ID: 902931746

View in Genome Browser
Species Human (GRCh38)
Location 1:19736343-19736365
Sequence AATCCACATGGGTCATGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5424
Summary {0: 1, 1: 16, 2: 554, 3: 1485, 4: 3368}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931746_902931757 13 Left 902931746 1:19736343-19736365 CCCTCCCATGACCCATGTGGATT 0: 1
1: 16
2: 554
3: 1485
4: 3368
Right 902931757 1:19736379-19736401 TTCAAGATGAGATTTGGGTGAGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
902931746_902931756 8 Left 902931746 1:19736343-19736365 CCCTCCCATGACCCATGTGGATT 0: 1
1: 16
2: 554
3: 1485
4: 3368
Right 902931756 1:19736374-19736396 CACAATTCAAGATGAGATTTGGG 0: 162
1: 7276
2: 10908
3: 10770
4: 7449
902931746_902931755 7 Left 902931746 1:19736343-19736365 CCCTCCCATGACCCATGTGGATT 0: 1
1: 16
2: 554
3: 1485
4: 3368
Right 902931755 1:19736373-19736395 CCACAATTCAAGATGAGATTTGG 0: 106
1: 4288
2: 7611
3: 10206
4: 11650

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931746 Original CRISPR AATCCACATGGGTCATGGGA GGG (reversed) Intronic