ID: 902931732

View in Genome Browser
Species Human (GRCh38)
Location 1:19736309-19736331
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9058
Summary {0: 4, 1: 532, 2: 2392, 3: 3151, 4: 2979}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931732_902931745 8 Left 902931732 1:19736309-19736331 CCCACCCCCCTGATTCAATTACC 0: 4
1: 532
2: 2392
3: 3151
4: 2979
Right 902931745 1:19736340-19736362 GGTCCCTCCCATGACCCATGTGG 0: 8
1: 398
2: 1030
3: 2122
4: 3341
902931732_902931749 15 Left 902931732 1:19736309-19736331 CCCACCCCCCTGATTCAATTACC 0: 4
1: 532
2: 2392
3: 3151
4: 2979
Right 902931749 1:19736347-19736369 CCCATGACCCATGTGGATTGTGG 0: 1
1: 0
2: 46
3: 710
4: 1781
902931732_902931751 16 Left 902931732 1:19736309-19736331 CCCACCCCCCTGATTCAATTACC 0: 4
1: 532
2: 2392
3: 3151
4: 2979
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931732 Original CRISPR GGTAATTGAATCAGGGGGGT GGG (reversed) Intronic