ID: 902931743

View in Genome Browser
Species Human (GRCh38)
Location 1:19736334-19736356
Sequence GGGTCATGGGAGGGACCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9848
Summary {0: 1, 1: 85, 2: 895, 3: 2636, 4: 6231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931743_902931751 -9 Left 902931743 1:19736334-19736356 CCACCGGGTCCCTCCCATGACCC 0: 1
1: 85
2: 895
3: 2636
4: 6231
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772
902931743_902931755 16 Left 902931743 1:19736334-19736356 CCACCGGGTCCCTCCCATGACCC 0: 1
1: 85
2: 895
3: 2636
4: 6231
Right 902931755 1:19736373-19736395 CCACAATTCAAGATGAGATTTGG 0: 106
1: 4288
2: 7611
3: 10206
4: 11650
902931743_902931757 22 Left 902931743 1:19736334-19736356 CCACCGGGTCCCTCCCATGACCC 0: 1
1: 85
2: 895
3: 2636
4: 6231
Right 902931757 1:19736379-19736401 TTCAAGATGAGATTTGGGTGAGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
902931743_902931749 -10 Left 902931743 1:19736334-19736356 CCACCGGGTCCCTCCCATGACCC 0: 1
1: 85
2: 895
3: 2636
4: 6231
Right 902931749 1:19736347-19736369 CCCATGACCCATGTGGATTGTGG 0: 1
1: 0
2: 46
3: 710
4: 1781
902931743_902931756 17 Left 902931743 1:19736334-19736356 CCACCGGGTCCCTCCCATGACCC 0: 1
1: 85
2: 895
3: 2636
4: 6231
Right 902931756 1:19736374-19736396 CACAATTCAAGATGAGATTTGGG 0: 162
1: 7276
2: 10908
3: 10770
4: 7449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931743 Original CRISPR GGGTCATGGGAGGGACCCGG TGG (reversed) Intronic
Too many off-targets to display for this crispr