ID: 902931755

View in Genome Browser
Species Human (GRCh38)
Location 1:19736373-19736395
Sequence CCACAATTCAAGATGAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33861
Summary {0: 106, 1: 4288, 2: 7611, 3: 10206, 4: 11650}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931742_902931755 17 Left 902931742 1:19736333-19736355 CCCACCGGGTCCCTCCCATGACC 0: 4
1: 142
2: 1374
3: 3264
4: 6447
Right 902931755 1:19736373-19736395 CCACAATTCAAGATGAGATTTGG 0: 106
1: 4288
2: 7611
3: 10206
4: 11650
902931748_902931755 3 Left 902931748 1:19736347-19736369 CCCATGACCCATGTGGATTGTGG 0: 1
1: 0
2: 49
3: 714
4: 1835
Right 902931755 1:19736373-19736395 CCACAATTCAAGATGAGATTTGG 0: 106
1: 4288
2: 7611
3: 10206
4: 11650
902931750_902931755 2 Left 902931750 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 1
2: 68
3: 927
4: 2084
Right 902931755 1:19736373-19736395 CCACAATTCAAGATGAGATTTGG 0: 106
1: 4288
2: 7611
3: 10206
4: 11650
902931747_902931755 6 Left 902931747 1:19736344-19736366 CCTCCCATGACCCATGTGGATTG 0: 1
1: 0
2: 51
3: 780
4: 2189
Right 902931755 1:19736373-19736395 CCACAATTCAAGATGAGATTTGG 0: 106
1: 4288
2: 7611
3: 10206
4: 11650
902931741_902931755 20 Left 902931741 1:19736330-19736352 CCTCCCACCGGGTCCCTCCCATG 0: 101
1: 1150
2: 2585
3: 4300
4: 5483
Right 902931755 1:19736373-19736395 CCACAATTCAAGATGAGATTTGG 0: 106
1: 4288
2: 7611
3: 10206
4: 11650
902931752_902931755 -4 Left 902931752 1:19736354-19736376 CCCATGTGGATTGTGGGAGCCAC 0: 1
1: 0
2: 3
3: 19
4: 190
Right 902931755 1:19736373-19736395 CCACAATTCAAGATGAGATTTGG 0: 106
1: 4288
2: 7611
3: 10206
4: 11650
902931744_902931755 13 Left 902931744 1:19736337-19736359 CCGGGTCCCTCCCATGACCCATG 0: 6
1: 297
2: 855
3: 2327
4: 4283
Right 902931755 1:19736373-19736395 CCACAATTCAAGATGAGATTTGG 0: 106
1: 4288
2: 7611
3: 10206
4: 11650
902931743_902931755 16 Left 902931743 1:19736334-19736356 CCACCGGGTCCCTCCCATGACCC 0: 1
1: 85
2: 895
3: 2636
4: 6231
Right 902931755 1:19736373-19736395 CCACAATTCAAGATGAGATTTGG 0: 106
1: 4288
2: 7611
3: 10206
4: 11650
902931753_902931755 -5 Left 902931753 1:19736355-19736377 CCATGTGGATTGTGGGAGCCACA 0: 1
1: 0
2: 3
3: 32
4: 248
Right 902931755 1:19736373-19736395 CCACAATTCAAGATGAGATTTGG 0: 106
1: 4288
2: 7611
3: 10206
4: 11650
902931746_902931755 7 Left 902931746 1:19736343-19736365 CCCTCCCATGACCCATGTGGATT 0: 1
1: 16
2: 554
3: 1485
4: 3368
Right 902931755 1:19736373-19736395 CCACAATTCAAGATGAGATTTGG 0: 106
1: 4288
2: 7611
3: 10206
4: 11650

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902931755 Original CRISPR CCACAATTCAAGATGAGATT TGG Intronic
Too many off-targets to display for this crispr