ID: 902931735

View in Genome Browser
Species Human (GRCh38)
Location 1:19736314-19736336
Sequence TGGGAGGTAATTGAATCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29997
Summary {0: 28, 1: 3156, 2: 6514, 3: 9422, 4: 10877}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931735_902931751 11 Left 902931735 1:19736314-19736336 CCCCCTGATTCAATTACCTCCCA 0: 28
1: 3156
2: 6514
3: 9422
4: 10877
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772
902931735_902931745 3 Left 902931735 1:19736314-19736336 CCCCCTGATTCAATTACCTCCCA 0: 28
1: 3156
2: 6514
3: 9422
4: 10877
Right 902931745 1:19736340-19736362 GGTCCCTCCCATGACCCATGTGG 0: 8
1: 398
2: 1030
3: 2122
4: 3341
902931735_902931749 10 Left 902931735 1:19736314-19736336 CCCCCTGATTCAATTACCTCCCA 0: 28
1: 3156
2: 6514
3: 9422
4: 10877
Right 902931749 1:19736347-19736369 CCCATGACCCATGTGGATTGTGG 0: 1
1: 0
2: 46
3: 710
4: 1781

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931735 Original CRISPR TGGGAGGTAATTGAATCAGG GGG (reversed) Intronic
Too many off-targets to display for this crispr