ID: 902931745

View in Genome Browser
Species Human (GRCh38)
Location 1:19736340-19736362
Sequence GGTCCCTCCCATGACCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6899
Summary {0: 8, 1: 398, 2: 1030, 3: 2122, 4: 3341}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931737_902931745 1 Left 902931737 1:19736316-19736338 CCCTGATTCAATTACCTCCCACC 0: 1659
1: 4879
2: 8898
3: 10570
4: 9952
Right 902931745 1:19736340-19736362 GGTCCCTCCCATGACCCATGTGG 0: 8
1: 398
2: 1030
3: 2122
4: 3341
902931735_902931745 3 Left 902931735 1:19736314-19736336 CCCCCTGATTCAATTACCTCCCA 0: 28
1: 3156
2: 6514
3: 9422
4: 10877
Right 902931745 1:19736340-19736362 GGTCCCTCCCATGACCCATGTGG 0: 8
1: 398
2: 1030
3: 2122
4: 3341
902931733_902931745 7 Left 902931733 1:19736310-19736332 CCACCCCCCTGATTCAATTACCT 0: 6
1: 1245
2: 3410
3: 5315
4: 5834
Right 902931745 1:19736340-19736362 GGTCCCTCCCATGACCCATGTGG 0: 8
1: 398
2: 1030
3: 2122
4: 3341
902931734_902931745 4 Left 902931734 1:19736313-19736335 CCCCCCTGATTCAATTACCTCCC 0: 19
1: 3127
2: 6337
3: 9318
4: 9980
Right 902931745 1:19736340-19736362 GGTCCCTCCCATGACCCATGTGG 0: 8
1: 398
2: 1030
3: 2122
4: 3341
902931732_902931745 8 Left 902931732 1:19736309-19736331 CCCACCCCCCTGATTCAATTACC 0: 4
1: 532
2: 2392
3: 3151
4: 2979
Right 902931745 1:19736340-19736362 GGTCCCTCCCATGACCCATGTGG 0: 8
1: 398
2: 1030
3: 2122
4: 3341
902931736_902931745 2 Left 902931736 1:19736315-19736337 CCCCTGATTCAATTACCTCCCAC 0: 33
1: 3223
2: 6518
3: 9352
4: 10507
Right 902931745 1:19736340-19736362 GGTCCCTCCCATGACCCATGTGG 0: 8
1: 398
2: 1030
3: 2122
4: 3341
902931738_902931745 0 Left 902931738 1:19736317-19736339 CCTGATTCAATTACCTCCCACCG 0: 7
1: 50
2: 109
3: 187
4: 277
Right 902931745 1:19736340-19736362 GGTCCCTCCCATGACCCATGTGG 0: 8
1: 398
2: 1030
3: 2122
4: 3341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931745 Original CRISPR GGTCCCTCCCATGACCCATG TGG Intronic
Too many off-targets to display for this crispr