047425206 8:124739135-124739157 TCCTCTCTAGATTCTCACTAAGG + Intergenic
1048545794 8:135386041-135386063 TCCTATAGAGATGAGCAATGAGG + Intergenic
1048545827 8:135386345-135386367 TCCTATAGAGATGAGCAATGAGG + Intergenic
1048545835 8:135386431-135386453 TCCTATAGAGATGAGCAATGAGG + Intergenic
1048545839 8:135386474-135386496 TCCTATAGAGATGAGCAATGAGG + Intergenic
1048545861 8:135386689-135386711 TCCTATAGAGATGAGCAATGAGG + Intergenic
1050247801 9:3709348-3709370 TCATCTCTAGAAGTTCAATTTGG - Intergenic
1051711682 9:19936786-19936808 TTATCTCAAGATGATAAATGGGG + Intergenic
1057990470 9:99763672-99763694 TTTTCTCTAGATGATCAAATTGG - Intergenic
1059255563 9:112927722-112927744 CCCTCCCGGGATGATCAATGGGG + Intergenic
1059316672 9:113431462-113431484 TCCTCTGTAATTGATTAATGTGG + Intergenic
1187013155 X:15300223-15300245 TCCACTCTAGATGATCTTTCAGG - Intronic
1189962940 X:46341720-46341742 TCCTGTCTATAGGAACAATGGGG + Intergenic
1190865201 X:54378560-54378582 TCATCTCTAGAAGTTCAATTTGG - Intergenic
1192956456 X:76075886-76075908 TCCTCTCTATATGGTGACTGTGG - Intergenic
1193597071 X:83459855-83459877 TCTTCTTTTGATGATGAATGTGG - Intergenic
1194539879 X:95156933-95156955 TCCTCTCTATATGGTGACTGTGG - Intergenic
1195477093 X:105299629-105299651 TCCTGTCTATAGGAACAATGGGG + Intronic
1197578225 X:128249210-128249232 TCCTCTTAAGATCATGAATGAGG + Intergenic
1197989080 X:132297671-132297693 TCATCTCTAGAAGTTCAATTTGG + Intergenic
1200148539 X:153940061-153940083 TCCCCTCTAGAGGCTGAATGGGG - Intronic
1202012700 Y:20363602-20363624 TTCTCTCTAGATCAGAAATGAGG + Intergenic