ID: 902931757

View in Genome Browser
Species Human (GRCh38)
Location 1:19736379-19736401
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40136
Summary {0: 7463, 1: 11190, 2: 9643, 3: 7118, 4: 4722}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902931753_902931757 1 Left 902931753 1:19736355-19736377 CCATGTGGATTGTGGGAGCCACA 0: 1
1: 0
2: 3
3: 32
4: 248
Right 902931757 1:19736379-19736401 TTCAAGATGAGATTTGGGTGAGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
902931741_902931757 26 Left 902931741 1:19736330-19736352 CCTCCCACCGGGTCCCTCCCATG 0: 101
1: 1150
2: 2585
3: 4300
4: 5483
Right 902931757 1:19736379-19736401 TTCAAGATGAGATTTGGGTGAGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
902931747_902931757 12 Left 902931747 1:19736344-19736366 CCTCCCATGACCCATGTGGATTG 0: 1
1: 0
2: 51
3: 780
4: 2189
Right 902931757 1:19736379-19736401 TTCAAGATGAGATTTGGGTGAGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
902931742_902931757 23 Left 902931742 1:19736333-19736355 CCCACCGGGTCCCTCCCATGACC 0: 4
1: 142
2: 1374
3: 3264
4: 6447
Right 902931757 1:19736379-19736401 TTCAAGATGAGATTTGGGTGAGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
902931743_902931757 22 Left 902931743 1:19736334-19736356 CCACCGGGTCCCTCCCATGACCC 0: 1
1: 85
2: 895
3: 2636
4: 6231
Right 902931757 1:19736379-19736401 TTCAAGATGAGATTTGGGTGAGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
902931746_902931757 13 Left 902931746 1:19736343-19736365 CCCTCCCATGACCCATGTGGATT 0: 1
1: 16
2: 554
3: 1485
4: 3368
Right 902931757 1:19736379-19736401 TTCAAGATGAGATTTGGGTGAGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
902931744_902931757 19 Left 902931744 1:19736337-19736359 CCGGGTCCCTCCCATGACCCATG 0: 6
1: 297
2: 855
3: 2327
4: 4283
Right 902931757 1:19736379-19736401 TTCAAGATGAGATTTGGGTGAGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
902931750_902931757 8 Left 902931750 1:19736348-19736370 CCATGACCCATGTGGATTGTGGG 0: 1
1: 1
2: 68
3: 927
4: 2084
Right 902931757 1:19736379-19736401 TTCAAGATGAGATTTGGGTGAGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
902931752_902931757 2 Left 902931752 1:19736354-19736376 CCCATGTGGATTGTGGGAGCCAC 0: 1
1: 0
2: 3
3: 19
4: 190
Right 902931757 1:19736379-19736401 TTCAAGATGAGATTTGGGTGAGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
902931748_902931757 9 Left 902931748 1:19736347-19736369 CCCATGACCCATGTGGATTGTGG 0: 1
1: 0
2: 49
3: 714
4: 1835
Right 902931757 1:19736379-19736401 TTCAAGATGAGATTTGGGTGAGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type