ID: 902931744

View in Genome Browser
Species Human (GRCh38)
Location 1:19736337-19736359
Sequence CATGGGTCATGGGAGGGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7768
Summary {0: 6, 1: 297, 2: 855, 3: 2327, 4: 4283}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931744_902931755 13 Left 902931744 1:19736337-19736359 CCGGGTCCCTCCCATGACCCATG 0: 6
1: 297
2: 855
3: 2327
4: 4283
Right 902931755 1:19736373-19736395 CCACAATTCAAGATGAGATTTGG 0: 106
1: 4288
2: 7611
3: 10206
4: 11650
902931744_902931756 14 Left 902931744 1:19736337-19736359 CCGGGTCCCTCCCATGACCCATG 0: 6
1: 297
2: 855
3: 2327
4: 4283
Right 902931756 1:19736374-19736396 CACAATTCAAGATGAGATTTGGG 0: 162
1: 7276
2: 10908
3: 10770
4: 7449
902931744_902931757 19 Left 902931744 1:19736337-19736359 CCGGGTCCCTCCCATGACCCATG 0: 6
1: 297
2: 855
3: 2327
4: 4283
Right 902931757 1:19736379-19736401 TTCAAGATGAGATTTGGGTGAGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931744 Original CRISPR CATGGGTCATGGGAGGGACC CGG (reversed) Intronic