ID: 902931734

View in Genome Browser
Species Human (GRCh38)
Location 1:19736313-19736335
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28781
Summary {0: 19, 1: 3127, 2: 6337, 3: 9318, 4: 9980}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931734_902931745 4 Left 902931734 1:19736313-19736335 CCCCCCTGATTCAATTACCTCCC 0: 19
1: 3127
2: 6337
3: 9318
4: 9980
Right 902931745 1:19736340-19736362 GGTCCCTCCCATGACCCATGTGG 0: 8
1: 398
2: 1030
3: 2122
4: 3341
902931734_902931751 12 Left 902931734 1:19736313-19736335 CCCCCCTGATTCAATTACCTCCC 0: 19
1: 3127
2: 6337
3: 9318
4: 9980
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772
902931734_902931749 11 Left 902931734 1:19736313-19736335 CCCCCCTGATTCAATTACCTCCC 0: 19
1: 3127
2: 6337
3: 9318
4: 9980
Right 902931749 1:19736347-19736369 CCCATGACCCATGTGGATTGTGG 0: 1
1: 0
2: 46
3: 710
4: 1781

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931734 Original CRISPR GGGAGGTAATTGAATCAGGG GGG (reversed) Intronic