ID: 902931737

View in Genome Browser
Species Human (GRCh38)
Location 1:19736316-19736338
Sequence GGTGGGAGGTAATTGAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35958
Summary {0: 1659, 1: 4879, 2: 8898, 3: 10570, 4: 9952}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931737_902931749 8 Left 902931737 1:19736316-19736338 CCCTGATTCAATTACCTCCCACC 0: 1659
1: 4879
2: 8898
3: 10570
4: 9952
Right 902931749 1:19736347-19736369 CCCATGACCCATGTGGATTGTGG 0: 1
1: 0
2: 46
3: 710
4: 1781
902931737_902931745 1 Left 902931737 1:19736316-19736338 CCCTGATTCAATTACCTCCCACC 0: 1659
1: 4879
2: 8898
3: 10570
4: 9952
Right 902931745 1:19736340-19736362 GGTCCCTCCCATGACCCATGTGG 0: 8
1: 398
2: 1030
3: 2122
4: 3341
902931737_902931751 9 Left 902931737 1:19736316-19736338 CCCTGATTCAATTACCTCCCACC 0: 1659
1: 4879
2: 8898
3: 10570
4: 9952
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931737 Original CRISPR GGTGGGAGGTAATTGAATCA GGG (reversed) Intronic
Too many off-targets to display for this crispr