ID: 902931738

View in Genome Browser
Species Human (GRCh38)
Location 1:19736317-19736339
Sequence CGGTGGGAGGTAATTGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 630
Summary {0: 7, 1: 50, 2: 109, 3: 187, 4: 277}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931738_902931751 8 Left 902931738 1:19736317-19736339 CCTGATTCAATTACCTCCCACCG 0: 7
1: 50
2: 109
3: 187
4: 277
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772
902931738_902931745 0 Left 902931738 1:19736317-19736339 CCTGATTCAATTACCTCCCACCG 0: 7
1: 50
2: 109
3: 187
4: 277
Right 902931745 1:19736340-19736362 GGTCCCTCCCATGACCCATGTGG 0: 8
1: 398
2: 1030
3: 2122
4: 3341
902931738_902931749 7 Left 902931738 1:19736317-19736339 CCTGATTCAATTACCTCCCACCG 0: 7
1: 50
2: 109
3: 187
4: 277
Right 902931749 1:19736347-19736369 CCCATGACCCATGTGGATTGTGG 0: 1
1: 0
2: 46
3: 710
4: 1781

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931738 Original CRISPR CGGTGGGAGGTAATTGAATC AGG (reversed) Intronic
900728543 1:4235524-4235546 TGGTGGGAGATAATTGAATCAGG + Intergenic
900740304 1:4327042-4327064 TGGTGGGAGGTGATTGGATCTGG + Intergenic
900740317 1:4327083-4327105 TGGTGGGAGGTGATTGGATCTGG + Intergenic
900740330 1:4327124-4327146 TGGTGGGAGGTGATTGGATCTGG + Intergenic
900740343 1:4327165-4327187 TGGTGGGAGGTGATTGGATCTGG + Intergenic
900740356 1:4327206-4327228 TGGTGGGAGGTGATTGGATCTGG + Intergenic
900811801 1:4808356-4808378 TAGTGGGAGGTGATTGGATCAGG + Intergenic
900895914 1:5482710-5482732 GGGAGGGAGGTGATTGGATCAGG + Intergenic
901750919 1:11407788-11407810 CAGCGGGAGATGATTGAATCAGG + Intergenic
902931738 1:19736317-19736339 CGGTGGGAGGTAATTGAATCAGG - Intronic
907448543 1:54526679-54526701 TGGTGGGAGGTGATTGGATGAGG + Intergenic
908442782 1:64171390-64171412 TGGTGGGAGGTAATTGAGTCAGG - Intronic
909097337 1:71304149-71304171 TGGTGGGAAGTGATTGGATCTGG - Intergenic
909200618 1:72686801-72686823 TGGTGGAAGGTAAATCAATCAGG - Intergenic
909368781 1:74860335-74860357 TGATGGGAGGTAATTGGATCAGG - Intergenic
909681122 1:78293451-78293473 CAAGGGGAGGTAATTGAATCAGG + Intergenic
909732975 1:78918988-78919010 TGGTGGAAGGTAATTGAAATAGG + Intronic
910289978 1:85590189-85590211 TGGTGGGAGTTAACTGAATCAGG + Intergenic
910336539 1:86138459-86138481 TGGTGGGAGGTGATTGAACCAGG + Intronic
911361371 1:96881385-96881407 TGATAAGAGGTAATTGAATCAGG - Intergenic
911467358 1:98272406-98272428 AGGGTGGAGGTAATTGGATCAGG + Intergenic
911972020 1:104451308-104451330 CGGTGGGAGGTGATTGAATCAGG + Intergenic
912117873 1:106429500-106429522 TGGTGGGAGGTAACTGAATCAGG - Intergenic
913241872 1:116836500-116836522 CGGTAGCAGGTATTTGAATCTGG + Intergenic
913435169 1:118840171-118840193 CAGTGGGAGATAATTGAACATGG - Intergenic
914904918 1:151736089-151736111 CGGTGGGAGGTGATTGGATTAGG + Intergenic
915219089 1:154359633-154359655 TGGTGGGAGGTAATTGATCATGG - Intergenic
915870989 1:159559421-159559443 TGGTGGGAAGTGATTGGATCAGG - Intergenic
915989420 1:160498595-160498617 TGGTAGGAGGTAATTGAATCTGG - Intronic
916302000 1:163285672-163285694 TGGTGGGAGGTGATTGAATCAGG + Intronic
916466925 1:165082070-165082092 TGGTAGGAGGTGATTGGATCAGG - Intergenic
916467961 1:165091397-165091419 TGGTGGGAGGTAATTGAATCAGG + Intergenic
917985134 1:180308821-180308843 GGGTGGGAAGTAAATGAATCTGG + Intronic
918180272 1:182081309-182081331 TGGTGGGAAGTAATTGAAACAGG - Intergenic
918844883 1:189595752-189595774 TTGTGGGAGGTGATTGGATCAGG + Intergenic
919212966 1:194511416-194511438 TGGTCGCAGGTGATTGAATCAGG + Intergenic
919480361 1:198080366-198080388 TGGTGGGAGATGACTGAATCTGG + Intergenic
921761848 1:218924029-218924051 CAGTGAGAAGTAATTGAATCAGG + Intergenic
922670262 1:227504355-227504377 CAGTGGGAGGTAATTGAATCAGG - Intergenic
922672702 1:227524068-227524090 TGGTGGTAGGTGTTTGAATCTGG - Intergenic
922970985 1:229737939-229737961 TGGTGGGAGGTAACTGAATCAGG - Intergenic
923238838 1:232061006-232061028 CAGTGGGAGGCATTTGAGTCTGG + Intergenic
924175258 1:241385129-241385151 CCTTGGGAAGTAATTGAATATGG - Intergenic
924242571 1:242055245-242055267 CAGTGGGAGGTAATTGAATCAGG - Intergenic
1062764579 10:51050-51072 CAGTGGGAGGTAATTGAATCAGG + Intergenic
1063065609 10:2605705-2605727 CAGTGGAAGGTAATTGAATCAGG - Intergenic
1063171491 10:3513761-3513783 GAGTGGGAGGTAATTGAATCAGG + Intergenic
1063544228 10:6964240-6964262 CTGAGGGAAGTAATTGAATCAGG + Intergenic
1063892339 10:10643289-10643311 CAGTTGGAGATAGTTGAATCAGG + Intergenic
1064194745 10:13235576-13235598 CTGTGGAAGGTGATTGAATTTGG - Intergenic
1064403234 10:15038479-15038501 CAGTGAGAGGTGGTTGAATCAGG + Intronic
1064693065 10:17937811-17937833 GGGAGGGAGGTAATTGGATCTGG - Intergenic
1065436869 10:25711740-25711762 CGGTGGGAGGTGATTGGATCAGG - Intergenic
1065852798 10:29804846-29804868 CAGTGGGAGATAATTGAATATGG + Intergenic
1066128118 10:32362327-32362349 CGGTGGGAGCTGCTTGGATCAGG + Intronic
1067012406 10:42726818-42726840 TGGTGGGAGGTGATTAGATCTGG + Intergenic
1067188933 10:44053739-44053761 AGGTGGGAGGTGAATTAATCAGG - Intergenic
1067287590 10:44918174-44918196 CAGCAGGAGGTAATTGAATCAGG - Intronic
1067964295 10:50891415-50891437 AGGTGGGAGGTACTTAACTCAGG - Intergenic
1068037761 10:51782631-51782653 TGGTGGGAGATAACTGAATCTGG + Intronic
1068284307 10:54914206-54914228 TGGTGGGAAGTGATTGGATCGGG + Intronic
1068552814 10:58425674-58425696 CGGGAGGAGGTAATTGAATCAGG - Intergenic
1069826356 10:71257316-71257338 AAGTGGGAGGTAAGTGAATAGGG + Intronic
1070922321 10:80195899-80195921 TGGTGGGAGGTAACTGAATGGGG - Intronic
1070993536 10:80754359-80754381 CAGTGGGAGGTAATTGAATCGGG + Intergenic
1071119818 10:82264422-82264444 CGGGTGGAGATAATTGAATCGGG - Intronic
1073396502 10:103222630-103222652 TGGTGGGAGGTGATTGGATTAGG - Intergenic
1073734341 10:106328231-106328253 CGGTGGGAGGTGATTGAATTAGG - Intergenic
1073855073 10:107664177-107664199 CGGTGGGAGGTGATTGAATTAGG - Intergenic
1074290213 10:112132648-112132670 TGGTGGGAAGTGATTGGATCAGG + Intergenic
1074580023 10:114710504-114710526 TGGTGGGAGATAATTTAATATGG - Intergenic
1074588826 10:114793206-114793228 TGGTGGGAGGTAACTGGATCAGG + Intergenic
1074708006 10:116152594-116152616 TGGTGGGAGGTGATTGGGTCAGG - Intronic
1074773465 10:116748794-116748816 TAGTGGGAGGTAATTGGATCAGG - Intergenic
1075509272 10:123056428-123056450 CAGGGGGAGGTCATCGAATCAGG - Exonic
1075516269 10:123110987-123111009 CAGTGGGAGGTAATTGAACACGG + Intergenic
1075673837 10:124282318-124282340 TGGTGGGAGGTGTTTGAATCTGG - Intergenic
1076492066 10:130868437-130868459 TGGTGGGAGGTGATTGGATCTGG - Intergenic
1076509885 10:131005768-131005790 TGGTGGGAGGTGATTGGATCAGG + Intergenic
1076856631 10:133118668-133118690 TGGTGGGAGGTGACTGGATCAGG - Intronic
1078301325 11:10134253-10134275 CAGTGGGAGGTAATTGAATCAGG - Intronic
1078744637 11:14100001-14100023 TGGTGGGAGGTGATCGGATCAGG - Intronic
1078959392 11:16247673-16247695 TGGTGGGAGGTAATTGTAGGTGG - Intronic
1079143978 11:17834130-17834152 TGGTGGGAGGTAATTGAATCAGG + Intronic
1079147885 11:17869993-17870015 CAGGTGGAGGTAATTGAATCAGG + Intronic
1079818681 11:25095380-25095402 TGGTGGGAGATAATTGAATCAGG + Intergenic
1080083179 11:28245904-28245926 TAGTGGGAGGTGATTGGATCAGG - Intronic
1080204777 11:29716424-29716446 CAGTGGGAGGTAATGGAATCAGG - Intergenic
1081226720 11:40533027-40533049 CAGGTGGAGGCAATTGAATCAGG - Intronic
1081234135 11:40625519-40625541 CTTTGGGAGGTAAGTGAATCAGG - Intronic
1081590223 11:44417616-44417638 TGGTGGGAGCTGATTGGATCAGG - Intergenic
1085818658 11:79769233-79769255 TGGTGGGAGGTGATTGAATCAGG + Intergenic
1086224485 11:84491224-84491246 TGGTGGGAGATAAGTGAATCAGG + Intronic
1086330026 11:85744691-85744713 TGGTGGGATGTCACTGAATCAGG - Intronic
1086871413 11:92041894-92041916 TGGTGGGAGATGATTGGATCAGG + Intergenic
1087377230 11:97359235-97359257 CAGTGTGAGGTCATTGAATTTGG - Intergenic
1087574685 11:99975708-99975730 TAGTGGGAGGTGATTGGATCAGG - Intronic
1087725620 11:101712915-101712937 CAGGAGGAGGTAATTGAATCAGG - Intronic
1090631366 11:128652046-128652068 CAGGTGGAGGTAATTGAATCAGG - Intergenic
1090935527 11:131338527-131338549 CGGTGGGAGGTAATCGGATCAGG - Intergenic
1091077018 11:132628738-132628760 CAGTGGGAGGTAATTGAATGAGG + Intronic
1092952181 12:13516634-13516656 GGGAGGGAGATGATTGAATCAGG + Intergenic
1093315717 12:17647409-17647431 TGGTGGGAGGTGACTGAATCGGG + Intergenic
1093692563 12:22124745-22124767 CAGTGGGAGATAATTGAATCAGG + Intronic
1094814365 12:34168759-34168781 CAGTGGGAGGTAATTGAATTGGG + Intergenic
1095102560 12:38199830-38199852 AAGTGGGAGGTAATTGAATTGGG - Intergenic
1096960397 12:55571156-55571178 CAATAGGAGATAATTGAATCAGG - Intergenic
1097469193 12:59967512-59967534 CAGGTGGAGGTAGTTGAATCAGG - Intergenic
1097522889 12:60690209-60690231 CAGTGGGAGGTGATTAAATTAGG + Intergenic
1097558032 12:61165644-61165666 CAGTGGGAGGTAATTGAATTAGG - Intergenic
1097750382 12:63346045-63346067 TGGTGGGAGGTAATTGGATCAGG - Intergenic
1098283583 12:68885617-68885639 CTGTGGGAGGTTAAGGAATCAGG - Intronic
1098694041 12:73528895-73528917 CAGGTGGAGGTAATTGGATCAGG + Intergenic
1098836222 12:75427704-75427726 TGGTGGGAGGTAATTAGATCAGG + Intronic
1099568023 12:84277986-84278008 TGGTGGGAGGTGATTGAATCAGG - Intergenic
1099635330 12:85205009-85205031 AGGTGTGAGATAATTAAATCAGG + Intronic
1099812680 12:87604966-87604988 CAATGGGAGGTAATTGAATCAGG - Intergenic
1100714322 12:97289928-97289950 CAGGGGGAGGTAATTGAATCAGG - Intergenic
1100722852 12:97377077-97377099 CGGTGGGAGGTAATTGAATCAGG - Intergenic
1100789297 12:98112700-98112722 TGGTGGGAGGTGATTGGATCAGG + Intergenic
1100933755 12:99639575-99639597 CAGTTGGAGGCAATTGGATCAGG + Intronic
1101842975 12:108341251-108341273 AGGTGGGAGGTAATTGAACATGG - Intergenic
1102729014 12:115091644-115091666 TGGTGGGAGGTGACTGGATCAGG + Intergenic
1103002917 12:117399401-117399423 TGGTGGGAGATAATTAAATCAGG - Intronic
1103286381 12:119804709-119804731 CGCTGGGAAGTAATTGGAGCAGG + Intronic
1103686505 12:122736185-122736207 CAGTGGGAGGTAATTGAACCAGG + Intergenic
1104100049 12:125599126-125599148 TAGTGGGAGGTAACTGAATCAGG + Intronic
1104133020 12:125912968-125912990 AGGCGGGAGGTAATTGAAAAAGG + Intergenic
1104746383 12:131213614-131213636 CAGTGGGAGGTGATTGAGTCAGG - Intergenic
1107863155 13:44680262-44680284 TTGTGGGAGATAATTGAATCAGG + Intergenic
1108102879 13:46976089-46976111 TGGTGGAAGGTGATTGGATCAGG + Intergenic
1108790408 13:53963061-53963083 TAGTGGGAGGTGATTGAATCAGG - Intergenic
1108832671 13:54499011-54499033 CAGTGAGAGGTAATTGGGTCAGG + Intergenic
1109169410 13:59076866-59076888 CAGTGGGAGGTAACTGAATCAGG - Intergenic
1109717514 13:66235219-66235241 TGGTGGAAGGTGATTGGATCTGG + Intergenic
1109958990 13:69605976-69605998 CACTGAGAAGTAATTGAATCAGG - Intergenic
1110124976 13:71931491-71931513 AGGGTGGAGGTAATTGGATCAGG + Intergenic
1110758646 13:79205304-79205326 TGGTGGGAGGTATTTGGGTCAGG - Intergenic
1110893071 13:80714089-80714111 TAGTGGGAGGTAATAGGATCAGG - Intergenic
1110895435 13:80745330-80745352 CGTTGGGAGGTCATTAGATCAGG + Intergenic
1111031852 13:82610794-82610816 CTGTGGCAGGTAATTGTAACAGG + Intergenic
1111033457 13:82637904-82637926 AGGTAGGAGGTAAGTGAATCAGG + Intergenic
1111241475 13:85481201-85481223 TTGTGGGAGGTGATTGGATCAGG - Intergenic
1111358651 13:87145193-87145215 CAGGTGGAGGTAATTGAATTAGG + Intergenic
1111536486 13:89608288-89608310 TGGTGGAAGGTAATTGAATCAGG - Intergenic
1112812544 13:103234856-103234878 TGGCAGGAGATAATTGAATCAGG + Intergenic
1112826461 13:103397940-103397962 CAGTGGGAGGTAATTGAATCAGG - Intergenic
1113158681 13:107354535-107354557 TGGTGGGAGGTGAGTGGATCAGG - Intronic
1113567526 13:111327660-111327682 CCGTGGGAGGTAAAGGAAGCAGG - Intronic
1113794157 13:113047196-113047218 TGGTGGGAGGTGATTAAGTCTGG - Intronic
1114140100 14:19900141-19900163 TGGTTGGAGGTGATTGAATCAGG + Intergenic
1114680615 14:24481101-24481123 CAGTGGGAGGTAATTGAATCAGG - Intergenic
1114693232 14:24604861-24604883 CAGTGGGAAGTTATTGAATCGGG + Intergenic
1114712262 14:24790492-24790514 TGGTGGGAAGTAATTGAATCAGG + Intergenic
1114780601 14:25534170-25534192 CAGGTGGAGATAATTGAATCAGG - Intergenic
1115021729 14:28689257-28689279 AGGAGGGAAGTATTTGAATCTGG - Intergenic
1115934963 14:38542178-38542200 CAGGTGGAGGTAATTGAATCTGG - Intergenic
1116599048 14:46895192-46895214 CAGTGGGAGGTAATTGAATCAGG + Intronic
1117083974 14:52180531-52180553 TGGTGGGAGGTAATTGAATCTGG - Intergenic
1117762995 14:59051938-59051960 TGGTTGGAGGTGATTGGATCAGG + Intergenic
1118101717 14:62613203-62613225 TGGTGTGAGGTGACTGAATCGGG - Intergenic
1118439686 14:65801230-65801252 TGCTGGGCAGTAATTGAATCTGG + Intergenic
1119564025 14:75613476-75613498 TGGTGGGAGGTGATTGGGTCAGG - Intronic
1120213029 14:81653057-81653079 CAGTGGGAGGTAATTGAATCTGG + Intergenic
1120319011 14:82934827-82934849 CTGGGGGAGGTAACCGAATCGGG + Intergenic
1120390543 14:83902063-83902085 CAGTGAGAGATAATTGAATCAGG - Intergenic
1120428858 14:84388159-84388181 CTTTGGGAGGTAATTAAATCAGG - Intergenic
1120684079 14:87517674-87517696 TGGTGGGAGGTGATTGAATTAGG - Intergenic
1120712612 14:87808320-87808342 CAGTGGGAGATGATTGAATCAGG + Intergenic
1120827141 14:88966347-88966369 TGGTGGGAGGTAATTGAATCAGG - Intergenic
1121602480 14:95216287-95216309 TGGTGGGAGGTCATTGAATCGGG - Intronic
1121653841 14:95580664-95580686 CAGTGGGAGGTAAATGAATCAGG - Intergenic
1122344563 14:101050472-101050494 TGGTGGGAGGTAATTGAATCAGG + Intergenic
1122877263 14:104673968-104673990 TGGTGGGAGGTGACTGGATCAGG + Intergenic
1124001238 15:25762034-25762056 CGGTGGGAGGTAAATGACTCAGG + Intronic
1125981486 15:44005787-44005809 TGGTGGGAAGTGATTGGATCTGG - Intronic
1126733575 15:51709278-51709300 CAGTAGGAGGTAATTGAATCAGG - Intronic
1126906376 15:53372169-53372191 TGGTGGGAGGTGATTGGATCTGG + Intergenic
1127177042 15:56370388-56370410 AGGAAGGAGGAAATTGAATCTGG - Intronic
1127186545 15:56486264-56486286 CAGTGGGAGGTAATTGAATCAGG + Intergenic
1127576122 15:60294443-60294465 TAGGGGGAGGTAATTGAATATGG - Intergenic
1129614617 15:77088566-77088588 TGGTGGGAGGTGTTTGGATCAGG + Intergenic
1129970777 15:79776077-79776099 CTGTTGGGGGTGATTGAATCAGG - Intergenic
1130420145 15:83737372-83737394 TGGTGGGAGGTGATTGGATCGGG + Intronic
1130791335 15:87159286-87159308 TAGTGGGAGGTAACTGAGTCGGG + Intergenic
1130840926 15:87700723-87700745 TGGTGGGAGGTAATTGATCATGG + Intergenic
1131327597 15:91463354-91463376 TGGTGGGAGGTGATCGGATCAGG + Intergenic
1132661234 16:1062394-1062416 CCGTGGGTGCTGATTGAATCGGG + Intergenic
1134009014 16:10837407-10837429 TGGTGGGAGGTGATTGGATCAGG + Intergenic
1134275980 16:12776488-12776510 TGGTGGGAGGTAACTGAACTGGG + Intronic
1134840151 16:17395234-17395256 TGGTGGGAGGTGATTGGATGAGG - Intronic
1135148359 16:19983492-19983514 CAGTGGGAGGTAATTAAATCAGG - Intergenic
1137396479 16:48119057-48119079 GGGTGGGAGGAAATTGAAGGTGG - Intronic
1138198349 16:55070943-55070965 CAGTGAGAGGTAATTGAATCAGG - Intergenic
1138198998 16:55075154-55075176 TGGTGGTAGGTAATTTGATCAGG - Intergenic
1138613565 16:58146477-58146499 TGGTGGGAGGTATTTGGGTCAGG + Intergenic
1140115898 16:72041240-72041262 TGGTGGAAGGTAATTGAATCAGG - Intergenic
1140587435 16:76309722-76309744 CAGGTGGAGGTAATTGAATTGGG + Intronic
1141792988 16:86249234-86249256 TGGTGGGAGATAATTGAATCAGG + Intergenic
1142440074 16:90092202-90092224 CAGTGGGAGGTAATCGAATCAGG - Intergenic
1144415520 17:15042592-15042614 CAGTAGAAGGTTATTGAATCGGG + Intergenic
1145073423 17:19831288-19831310 TGGTGGGAGGTGAGTGAATGGGG - Intronic
1145116203 17:20212582-20212604 CAGTGGGAGGTAATTGAATCAGG - Intronic
1145188435 17:20817005-20817027 TGGTGGGAGGTGATTGGATCAGG + Intergenic
1145759099 17:27415778-27415800 TGGTGGGAGGGGATTGGATCTGG + Intergenic
1149162968 17:53717016-53717038 TGGTGGGAGGTGATTGGATCAGG - Intergenic
1149190187 17:54051571-54051593 CAGTGGGAGGTAACTGAATCAGG - Intergenic
1151006968 17:70449057-70449079 CAGTGGGAGGTAATTGCATGGGG - Intergenic
1151066376 17:71155043-71155065 CAGGTGGAGGTAATTGGATCAGG + Intergenic
1151101184 17:71557151-71557173 CAGTGGGAGGTGATTGAATTAGG - Intergenic
1151874816 17:76861661-76861683 TGGTGGGAGGTGACTGGATCAGG - Intergenic
1152327467 17:79650004-79650026 TGGTGGGACGTGATTGGATCAGG - Intergenic
1152957479 18:51355-51377 CAGTGGGAGGTAATTGAATCAGG + Intronic
1153714885 18:7838312-7838334 TGGGGGGAGGTAATTAAAACAGG - Intronic
1153986734 18:10357407-10357429 TGGTGGGAGGTGATTGAATTAGG + Intergenic
1154024767 18:10696844-10696866 CGGTGGTGAGCAATTGAATCAGG - Intronic
1154156694 18:11949411-11949433 TGGTGGTTGGTAAATGAATCTGG + Intergenic
1156359168 18:36368883-36368905 TGGTGGGGGGTGATTGGATCAGG - Intronic
1156769032 18:40697401-40697423 TGGTGGGAGGTACTTGAATCAGG + Intergenic
1157172153 18:45417604-45417626 TGGTGGGAGGTAATTGAATTGGG - Intronic
1157389019 18:47285588-47285610 TGGTGGGAGGTGATTGGATCGGG + Intergenic
1157408671 18:47445551-47445573 TGGTGGGAGACAATTGAATTGGG + Intergenic
1157682190 18:49615846-49615868 GGGTGGGTGGTAGTTGAAGCTGG + Intergenic
1158071315 18:53474476-53474498 CAATGGGAGGTAATTGAATCAGG + Intronic
1158335654 18:56413118-56413140 CAGTGGGAGGTGATTGAATCAGG + Intergenic
1158374294 18:56846347-56846369 CAGGGGGAGGTAATTGGATCAGG + Intronic
1158728109 18:59993235-59993257 TGGTGGGAGATAATTGAATATGG + Intergenic
1158763823 18:60423041-60423063 CACAGGGAGATAATTGAATCAGG - Intergenic
1159183856 18:64945051-64945073 TGATGGGAGGTAATTGAATCAGG - Intergenic
1159377593 18:67613826-67613848 TGGTGGGAGGTGATTGGATTAGG + Intergenic
1159744931 18:72221310-72221332 CAGTGGGAAGTCACTGAATCAGG + Intergenic
1159898615 18:74021178-74021200 TGGTGGGAGGTGGTTGGATCAGG - Intergenic
1160599537 18:80002050-80002072 TGGAGGGAGATAATTGAATTAGG + Intronic
1162513003 19:11131103-11131125 CGGTGGGAAGTGACTGAATCCGG + Intronic
1164398611 19:27887708-27887730 TGGTGGGAGGTGATTGGATCAGG - Intergenic
1165817200 19:38649402-38649424 GGGTGGGAGGTACTTGAAGTTGG + Intronic
1166325008 19:42044019-42044041 CAGGTGGAGGTAACTGAATCAGG + Intronic
1166646492 19:44535680-44535702 TGGTGGGAGGTAATTGAATCAGG - Intergenic
1168388113 19:55982991-55983013 CGGTGGGAACTCATTCAATCAGG - Intronic
925045335 2:768890-768912 CAGTGGGAGGTAGTTTAATCAGG + Intergenic
925669297 2:6293913-6293935 TGGTGGGAGGTGATTGAATTAGG + Intergenic
925829924 2:7883885-7883907 CAGTGGGCGGTAATCGAATCAGG + Intergenic
925952496 2:8928151-8928173 TGGTGGGAGATGATTGGATCGGG - Intronic
926142470 2:10375965-10375987 TGGTGGGAGTTGATTGGATCAGG + Intronic
926484172 2:13434227-13434249 CGGTGGGAGGCGATTGAATCAGG - Intergenic
926526754 2:13991311-13991333 TGATGGGAGGTAACTGAATCAGG - Intergenic
926544051 2:14216898-14216920 CAGATGGAGATAATTGAATCAGG + Intergenic
926824544 2:16890988-16891010 CAGGTGGAGGTAATTGAATCGGG + Intergenic
927110903 2:19863231-19863253 TGGTGGGAAGTGATTGGATCAGG - Intergenic
927446806 2:23169641-23169663 TGGTGGGAGGTGATTGGATCAGG + Intergenic
928836693 2:35555937-35555959 TGGTGGGAGGTGATTTCATCAGG - Intergenic
928846147 2:35675382-35675404 TGGTGGGAGATAATCGAATCAGG - Intergenic
929141617 2:38671538-38671560 CTGGTGGAGGTAATTGGATCAGG - Intronic
930335688 2:50042293-50042315 CAGTGGGAGGTAACTGAATCAGG + Intronic
931490671 2:62742946-62742968 TGGTGGGAGGTATTTAAATGTGG - Intronic
933064303 2:77774175-77774197 CGGTGGGAGGTAACTGAACATGG - Intergenic
934030272 2:88038841-88038863 CAGGTGGAGGTAATTGAATCGGG - Intronic
934144290 2:89076112-89076134 CGGTGGTTGGTAATTGAATCAGG + Intergenic
936634728 2:114242860-114242882 TGGTGGGAGGTAACTGGATTAGG - Intergenic
936897456 2:117444763-117444785 TGGTGGGAGGTCATTGAATCAGG + Intergenic
937677353 2:124606820-124606842 TGGTGCGAGGTAATTGAATTAGG - Intronic
937750903 2:125475513-125475535 CAGTGGAAGATAATTGAATCAGG + Intergenic
938590912 2:132735276-132735298 TGGTGGGAGGTGTTTGAATCGGG + Intronic
938730660 2:134144469-134144491 TGGTGGGAGCTAATTGGATCAGG - Intronic
939382942 2:141459590-141459612 CGGTGGGAAATAACTGAGTCAGG + Intronic
939830267 2:147063254-147063276 CGGTTGGAGGTAATTGAATCTGG + Intergenic
940339849 2:152568788-152568810 CAGTAAGAGATAATTGAATCTGG - Intronic
940408920 2:153336870-153336892 CAGGGGGAGGCAATTGAATAAGG + Intergenic
940554498 2:155206211-155206233 TGGTGGGAGATGATTTAATCAGG - Intergenic
941416165 2:165224222-165224244 TGGTGGGAGGTGATTGGATTAGG - Intergenic
942489494 2:176475407-176475429 CAGGTGGAGATAATTGAATCAGG - Intergenic
943502311 2:188707215-188707237 TGGTGAGAGGTAATTGAATCAGG + Intergenic
943948362 2:194096233-194096255 TGGTAGGAGGTAATTGAATCAGG + Intergenic
945223751 2:207510896-207510918 CTTTGGGAGGTGATTAAATCAGG + Intergenic
945556178 2:211279227-211279249 AGGTGGGAGGTAATTGAATTAGG - Intergenic
945767844 2:214002118-214002140 TAGTGGGAGATGATTGAATCAGG - Intronic
945769021 2:214016408-214016430 TGGTGGGAAGTAACTGAATCAGG - Intronic
945818119 2:214630540-214630562 CAGGTGGAGGTAATTGAATCAGG - Intergenic
946763523 2:223019258-223019280 CAGTGGGAAGTAATTGAATCAGG - Intergenic
946816871 2:223587884-223587906 TGGTGGGAAATAATTAAATCTGG - Intergenic
946910697 2:224457708-224457730 CAGTGGGAGATAATTGAATTGGG - Intergenic
947230667 2:227882710-227882732 CAGGTGGAGGTAATTGGATCAGG + Intronic
947527693 2:230889320-230889342 TGGTGGGAGGTGATTGGATCGGG - Intergenic
948089613 2:235281879-235281901 TGGTGGGAGGTGACTGGATCAGG + Intergenic
948223047 2:236288679-236288701 CAGTGGGAGGTAATTTAATCAGG - Intergenic
948759460 2:240181845-240181867 CGGTGGGTGGTGATTGGAGCAGG - Intergenic
1169706886 20:8516109-8516131 TGATGGGAAGTAACTGAATCAGG - Intronic
1169811413 20:9612638-9612660 TGGTGGGAGGTGATTGGATCGGG - Intronic
1170274189 20:14565421-14565443 GGGTGGGAGGGAAATGAATGTGG - Intronic
1171775558 20:29364135-29364157 CAGTGGGAGGTAATCTAATCGGG + Intergenic
1171817571 20:29801940-29801962 CAGTGGGAGGTAATCGAATCGGG + Intergenic
1171900764 20:30854162-30854184 CAGTGAGAGGTAATCGAATCGGG - Intergenic
1173240008 20:41286804-41286826 TGGTGGGAGGTGATTGGATATGG + Intronic
1174196405 20:48775631-48775653 CAATGGGAGGTAATTAAATGGGG + Intronic
1175134326 20:56811468-56811490 CAGTGGGAGGGAATTGAAAGGGG + Intergenic
1176587619 21:8604064-8604086 CAGTGGGAGATAATTGAATTGGG + Intergenic
1176925753 21:14746669-14746691 CAGTGGAAGGTAATTGGATCGGG - Intergenic
1176987005 21:15448842-15448864 TGGTGGAAGGTAAATTAATCAGG + Intergenic
1177204982 21:17999712-17999734 CAGTGGGAGGTAATTGAATATGG - Intronic
1177222880 21:18217495-18217517 CAATGGGAGGTTATTGAGTCGGG - Intronic
1177477511 21:21643689-21643711 CTGGGGGAGGTAATTGAGTCAGG + Intergenic
1178110358 21:29363817-29363839 CGGTGGGAGATAATTGAATCAGG + Intronic
1178261738 21:31106330-31106352 TGGTGGGAGGTAATTGTATCAGG - Intergenic
1178766069 21:35452084-35452106 TGGTGGAAGGTAATTGGTTCTGG - Intronic
1179001960 21:37469766-37469788 CGGTAGGAGGTTATTGGATTAGG - Intronic
1179231366 21:39506683-39506705 CAGGTGGAGGTAACTGAATCAGG - Intronic
1180270449 22:10581062-10581084 CAGTGGGAGATAATTGAATTGGG + Intergenic
1180320909 22:11320600-11320622 CAGTGGGAAGTAATCGAATCGGG + Intergenic
1180334134 22:11560145-11560167 CAGTGGGAAGTAATCGAATCGGG - Intergenic
1182935825 22:34220702-34220724 CGGTAGGAGATAATTGAATTGGG + Intergenic
1184826708 22:46957538-46957560 GGGAGGGAGGTGATTGAATCGGG - Intronic
949139734 3:617687-617709 CAGTGGGAGATAATTGAATCAGG - Intergenic
949461188 3:4296634-4296656 CAGTGGGAGGTAATTGAATCAGG - Intronic
949539022 3:5017960-5017982 GTGTGGGAGGGAATGGAATCAGG - Intergenic
949642558 3:6054554-6054576 AGGTGGGAGGTGATTGGGTCAGG - Intergenic
949951941 3:9236452-9236474 TGGTGGGAGGTGATTGGATCAGG + Intronic
950160190 3:10754684-10754706 TGGCGGGAGGTGATTGGATCAGG + Intergenic
950326111 3:12111116-12111138 CAGTAGGAAATAATTGAATCAGG + Intronic
951360354 3:21717627-21717649 CAGTGGGAGATAATTGAATCAGG + Intronic
952414145 3:33075373-33075395 TGGTGGGAGACAATGGAATCTGG + Intronic
952575944 3:34774070-34774092 CACTGGGAGATAATTGAATCTGG + Intergenic
952734914 3:36680163-36680185 TTGTGGGAGGTGATTGGATCTGG - Intergenic
954484769 3:50837530-50837552 CAGTGGGAGGTAACTGAATCTGG - Intronic
955331957 3:58054661-58054683 TGGTGGGAGGTAATTGAATCAGG - Intronic
955527246 3:59833783-59833805 TGGTGGGAGGTGATTGGATCAGG + Intronic
956366677 3:68510749-68510771 CAGTGGGAAGAAATTGAATTGGG - Intronic
956984909 3:74687506-74687528 TGGTTGGAGGTGATTGGATCGGG - Intergenic
957113427 3:75994402-75994424 CAGTGGGAGGTAACTGAATCAGG + Intronic
957416205 3:79908792-79908814 CAGGTGGAAGTAATTGAATCGGG - Intergenic
957876228 3:86149898-86149920 TGGTGGGAGGTGATTGGATCAGG + Intergenic
957993598 3:87659417-87659439 GGATTGGAGGTAATTGAATCAGG + Intergenic
958196109 3:90244430-90244452 CAGGTGGAGGTAGTTGAATCAGG + Intergenic
958419302 3:93913076-93913098 CAGGTGGAGGTAATTGAATCAGG + Intronic
959160885 3:102723584-102723606 CAGTGAGAAGTAATTGAATTAGG + Intergenic
959203073 3:103272673-103272695 CAGGGGGAGATAATTGAATCAGG - Intergenic
959403813 3:105936306-105936328 CAGTGGAAGGTAACTGAATCAGG - Intergenic
959434588 3:106298599-106298621 TGGTGGGAGGTGATTGGATCAGG + Intergenic
959788523 3:110329775-110329797 TGGTAGGAGGTAATTGAATCAGG + Intergenic
960172117 3:114474131-114474153 CAGAGGGAGGTAATTGAATCAGG - Intronic
960442153 3:117702069-117702091 TGGTGGGAGGTGATTGGATTAGG + Intergenic
960486628 3:118260103-118260125 CAGTGGGAGGTATTTGAATCAGG + Intergenic
960928558 3:122820977-122820999 TGGTGGGAGGTAATTGAATCGGG + Intronic
961954620 3:130788669-130788691 TGGTGAGAGGTGATTAAATCAGG - Intergenic
962984271 3:140520534-140520556 CAGGTGGAGGTAATTGGATCAGG - Intronic
963453694 3:145516812-145516834 TGGGGGGATATAATTGAATCAGG + Intergenic
965363265 3:167766444-167766466 CAGTGGGAGATAATTGAATCAGG - Intronic
965434187 3:168626936-168626958 CGGTGAGATGTAATTGAACATGG + Intergenic
965879598 3:173372657-173372679 GGGAGGGAGGTGATTGGATCGGG + Intergenic
966241565 3:177759818-177759840 TAGTGGGAGGTGATTGGATCAGG - Intergenic
968029309 3:195469382-195469404 CTGTGGGAGGTAATTGAATCGGG + Intergenic
968349871 3:198045501-198045523 CAGTGGGGGGCAATTGAATTGGG - Intergenic
968387634 4:155908-155930 CAGTGGGAGATAATTGAATCAGG + Intronic
969049005 4:4359402-4359424 CTGTGGGAGATAATTGAATAAGG + Intronic
970199240 4:13585724-13585746 CAGTGGGAGGTAATTGAATCGGG + Intronic
970303217 4:14703246-14703268 CAGTGGGAGGTAAATGAATCAGG + Intergenic
970357047 4:15265379-15265401 TGGTGGGAGGTGTTTGGATCAGG + Intergenic
970530844 4:16981490-16981512 GGGTGGGAGGAAAATGAATATGG + Intergenic
970705353 4:18794986-18795008 CAGTGGGAGGTAATTGAATCAGG - Intergenic
970707879 4:18826747-18826769 CGGTGGGAGATGATTGAATCAGG - Intergenic
970718678 4:18959526-18959548 AAGTGGGAGATAATGGAATCAGG - Intergenic
970769236 4:19590683-19590705 TGGTATGAGGTAATTGTATCGGG - Intergenic
971111741 4:23592675-23592697 TTGTGGGAGGTAATTTAATTGGG + Intergenic
971252096 4:24981554-24981576 TGGTGGGAGATAATTGAATCAGG + Intergenic
971631334 4:28997498-28997520 TGGTGGGAGGTAATTGAATCAGG + Intergenic
971699256 4:29948154-29948176 TGGTGGGAGGTGATTGGAACAGG + Intergenic
971721044 4:30245615-30245637 TGGTGGGAGGTGATTGGATCAGG - Intergenic
971781223 4:31036998-31037020 CGGTGGGAGGTAATTGAATCAGG - Intronic
971889993 4:32507692-32507714 TGGTGGGAGGTGATTGGATCAGG - Intergenic
971892486 4:32543276-32543298 TGGTGGGAGGTGATTGGATCAGG + Intergenic
971996132 4:33967121-33967143 TGGGGGGAGTTAATTGAATCAGG + Intergenic
972428969 4:38962077-38962099 CAGTGGAAGATCATTGAATCAGG + Intergenic
972517326 4:39820476-39820498 TAGTGGGAGGTGATTGAATCTGG - Intergenic
973136115 4:46708808-46708830 CAGTAGGAGGTAATTGAATCTGG + Intergenic
973838467 4:54835925-54835947 TGGTGGGAGGTAATTGAATCAGG - Intergenic
974112342 4:57539888-57539910 TTGTGGGAGGAAATTGAAACAGG - Intergenic
974373247 4:61044162-61044184 TGGTGGGAGGTGATTGAAAATGG - Intergenic
974724050 4:65776604-65776626 CAGTGGGAGGTAGTTGAGTTGGG + Intergenic
974724305 4:65778471-65778493 CAGTGGGAGGTAATTGAATAGGG + Intergenic
974846158 4:67352975-67352997 CAGTGGGAGATAATTTACTCAGG - Intergenic
975068212 4:70097016-70097038 TGCTGGGAGGTTTTTGAATCAGG - Intergenic
976032336 4:80771306-80771328 TGGTGGGAGGTAAATAAATTTGG - Intronic
977053553 4:92161511-92161533 CAGTGGGAGGTAATCAAATCAGG - Intergenic
977099705 4:92795247-92795269 CAGTGGGAGGTAAATTAATCAGG + Intronic
977383669 4:96309320-96309342 CAGTGGGAGATAACTGAGTCAGG + Intergenic
978188739 4:105888916-105888938 TGGTGGGAGGTGATTGAATATGG - Intronic
978714464 4:111824939-111824961 CGGTGGGAGGTAAATTATTGGGG + Intergenic
978844166 4:113252259-113252281 CAGTGGGAGATAACTGAATCAGG - Intronic
979049505 4:115911569-115911591 TGGTGGGAAGCGATTGAATCGGG - Intergenic
979079029 4:116311378-116311400 CAGTAGGAGGTAACTGAATCAGG - Intergenic
979093562 4:116517579-116517601 CAGTGGGAGAAAATTGATTCAGG - Intergenic
979506921 4:121509590-121509612 AGGAGGGGGGTCATTGAATCTGG + Intergenic
979966749 4:127085535-127085557 CAGTGGGAGGTAATTAAATGGGG + Intergenic
980161140 4:129164409-129164431 CAGTGGGAGGTAATTTAATCAGG - Intergenic
980242350 4:130192579-130192601 CAGGTGGAGTTAATTGAATCTGG - Intergenic
980282822 4:130742484-130742506 CAGGTGGAGGTAATTGAATCAGG + Intergenic
980385835 4:132087458-132087480 TGGTGGGAGGTAATTGAATCAGG - Intergenic
980814905 4:137932488-137932510 TGGTGGGATGTAATTGAATCAGG - Intergenic
981251651 4:142610118-142610140 CAGGTGGAGATAATTGAATCAGG + Intronic
981832494 4:149018354-149018376 CAGTGGGAGGTAATTGAATCAGG - Intergenic
983306741 4:165999518-165999540 TGGTGGGAAGTGATTGGATCAGG - Intronic
983734095 4:171035717-171035739 CGGTGGGAGGTGATTGGATCAGG + Intergenic
983934690 4:173493181-173493203 TGGTAGGAGGTAATTGAATCAGG + Intergenic
984438432 4:179734291-179734313 TGGTGGGAGGTAATTGAATCGGG - Intergenic
984841446 4:184071623-184071645 CAGTGGGAGATAATTGAATGAGG - Intergenic
985431695 4:189887588-189887610 CAGTCGGAGGTAATTGAATCAGG - Intergenic
985441750 4:189986667-189986689 CAGTGGGAGGTAATTGAATCAGG + Intergenic
986933958 5:12859519-12859541 CAGTGGGAGGTAGTTAAATCAGG + Intergenic
987289403 5:16494414-16494436 TGATGGGAGGTGGTTGAATCGGG + Intronic
987650553 5:20734574-20734596 TGATGGGACGTGATTGAATCAGG - Intergenic
987744879 5:21958006-21958028 CAGGTGGAGGTAATTGAATCTGG + Intronic
987851709 5:23363122-23363144 CAGTGAGAGGTAATTGAATCAGG - Intergenic
987891276 5:23881644-23881666 CTGTGGGAGGTGATTGGATCAGG + Intergenic
988019398 5:25604510-25604532 CACTGGAAGGTAATTGAATCGGG - Intergenic
988034096 5:25803434-25803456 TGGTGGAAGATAAATGAATCAGG - Intergenic
988263385 5:28920450-28920472 CAGTGGGAGCTAATTAAACCAGG + Intergenic
988375961 5:30436405-30436427 TGGTGGGAGGTGATTGGCTCAGG + Intergenic
988422774 5:31026516-31026538 CAGTGGGAGGTAATTGAATCAGG + Intergenic
988672875 5:33400809-33400831 AGGTGGGAGGTGATTGAATCAGG + Intergenic
988688401 5:33548063-33548085 CGGTGGGTGGTAAGTAACTCGGG + Intronic
988886168 5:35560261-35560283 TGATGGGAGGTGATTGAATTAGG - Intergenic
989752900 5:44917133-44917155 GGGTGGGAGGTAGGTGAATGTGG - Intergenic
990122390 5:52471142-52471164 TGGTGAGAGATAATTGAATCAGG - Intergenic
990127131 5:52532457-52532479 CCATGGGAGACAATTGAATCAGG - Intergenic
990294860 5:54390730-54390752 CAGTGGGAGGTGATTGAATATGG + Intergenic
991185201 5:63798747-63798769 TGGTGGGAAGTAATTGAATCGGG + Intergenic
991354033 5:65748939-65748961 CAATGGGAGGTCATTGAATCTGG + Intronic
991765085 5:69968135-69968157 CAGGTGGAGGTAATTGAATCTGG + Intergenic
991782240 5:70150018-70150040 CAGGTGGAGGTAATTGAATCTGG - Intergenic
991844317 5:70843206-70843228 CAGGTGGAGGTAATTGAATCTGG + Intergenic
991874683 5:71150333-71150355 CAGGTGGAGGTAATTGAATCTGG - Intergenic
992060717 5:73043970-73043992 TGGTGGGAGGCAATTGGGTCAGG + Intronic
992778363 5:80107113-80107135 CAGTGGGAGGTTGTTGAATCAGG + Intergenic
993175194 5:84475054-84475076 CAGTGGGAGGTAATTGAATCAGG - Intergenic
993413347 5:87597743-87597765 CAGTTGGAGGTAATTGAATCAGG - Intergenic
994216646 5:97145086-97145108 TGATGGGAGGTAATTGAATCAGG - Intronic
994680392 5:102879456-102879478 TGGTGGGAGGTGATTGGATATGG + Intronic
994833136 5:104811289-104811311 CAATGGGAGGTAATTGAATCAGG - Intergenic
995477772 5:112564830-112564852 TGGTAGGAGGTAATTGGATCAGG + Intergenic
996227619 5:121019948-121019970 CAGTGGAAGATAATTGAATCTGG - Intergenic
996829050 5:127719921-127719943 TGGTGGGAGATGATTGGATCGGG - Intergenic
996892070 5:128433034-128433056 TGGTGGGAGGTGATTGGATCAGG - Intronic
997016352 5:129939247-129939269 TGGTAGGAGGTGACTGAATCGGG - Intronic
999325392 5:150640555-150640577 CGGAGGGAGGAAGATGAATCTGG + Intronic
1000222444 5:159227050-159227072 TGGTGGGAGGTAATTGAATCAGG - Intergenic
1000668867 5:164034739-164034761 TGGTGGGAGGTGATTGAATTAGG - Intergenic
1001944027 5:175762396-175762418 CATTGGGAGGTAATTGAATCAGG + Intergenic
1004031269 6:11871741-11871763 TGGTGGGGGGTGATTGAATTAGG - Intergenic
1004476475 6:15977940-15977962 CGGTGGGAGGTGATTGGATCAGG + Intergenic
1005362765 6:25047255-25047277 CAGGTGGAGATAATTGAATCAGG - Intergenic
1006244540 6:32719086-32719108 CAGTCAGAAGTAATTGAATCAGG - Intergenic
1006657948 6:35612801-35612823 CACTGGGAGGTAACTGAATCGGG - Intronic
1006683754 6:35815286-35815308 GGATGGGAGGGAATTGAAACAGG - Intronic
1008545321 6:52578101-52578123 CGGTGGAATGTAATTGAGACAGG + Intergenic
1009338763 6:62527560-62527582 CAGTGGGAGGTAATTGAATTGGG - Intergenic
1009793399 6:68433837-68433859 CAGTGGGAAATAATTGACTCGGG - Intergenic
1009957862 6:70477683-70477705 TGGTGGGAGGTGATTAGATCAGG - Intronic
1010031999 6:71281107-71281129 TGGTGGGAGATAATTGAATTAGG + Intergenic
1010268389 6:73892565-73892587 TGGTGGGAGGTGATTGAATCAGG + Intergenic
1010655488 6:78506670-78506692 TGGTAGGAGGTAATTGAATGGGG + Intergenic
1010676291 6:78748372-78748394 CAGGGGGAGGTAATTTAATCAGG + Intergenic
1011129613 6:84040102-84040124 CACTGGGAGGTAATTGAATCAGG + Intronic
1011207314 6:84913669-84913691 AAGTGGGAGGTAACTGAATCAGG - Intergenic
1011346003 6:86370226-86370248 TAGTGGGAGATAATTGAATCAGG - Intergenic
1011895028 6:92215207-92215229 CGGTGGGAGGTAATTGAATCAGG - Intergenic
1011895123 6:92215940-92215962 TGGTGAGAGGTAATTTAATAAGG + Intergenic
1011956542 6:93030999-93031021 TGGTGGGAGGTGACTGAATCAGG - Intergenic
1012715345 6:102661361-102661383 TGGTGGGAGGTAATTGGATTGGG + Intergenic
1013090206 6:106893677-106893699 TGATGGGAGGTGATTGGATCAGG - Intergenic
1013201901 6:107906054-107906076 TGGTGGAAGGTGATTGGATCAGG + Intronic
1013375213 6:109508415-109508437 AGGGAGGAGGTAATTCAATCTGG + Intronic
1014303529 6:119712753-119712775 TGGTGGGAGGTGATTGGATGAGG + Intergenic
1014634078 6:123823449-123823471 TGTTGGGAGGTAATTGAGTTGGG + Intronic
1015459827 6:133476917-133476939 CAGGTGGAGGTAATTGAATCAGG + Intronic
1016215815 6:141601139-141601161 TGGTGAAAGGTTATTGAATCAGG - Intergenic
1016414486 6:143818768-143818790 TGGTGGGAGGTAATTGAATCAGG - Intronic
1016493253 6:144630572-144630594 TTGTGGGAGGTAACTGAATCAGG - Intronic
1016740869 6:147527475-147527497 TGGTGGGAGGTGACTGAATACGG - Intronic
1017053810 6:150419602-150419624 CCCTAGGAGGTAATTGAATTGGG + Intergenic
1017294646 6:152779472-152779494 AAGTGGGAGGTAACTGAATCAGG + Intergenic
1017549715 6:155493102-155493124 TGGTGGGAGGTAATTGAATCAGG + Intergenic
1017640806 6:156491616-156491638 CAGTGGCAGGTAATTGAATCAGG + Intergenic
1018485513 6:164237661-164237683 TGGTGGGAGGTAATTGAATCAGG + Intergenic
1018562661 6:165118390-165118412 TGGTGGGAGGTAACTGAATCAGG + Intergenic
1018575226 6:165252752-165252774 CAGGTGGAGGTAACTGAATCAGG - Intergenic
1020416470 7:7951591-7951613 TGGTGGGAGGTGATTGGATAAGG - Intronic
1020585197 7:10056326-10056348 CAGTGGGAGATAATTGAATCGGG + Intergenic
1020684658 7:11278602-11278624 GGGTAGGAGATAATTGAATCAGG - Intergenic
1021036720 7:15809150-15809172 CAGTTGGAGATGATTGAATCAGG - Intergenic
1021680627 7:23127616-23127638 CGGTGGCAGCTGATGGAATCGGG + Intronic
1021758781 7:23882749-23882771 TGGTGAGAGGTGATTGGATCAGG - Intergenic
1022840978 7:34163643-34163665 CAGTTGGAAGTACTTGAATCTGG - Intergenic
1023706175 7:42943833-42943855 TGGTGGGAGGTGATTGGATCGGG + Intronic
1023958295 7:44905545-44905567 CAGTGGGAGGTGATTAAAGCAGG - Intergenic
1024207425 7:47175852-47175874 TGGTGGGAGGTAATTGAATCGGG + Intergenic
1024674157 7:51623154-51623176 TGGTGGGAGGTAATTGAATCAGG + Intergenic
1024844082 7:53621326-53621348 CAGATGGAGATAATTGAATCGGG + Intergenic
1025116667 7:56264083-56264105 CGGAGAGAGGTGATTGCATCAGG - Intergenic
1026197571 7:68186090-68186112 CGGTGGGAGGTGATTGAATATGG + Intergenic
1027771965 7:82418257-82418279 CAGGTGGAGATAATTGAATCAGG - Intronic
1028023544 7:85807966-85807988 CAGTGGAAGGTAGTTGAATCAGG + Intergenic
1028023555 7:85808024-85808046 CAGTGGAAGTTAATTGAATCAGG + Intergenic
1028054306 7:86223929-86223951 CGGTGGAAGATAATTGAATCAGG - Intergenic
1028421875 7:90642025-90642047 CAGTGGGAGATAACTGAATCAGG - Intronic
1028435441 7:90797870-90797892 TGGTGGGAGGTGATTGGATCTGG - Intronic
1030411136 7:109182004-109182026 CGATGGGAGGTAATTGAATCAGG - Intergenic
1030415614 7:109239060-109239082 CAGTGGGAGGTAAATGAATCAGG + Intergenic
1031005309 7:116463827-116463849 TGGTGGGAGGTGACTGGATCAGG - Intronic
1031194742 7:118599182-118599204 TGGTGGGAGGTGATTGGATCGGG + Intergenic
1031279679 7:119782469-119782491 GGGAGGGAGGTGATTGGATCTGG - Intergenic
1031397163 7:121287073-121287095 CAGGTAGAGGTAATTGAATCGGG - Intronic
1031702586 7:124943683-124943705 CAGTGGGAGGTTACTGAATCAGG + Intergenic
1031790268 7:126093613-126093635 TGGTGGAAGGTAATTGAAGTGGG - Intergenic
1032432237 7:131871576-131871598 CAGTAGGAGTTAATTGAATTAGG - Intergenic
1032499291 7:132388009-132388031 CGGTGGGAATTGATTGAAGCTGG - Intronic
1032738436 7:134713950-134713972 TGGTGGGAGGTGATGGGATCAGG + Intergenic
1033311992 7:140268214-140268236 TAGTGGGAGATAATTGAAGCGGG + Intergenic
1034029268 7:147742131-147742153 CAGTGGAAGGTAATTGAATCAGG - Intronic
1034159859 7:148985578-148985600 TGGTGAGAGGTAACTGAATCAGG - Intergenic
1034929186 7:155147782-155147804 TGGTGGGAGGTGATTGGATCAGG + Intergenic
1035128547 7:156629660-156629682 TGATGGGAGATAATTGAATCGGG - Intergenic
1035896662 8:3410425-3410447 TGGTGGGAGGTAATTGATCATGG + Intronic
1036122129 8:6030105-6030127 CTTTGGGAGGTAATTGAGTCAGG + Intergenic
1036125841 8:6061400-6061422 CAGGTGGAGGCAATTGAATCAGG - Intergenic
1036412072 8:8511586-8511608 TGGTGGGAGATCTTTGAATCGGG - Intergenic
1036447329 8:8833193-8833215 TGGTGGGAGATGATTGGATCAGG - Intronic
1037426593 8:18762136-18762158 TGTTGGGAGGTGATTGGATCAGG + Intronic
1037565977 8:20118861-20118883 TGGTGGGAGATGATTGGATCAGG + Intergenic
1037747327 8:21656857-21656879 CCGGGGGATGTAATTGAATCAGG + Intergenic
1038355078 8:26821509-26821531 TGGTGGGAGGTGATTGGATCAGG - Intronic
1038572266 8:28672877-28672899 CGGTGGGAGGTAATTGAATCGGG + Intronic
1039675898 8:39666759-39666781 CGGTGGGAGATAATTCAATCAGG - Intronic
1042414137 8:68499877-68499899 TGGTGGGAGGTGATTGGATTGGG + Intronic
1042458108 8:69029145-69029167 GGGTGGGCTGTAATTTAATCTGG + Intergenic
1042580743 8:70276508-70276530 CTGTGGGAGGTAATTGAATTGGG + Intronic
1043336169 8:79179812-79179834 TGGTTGGAAGTAATTGAATCAGG - Intergenic
1043393583 8:79814558-79814580 CAGTGGGAGGTAATTGAATCAGG - Intergenic
1044066453 8:87705493-87705515 CAGGTGGAAGTAATTGAATCAGG - Intergenic
1044157507 8:88866251-88866273 TGGTTGGAGGTGATTGGATCAGG - Intergenic
1044381503 8:91539535-91539557 TGGTGGGAGGTGATTGGATTGGG + Intergenic
1045076339 8:98573476-98573498 TGGTGGGAGGTAACTGAATCAGG - Intronic
1045146506 8:99350737-99350759 TGGCAGGAGGTAAATGAATCAGG + Intronic
1045176193 8:99727654-99727676 CAGTGGGAGATGAATGAATCAGG - Intronic
1045194078 8:99912183-99912205 CAGTGAGAGATAATTGAATCAGG + Intergenic
1045664635 8:104471219-104471241 GGGTGGGAGAAAATTGAATGAGG + Intergenic
1046052768 8:109043864-109043886 CAGTGGGAGATAATTGAATCAGG - Intergenic
1046172565 8:110530127-110530149 CAGTGGGAGGTAATTAATTATGG + Intergenic
1046600715 8:116314535-116314557 TGGTAGGAGGTAATTGAACATGG - Intergenic
1047036728 8:120948214-120948236 TAGCAGGAGGTAATTGAATCAGG - Intergenic
1047124165 8:121941958-121941980 TGCTGGGAGGTGATTGGATCAGG + Intergenic
1047245824 8:123143644-123143666 GGGTAGGAGGAAAATGAATCTGG - Intronic
1047630426 8:126700374-126700396 CAGGGGGAGGTAATTGAATTAGG + Intergenic
1047939446 8:129815036-129815058 TAGTGGGAGGTAATTGAATGGGG + Intergenic
1047940344 8:129822974-129822996 TGGTGGGAGGTAATTGGATTGGG + Intergenic
1048023234 8:130559952-130559974 TGGTGGGATGTGGTTGAATCAGG + Intergenic
1048234847 8:132679654-132679676 TGGTGGGAGGTAATTAAACCAGG + Intergenic
1048569494 8:135639856-135639878 TGGTGGGAGGTGACTGGATCGGG - Intronic
1048790137 8:138094221-138094243 TGGTGGTAGGTGATCGAATCTGG - Intergenic
1048829589 8:138463385-138463407 GGGTGGGAGAGAATTGTATCAGG + Intronic
1049522341 8:143099929-143099951 TGGTGGGAGGTAATTGAAGCAGG - Intergenic
1050598274 9:7225667-7225689 CAGTAGAAGGTAATTGAATCAGG - Intergenic
1050832990 9:10037279-10037301 TGGTGGGAGGTGATTGTATCAGG + Intronic
1050874968 9:10622997-10623019 TAGTGGGAGGTCATTGAATCAGG - Intergenic
1051677440 9:19572413-19572435 TGGTGGGAGGTGATTGAATCTGG + Intronic
1052008996 9:23383629-23383651 CAGGTGGAGGTAATTGAATGGGG + Intergenic
1052018944 9:23503019-23503041 TGGTGGGAGGTGATTGGATCAGG - Intergenic
1052097671 9:24403679-24403701 AGGTGGGAGGTGATTGGATCAGG - Intergenic
1052170619 9:25391562-25391584 CGGTGGGAGGTAATTGAATCTGG - Intergenic
1052319201 9:27149808-27149830 ACTTGGCAGGTAATTGAATCAGG + Intronic
1055001905 9:71460638-71460660 CAGTGGGAGGTAATTTAATAAGG - Intergenic
1055203395 9:73695711-73695733 TGGTGGGAAGTGATTGTATCGGG + Intergenic
1055413069 9:76052544-76052566 CATTGGGAGGTAATTGAATCAGG - Intronic
1055764200 9:79644108-79644130 TCGTGGGAGGTAATTTAATCAGG + Intronic
1056625900 9:88252810-88252832 TGGTAAGAGGTAATTGGATCGGG + Intergenic
1057349803 9:94286497-94286519 TGGTGGGAAGTGATTGGATCAGG + Intronic
1058873905 9:109225567-109225589 TGGTGGGAGATAATTGAATCGGG - Intronic
1059462668 9:114444035-114444057 CAGTGGGAGATAATTGAACCGGG - Intronic
1060310719 9:122458660-122458682 CAGTGGGAGGTAACAGAATTGGG - Intergenic
1060785444 9:126448802-126448824 TGGTGGGAGGTGACTGGATCAGG - Intronic
1062740664 9:138173215-138173237 CAGTGGGAGGTAATTGAATCGGG - Intergenic
1203369124 Un_KI270442v1:286372-286394 CAGTGGGAGGTAATCGAATCAGG + Intergenic
1203617586 Un_KI270749v1:82242-82264 CAGTGGGAGATAATTGAATTGGG + Intergenic
1185666563 X:1769929-1769951 TGGTGGGAGGTGACTGGATCAGG - Intergenic
1185958353 X:4517984-4518006 CGATGGGAGGTTATTGAATCAGG + Intergenic
1186035040 X:5412867-5412889 AGGTGGGAGGTAATTGATCATGG - Intergenic
1186061242 X:5709813-5709835 AGGTGGGAGGTAATTGATCACGG - Intergenic
1186069937 X:5808628-5808650 CGGTGGGAGGTAATTTAATCAGG - Intergenic
1186191037 X:7067825-7067847 CGGTGGAAGGTAATTGAATCAGG + Intronic
1186541186 X:10402179-10402201 TGGTGGGAGGTGATTGGATGGGG - Intergenic
1186802630 X:13109027-13109049 TGGTGGGAGGTGATTGGATCAGG + Intergenic
1187052401 X:15707804-15707826 TGGGGGGAGGTGATTGGATCAGG + Intronic
1187931505 X:24297509-24297531 CAGGTGGAGATAATTGAATCAGG - Intergenic
1187941104 X:24382502-24382524 CAGTGGGAGGTAATTGAATCAGG + Intergenic
1188187183 X:27130013-27130035 TGGTGAAAGATAATTGAATCAGG - Intergenic
1188662513 X:32776650-32776672 TGGTGGGAGGTGATTGGATCAGG - Intronic
1188926669 X:36051859-36051881 CAGTCAGAGGTAATTGAATCAGG + Intronic
1188961762 X:36501607-36501629 CGGTGGGAAGTAATTGAATCGGG - Intergenic
1188990816 X:36817780-36817802 CCGTGGGAGGTAATCGAATCAGG - Intergenic
1190956721 X:55202303-55202325 GGGTAGGAGGTCAGTGAATCAGG + Intronic
1191688053 X:63912914-63912936 TGGTGGGAGATAATTGAATCAGG + Intergenic
1191886978 X:65899016-65899038 CAGGGGGAGGTAATTGAAACAGG - Intergenic
1192090960 X:68155402-68155424 TGGTGGGAGGTGATTGGATCAGG + Intronic
1192418088 X:71002489-71002511 CAGGTGGAGATAATTGAATCGGG + Intergenic
1193498992 X:82249786-82249808 CAGTGGGAGGTAATTGAATAAGG - Intergenic
1194038991 X:88916435-88916457 TGGTGGGAGTTAATTGATTCAGG - Intergenic
1194194228 X:90871435-90871457 CCGTAGGAGGTAATTGAATGAGG + Intergenic
1194397678 X:93405188-93405210 CAGTGGGAGGTAATTGAATCAGG - Intergenic
1194443036 X:93955785-93955807 TGGTGGGAGGTAATTGATCATGG + Intergenic
1194526904 X:94988734-94988756 CAGTGGGAGATAATTGAATCAGG - Intergenic
1195209949 X:102645339-102645361 CAGAGGGAGGTAATTGAATCAGG - Intergenic
1196228240 X:113190353-113190375 CAGGTGGAGGTAATTGGATCAGG + Intergenic
1196414748 X:115458927-115458949 TGGTGGCAGGTACTTGAACCCGG - Intergenic
1196460557 X:115924839-115924861 TTGTGGGAGGTAATTGGATCAGG + Intergenic
1196483489 X:116178764-116178786 AGGTGGGAGATAATTGAATTAGG + Intergenic
1196555479 X:117079917-117079939 TGGTGGGAGGTGATTGAACCAGG + Intergenic
1196565939 X:117205821-117205843 AGGTGGGAGGTAATTGAATAAGG - Intergenic
1196627774 X:117896971-117896993 CGGTGGGAGGTAATTGAATCAGG - Intergenic
1196835415 X:119809258-119809280 TGGTGGGAGGTGATTGGATTAGG - Intergenic
1197171782 X:123443054-123443076 CAGTGGGAGATAATTGTTTCAGG + Intronic
1197452019 X:126630413-126630435 AGGTGGGTGTTAATTGAATCAGG - Intergenic
1197835136 X:130686218-130686240 TGATGGGAGGTGATTGGATCAGG + Intronic
1198523678 X:137477840-137477862 CTTTGGGAGGAAATTAAATCTGG + Intergenic
1198690990 X:139284307-139284329 TGGTGGGAGGTAATTGAATCTGG - Intergenic
1199909781 X:152272740-152272762 TGGTGGGAGGAAATTGAATCAGG + Intronic
1200540836 Y:4453819-4453841 CCGTAGGAGGTAATTGAATGAGG + Intergenic
1201069156 Y:10128586-10128608 CAGTGGGAGGTAATCTAATCGGG - Intergenic
1201606996 Y:15797992-15798014 CAGTGGGATGTATTTGAATCAGG - Intergenic
1201722855 Y:17120585-17120607 TGGTGGGAGGTGATTGAACTTGG + Intergenic
1201746835 Y:17385239-17385261 AAATGGGAGGTAATTGAATCAGG + Intergenic
1201759416 Y:17520815-17520837 CAGGGGGAGGTAATTGAATTGGG + Intergenic
1201842138 Y:18385175-18385197 CAGGGGGAGGTAATTGAATTGGG - Intergenic