ID: 902931738

View in Genome Browser
Species Human (GRCh38)
Location 1:19736317-19736339
Sequence CGGTGGGAGGTAATTGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 630
Summary {0: 7, 1: 50, 2: 109, 3: 187, 4: 277}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931738_902931751 8 Left 902931738 1:19736317-19736339 CCTGATTCAATTACCTCCCACCG 0: 7
1: 50
2: 109
3: 187
4: 277
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772
902931738_902931745 0 Left 902931738 1:19736317-19736339 CCTGATTCAATTACCTCCCACCG 0: 7
1: 50
2: 109
3: 187
4: 277
Right 902931745 1:19736340-19736362 GGTCCCTCCCATGACCCATGTGG 0: 8
1: 398
2: 1030
3: 2122
4: 3341
902931738_902931749 7 Left 902931738 1:19736317-19736339 CCTGATTCAATTACCTCCCACCG 0: 7
1: 50
2: 109
3: 187
4: 277
Right 902931749 1:19736347-19736369 CCCATGACCCATGTGGATTGTGG 0: 1
1: 0
2: 46
3: 710
4: 1781

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931738 Original CRISPR CGGTGGGAGGTAATTGAATC AGG (reversed) Intronic