ID: 902931742

View in Genome Browser
Species Human (GRCh38)
Location 1:19736333-19736355
Sequence GGTCATGGGAGGGACCCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11231
Summary {0: 4, 1: 142, 2: 1374, 3: 3264, 4: 6447}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931742_902931749 -9 Left 902931742 1:19736333-19736355 CCCACCGGGTCCCTCCCATGACC 0: 4
1: 142
2: 1374
3: 3264
4: 6447
Right 902931749 1:19736347-19736369 CCCATGACCCATGTGGATTGTGG 0: 1
1: 0
2: 46
3: 710
4: 1781
902931742_902931755 17 Left 902931742 1:19736333-19736355 CCCACCGGGTCCCTCCCATGACC 0: 4
1: 142
2: 1374
3: 3264
4: 6447
Right 902931755 1:19736373-19736395 CCACAATTCAAGATGAGATTTGG 0: 106
1: 4288
2: 7611
3: 10206
4: 11650
902931742_902931757 23 Left 902931742 1:19736333-19736355 CCCACCGGGTCCCTCCCATGACC 0: 4
1: 142
2: 1374
3: 3264
4: 6447
Right 902931757 1:19736379-19736401 TTCAAGATGAGATTTGGGTGAGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
902931742_902931756 18 Left 902931742 1:19736333-19736355 CCCACCGGGTCCCTCCCATGACC 0: 4
1: 142
2: 1374
3: 3264
4: 6447
Right 902931756 1:19736374-19736396 CACAATTCAAGATGAGATTTGGG 0: 162
1: 7276
2: 10908
3: 10770
4: 7449
902931742_902931751 -8 Left 902931742 1:19736333-19736355 CCCACCGGGTCCCTCCCATGACC 0: 4
1: 142
2: 1374
3: 3264
4: 6447
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931742 Original CRISPR GGTCATGGGAGGGACCCGGT GGG (reversed) Intronic
Too many off-targets to display for this crispr