ID: 902931741

View in Genome Browser
Species Human (GRCh38)
Location 1:19736330-19736352
Sequence CATGGGAGGGACCCGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13619
Summary {0: 101, 1: 1150, 2: 2585, 3: 4300, 4: 5483}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931741_902931757 26 Left 902931741 1:19736330-19736352 CCTCCCACCGGGTCCCTCCCATG 0: 101
1: 1150
2: 2585
3: 4300
4: 5483
Right 902931757 1:19736379-19736401 TTCAAGATGAGATTTGGGTGAGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
902931741_902931756 21 Left 902931741 1:19736330-19736352 CCTCCCACCGGGTCCCTCCCATG 0: 101
1: 1150
2: 2585
3: 4300
4: 5483
Right 902931756 1:19736374-19736396 CACAATTCAAGATGAGATTTGGG 0: 162
1: 7276
2: 10908
3: 10770
4: 7449
902931741_902931755 20 Left 902931741 1:19736330-19736352 CCTCCCACCGGGTCCCTCCCATG 0: 101
1: 1150
2: 2585
3: 4300
4: 5483
Right 902931755 1:19736373-19736395 CCACAATTCAAGATGAGATTTGG 0: 106
1: 4288
2: 7611
3: 10206
4: 11650
902931741_902931749 -6 Left 902931741 1:19736330-19736352 CCTCCCACCGGGTCCCTCCCATG 0: 101
1: 1150
2: 2585
3: 4300
4: 5483
Right 902931749 1:19736347-19736369 CCCATGACCCATGTGGATTGTGG 0: 1
1: 0
2: 46
3: 710
4: 1781
902931741_902931751 -5 Left 902931741 1:19736330-19736352 CCTCCCACCGGGTCCCTCCCATG 0: 101
1: 1150
2: 2585
3: 4300
4: 5483
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931741 Original CRISPR CATGGGAGGGACCCGGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr