ID: 902931733

View in Genome Browser
Species Human (GRCh38)
Location 1:19736310-19736332
Sequence AGGTAATTGAATCAGGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15810
Summary {0: 6, 1: 1245, 2: 3410, 3: 5315, 4: 5834}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931733_902931751 15 Left 902931733 1:19736310-19736332 CCACCCCCCTGATTCAATTACCT 0: 6
1: 1245
2: 3410
3: 5315
4: 5834
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772
902931733_902931749 14 Left 902931733 1:19736310-19736332 CCACCCCCCTGATTCAATTACCT 0: 6
1: 1245
2: 3410
3: 5315
4: 5834
Right 902931749 1:19736347-19736369 CCCATGACCCATGTGGATTGTGG 0: 1
1: 0
2: 46
3: 710
4: 1781
902931733_902931745 7 Left 902931733 1:19736310-19736332 CCACCCCCCTGATTCAATTACCT 0: 6
1: 1245
2: 3410
3: 5315
4: 5834
Right 902931745 1:19736340-19736362 GGTCCCTCCCATGACCCATGTGG 0: 8
1: 398
2: 1030
3: 2122
4: 3341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931733 Original CRISPR AGGTAATTGAATCAGGGGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr