ID: 902931751

View in Genome Browser
Species Human (GRCh38)
Location 1:19736348-19736370
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2548
Summary {0: 1, 1: 0, 2: 50, 3: 725, 4: 1772}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931737_902931751 9 Left 902931737 1:19736316-19736338 CCCTGATTCAATTACCTCCCACC 0: 1659
1: 4879
2: 8898
3: 10570
4: 9952
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772
902931742_902931751 -8 Left 902931742 1:19736333-19736355 CCCACCGGGTCCCTCCCATGACC 0: 4
1: 142
2: 1374
3: 3264
4: 6447
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772
902931734_902931751 12 Left 902931734 1:19736313-19736335 CCCCCCTGATTCAATTACCTCCC 0: 19
1: 3127
2: 6337
3: 9318
4: 9980
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772
902931738_902931751 8 Left 902931738 1:19736317-19736339 CCTGATTCAATTACCTCCCACCG 0: 7
1: 50
2: 109
3: 187
4: 277
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772
902931733_902931751 15 Left 902931733 1:19736310-19736332 CCACCCCCCTGATTCAATTACCT 0: 6
1: 1245
2: 3410
3: 5315
4: 5834
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772
902931743_902931751 -9 Left 902931743 1:19736334-19736356 CCACCGGGTCCCTCCCATGACCC 0: 1
1: 85
2: 895
3: 2636
4: 6231
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772
902931732_902931751 16 Left 902931732 1:19736309-19736331 CCCACCCCCCTGATTCAATTACC 0: 4
1: 532
2: 2392
3: 3151
4: 2979
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772
902931736_902931751 10 Left 902931736 1:19736315-19736337 CCCCTGATTCAATTACCTCCCAC 0: 33
1: 3223
2: 6518
3: 9352
4: 10507
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772
902931735_902931751 11 Left 902931735 1:19736314-19736336 CCCCCTGATTCAATTACCTCCCA 0: 28
1: 3156
2: 6514
3: 9422
4: 10877
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772
902931741_902931751 -5 Left 902931741 1:19736330-19736352 CCTCCCACCGGGTCCCTCCCATG 0: 101
1: 1150
2: 2585
3: 4300
4: 5483
Right 902931751 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 0
2: 50
3: 725
4: 1772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr