ID: 902931747 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:19736344-19736366 |
Sequence | CAATCCACATGGGTCATGGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 3021 | |||
Summary | {0: 1, 1: 0, 2: 51, 3: 780, 4: 2189} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
902931747_902931756 | 7 | Left | 902931747 | 1:19736344-19736366 | CCTCCCATGACCCATGTGGATTG | 0: 1 1: 0 2: 51 3: 780 4: 2189 |
||
Right | 902931756 | 1:19736374-19736396 | CACAATTCAAGATGAGATTTGGG | 0: 162 1: 7276 2: 10908 3: 10770 4: 7449 |
||||
902931747_902931755 | 6 | Left | 902931747 | 1:19736344-19736366 | CCTCCCATGACCCATGTGGATTG | 0: 1 1: 0 2: 51 3: 780 4: 2189 |
||
Right | 902931755 | 1:19736373-19736395 | CCACAATTCAAGATGAGATTTGG | 0: 106 1: 4288 2: 7611 3: 10206 4: 11650 |
||||
902931747_902931757 | 12 | Left | 902931747 | 1:19736344-19736366 | CCTCCCATGACCCATGTGGATTG | 0: 1 1: 0 2: 51 3: 780 4: 2189 |
||
Right | 902931757 | 1:19736379-19736401 | TTCAAGATGAGATTTGGGTGAGG | 0: 7463 1: 11190 2: 9643 3: 7118 4: 4722 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
902931747 | Original CRISPR | CAATCCACATGGGTCATGGG AGG (reversed) | Intronic | ||