ID: 902931736

View in Genome Browser
Species Human (GRCh38)
Location 1:19736315-19736337
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29633
Summary {0: 33, 1: 3223, 2: 6518, 3: 9352, 4: 10507}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931736_902931751 10 Left 902931736 1:19736315-19736337 CCCCTGATTCAATTACCTCCCAC 0: 33
1: 3223
2: 6518
3: 9352
4: 10507
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772
902931736_902931749 9 Left 902931736 1:19736315-19736337 CCCCTGATTCAATTACCTCCCAC 0: 33
1: 3223
2: 6518
3: 9352
4: 10507
Right 902931749 1:19736347-19736369 CCCATGACCCATGTGGATTGTGG 0: 1
1: 0
2: 46
3: 710
4: 1781
902931736_902931745 2 Left 902931736 1:19736315-19736337 CCCCTGATTCAATTACCTCCCAC 0: 33
1: 3223
2: 6518
3: 9352
4: 10507
Right 902931745 1:19736340-19736362 GGTCCCTCCCATGACCCATGTGG 0: 8
1: 398
2: 1030
3: 2122
4: 3341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931736 Original CRISPR GTGGGAGGTAATTGAATCAG GGG (reversed) Intronic