ID: 902931753

View in Genome Browser
Species Human (GRCh38)
Location 1:19736355-19736377
Sequence TGTGGCTCCCACAATCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931753_902931757 1 Left 902931753 1:19736355-19736377 CCATGTGGATTGTGGGAGCCACA 0: 1
1: 0
2: 3
3: 32
4: 248
Right 902931757 1:19736379-19736401 TTCAAGATGAGATTTGGGTGAGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
902931753_902931755 -5 Left 902931753 1:19736355-19736377 CCATGTGGATTGTGGGAGCCACA 0: 1
1: 0
2: 3
3: 32
4: 248
Right 902931755 1:19736373-19736395 CCACAATTCAAGATGAGATTTGG 0: 106
1: 4288
2: 7611
3: 10206
4: 11650
902931753_902931756 -4 Left 902931753 1:19736355-19736377 CCATGTGGATTGTGGGAGCCACA 0: 1
1: 0
2: 3
3: 32
4: 248
Right 902931756 1:19736374-19736396 CACAATTCAAGATGAGATTTGGG 0: 162
1: 7276
2: 10908
3: 10770
4: 7449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931753 Original CRISPR TGTGGCTCCCACAATCCACA TGG (reversed) Intronic